Page 1 of 20in PresS. Am J Physiol Gastrointest Liver Physiol (December 14, 2006). doi:10.1152/ajpgi.00493.2006 Articles
1 DELAYED LIVER REGENERATION IN MICE LACKING LIVER SERUM RESPONSE FACTOR
M. Ujue Latasa1, Dominique Couton1, Claude Charvet1, Aurélie Lafanechère1, JacquesEmmanuel Guidotti1, Zhenlin Li2, David Tuil1, Dominique Daegelen1, Claudia Mitchell1 and Hélène Gilgenkrantz1.
Running Head : SRF is a new player involved in liver regeneration Institut Cochin, Genetic and Development Department U.567 INSERM, CNRS UMR8104, Université R. Descartes, Paris, 75014 France. 2. CNRS UMR 7079, Université Pierre et Marie Curie, 7 quai St Bernard, 75005 Paris, France. Address correspondence to: Hélène Gilgenkrantz, Institut Cochin, Genetics and Development Department, 24 Rue du Fbg St. Jacques, 75014 Paris, France. Tel : (33) 1 44 41 24 39, Fax : (33) 1 44 41 24 21. E-mail:
[email protected]
Abstract Various immediate early genes (IEGs) up-regulated during the early process of liver regeneration are transcriptional targets of the Serum Response Factor (SRF). We show here that the expression of SRF is rapidly induced in rodent liver after partial hepatectomy. Because the inactivation of the SRF gene in mice is embryonic lethal, the in vivo role of SRF in liver regeneration after partial hepatectomy was analyzed in mutant mice conditionally deleted for SRF in the liver. We demonstrate that SRF is not an essential factor for liver ontogenesis. However, adult mutant mice show impaired liver regeneration after partial hepatectomy, associated with a blunted up-regulation of various SRF target IEGs. In conclusion, our work suggests that SRF is an early-response transcription factor that may contribute to the initial phases of liver regneration through its activation of immediate early genes.
Copyright © 2006 by the American Physiological Society.
Page 2 of 20
2 Introduction The liver presents a remarkable capacity to regenerate after injury. Most of our knowledge on liver regeneration derives from studies performed after 2/3 partial hepatectomy (PH) in rodents. In response to this surgical procedure, the remnant hepatocytes enter the cell cycle in a highly synchronized manner and restore the lost mass in 1 to 2 rounds of cell division. The first critical phase, initiated a few minutes after PH, is called the priming phase and shows the induction of immediate early genes (IEGs) at both transcriptional and translational levels (26). It corresponds to the exit of the hepatocytes from G0 quiescent state, rendering them susceptible to a set of factors leading to their progress through the cell cycle (9). SRF is a ubiquitously expressed transcription factor that binds as a homodimer to the CArG box sequence and requires a MADS (MCM1, Agamous, Deficiens, Serum response factor) box for its transcriptional activity (27). SRF-directed gene activation has been observed at different stages of the cell cycle (11). Moreover, an essential involvement of SRF has been assumed in the control of proliferation and cell-cycle progression (24). Total gene invalidation of SRF is embryonic lethal in mouse at the onset of gastrulation (1). Because SRF is a transcription factor responsible for the induction of IEGs (25), among which some are normally up-regulated in the liver during the priming phase after PH, such as c-fos, Egr-1, JunB or pip92, (4),(30), we wondered if it could play a role in liver regeneration. Using the conditional knockout Cre-Lox strategy, we therefore investigated whether genetic disruption of SRF expression in the liver could affect the normal liver development and the hepatic proliferative response following 70% hepatectomy. We show here that conditionally deleted animals displayed impaired regenerative response after partial hepatectomy. This phenotype was associated with delayed expression of cell cycle-regulatory proteins and impaired induction of various SRF target IEGs, such as c-fos, Egr-1 and JunB.
Page 3 of 20
3 Material and Methods Animals and Surgery. Alfp-Cre mice (14) were bred with SRF-exon 2-floxed homozygous mice (SRFf/f) (23) to obtain double transgenic mice SRFf/+Cre+ with a mixed genetic background (129sv, Balb/c, C57Bl/6). Further crosses between SRFf/+Cre+ and SRFf/fCre- mice were used to obtain SRFf/fCre+ or SRFf/fCremice. The SRF allele is constitutively deleted for exon 2. Eight to 12 week old SRF f/f Cre+ and SRF f/f
Cre- mice were subjected to sham operation or two third hepatectomy (PH) between 9 am to 12 pm
as described by Higgins and Anderson(12) under general anesthesia with inhaled isoflurane (n=4 for each genotype and time point). Animals were killed at different times after surgery. Sham animals were operated without any liver resection. Livers were harvested either into formalin for histological evaluation and proliferation studies or snap-frozen into liquid nitrogen for mRNA preparations or cellular lysate preparations. All experiments were conducted in accordance with European guidelines for the care and use of laboratory animals.
PCR analysis of SRF gene deletion Cre recombinase-mediated excision of the floxed Srf allele was detected by PCR on DNA from different
organs
using
primers
SF1:
5’-CTGTAAGGGATGGAAGCAGA-3’,
SF2:
5’-
ATAGGGACAGTGAGGTCCCTA-3’ and SF3: 5’-TTCGGAACTGCCGGGCACTAAA-3’. PCR cycles were as follows: SF1-SF3: 94°C for 4 min, followed by 25 cycles of 94°C for 30 sec, 50°C for 30 sec, and 72°C for 1 min; SF1-SF2: 94°C for 4 min, followed by 25 cycles of 94°C for 1 min, 56°C for 1 min, and 72°C for 1 min. The internal probe SF int: 5’-GCAGATGTAGCTCTCATCGT-3’ was used for hybridization with PCR products. Position of primers is indicated in Fig 1. TBP (TATA box binding protein) mouse gene was used to normalize the measurements using oligonucleotides TBP-F: 5’-AAGAGAGCCACGGACAACTG-3’, TBP-R: 5’-TACTGAACTGCTGGTGGGTC-3’.
Northern blot analysis
Page 4 of 20
4 Total RNA was extracted from frozen liver tissue using trizol reagent (Invitrogen, Carlsbad, CA). 20 µg of total RNA were size-fractionated by gel electrophoresis on 1% agarose under denaturing conditions, transferred to Hybond N+ (Amersham, Pharmacia Biotech), and hybridized with p32labeled probes.
RT-PCR analysis For RT-PCR, the first-strand cDNA synthesis was performed with 5µg of total RNA in a final volume of 20 µl according to the manufacturer’s instructions (Promega). One µl of this reaction was used for PCRs using oligonucleotides SF4: 5’-TCATCGACAACAAGCTGCGGCGCT-3’, SF5:5’CAGGTAGTTGGTGATGGGGAAGGA-3’. PCR cycles were as follows: 94°C for 4 min, followed by 25 cycles of 94°C for 30 sec, 55°C for 20 sec, and 72°C for 30 sec.
Quantitative RT-PCR analysis Quantitative RT-PCR analysis was carried out using standard protocols (Invitrogen Superscript II reverse transcriptase) and in duplicate on a LightCycler apparatus with the LightCycler-fastStart DNA Master SYBR Green I kit (Roche Diagnostics). We used 18S rRNA to normalize the data. A minimum of 3 samples was run for each experimental group. The following primers were used:SF4 and SF5; Egr1F: 5’ AACACTTTGTGGCCTGAACC 3’; Egr1R: 5’AGGTCTCCCTGTTGTTGTGG 3’; c-myc: Quantitect primer assay kit (Qiagen). 18S-F: 5’GATACCCGTTGAACCCCATT 3’; 18SR: 5’CCATCCAATCGGTAGTAGCG 3’.
Western blot analysis Liver lysates were prepared by homogenization and mixed in 2X Laemmli sample buffer. 40µg protein were resolved by SDS-PAGE in 12% polyacrylamide gels and transferred to nitrocellulose.
Page 5 of 20
5 Blots were incubated with anti-cyclin A (Santa Cruz, CA, C-19, 1:200), anti-cyclin E (Santa-Cruz, CA, M-20, 1:200), and anti- -tubulin (Sigma, GTU88, 1:200). Proteins were visualized by enhanced chemiluminescence (Amersham) using Kodak BioMax films.
Measurement of hepatocyte proliferation. Cell proliferation was assessed by bromodeoxyuridine (BrdUrd) (Sigma-aldrich St. Louis, MO) incorporation into nuclei. Mice received an intraperitoneal injection of BrdUrd at 50 mg/kg 2 hours before killing. Liver samples were fixed in 10% phosphate-buffered formalin and embedded in paraffin. BrdUrd immunostaining was performed using a biotinylated monoclonal primary antibody (DAKO, Glostrup, Denmark) and revealed with the Vectastain Elite ABC kit (Vector, Burlingame, USA) according to the manufacturer’s instructions. The proportion of BrdUrd positive nuclei was determined by counting 2,000 hepatocytes per animal.
Statistical analysis Statistical analyses were performed using the software Statview 4.5. Data sets were compared by using Student t-test and one way analysis variance. Non-normally distributed data were compared by using the Mann-Whitney test (kinetics study of BrdUdr incorporation). Data are represented as mean + SEM with the following symbols indicating the level of significance: **, p
