Articles in PresS. Am J Physiol Regul Integr Comp Physiol (December 31, 2008). doi:10.1152/ajpregu.90673.2008
Expression of rainbow trout glucose transporters GLUT1 and GLUT4 during in vitro muscle cell differentiation and regulation by insulin and IGF-I
Mònica Díaz, Yoryia Vraskou, Joaquim Gutiérrez and Josep V. Planas1
Departament de Fisiologia, Facultat de Biologia, Universitat de Barcelona and Institut de Biomedicina de la Universitat de Barcelona (IBUB), Barcelona, Spain
1
Corresponding author: Dr Josep V. Planas; Avinguda Diagonal 645 08028 Barcelona;
Tel: +34 934939384; Fax: +34 934110358; e-mail:
[email protected]
Short title: GLUT4 expression in fish muscle cells
1 Copyright © 2008 by the American Physiological Society.
Abstract
Insulin is an important factor for the maintenance of glucose homeostasis, enhancing glucose uptake in its target tissues in a process that has been conserved between fish and mammals. In fish skeletal muscle cells, like in mammals, insulin promotes GLUT4 translocation to the plasma membrane and, consequently, glucose uptake but its role regulating the expression of glucose transporters in vitro has not been demonstrated to date. Thus, we investigated the expression of GLUT4 and GLUT1 throughout skeletal muscle cell differentiation and their regulation by insulin and IGF-I using a primary culture of trout muscle cells. GLUT4 expression gradually increased during the muscle cell differentiation process, whereas GLUT1 expression remained fairly constant. Insulin and IGF-I similarly increased the mRNA levels of GLUT4 in myoblasts and myotubes. On the other hand, IGF-I appeared to be more potent than insulin in stimulating GLUT1 expression, particularly at the myoblast stage. Therefore, this work provides the first demonstration in non-mammalian vertebrates that insulin and IGF-I may act directly on trout muscle cells to regulate the expression of GLUT4 and GLUT1.
Keywords: GLUT4, GLUT1, insulin, IGF-I, muscle cells, trout
2
Introduction
Insulin is an anabolic hormone that plays a key role in carbohydrate metabolism, promoting the storage and synthesis of carbohydrates and inhibiting their degradation. Therefore, insulin is an essential hormone for the maintenance of glucose homeostasis (40). In mammals, skeletal muscle is the main tissue contributing to the removal of glucose from the blood to maintain normoglycemia upon insulin stimulation (50). Insulin enhances glucose uptake in skeletal muscle primarily by increasing the presence of the facilitative glucose carrier GLUT4 in the sarcolemma of muscle fibers (38). In addition to this acute effect of insulin on the subcellular localization of GLUT4, insulin stimulates the expression of GLUT4, as well as of GLUT1, in muscle and fat cells (29). GLUT4 expression is also known to increase with the progression of the myogenic differentiation process (30, 41) which entails an increase in insulin-stimulated glucose transport (30). Furthermore, the expression of GLUT4 in skeletal muscle is also stimulated by IGF-I (4), a hormone primarily involved in the control of skeletal muscle growth and differentiation (17) but also involved in metabolic regulation, evidenced by its stimulatory effects on glucose uptake in muscle cells (4).
In non-mammalian vertebrates, such as teleost fish, insulin also has an important metabolic role stimulating the entry of nutrients into the cells. Insulin is generally considered a hypoglycemic hormone in teleost fish (32) but its role regulating glucose homeostasis could be somewhat different than in mammals. In fact, the stimulatory effects of insulin on glucose uptake by skeletal muscle, which accounts for more than 50% of the body weight, are known only for certain species of fish (1, 42). Moreover, insulin accelerates the rates of protein synthesis and amino acid uptake in order to
3
promote muscle growth (31). Recently, insulin has been shown to directly stimulate the uptake of glucose and amino acids by trout muscle cells in culture (9) and IGF-I shares the same effects, supporting the notion that insulin and IGF-I may directly regulate carbohydrate and protein metabolism in trout skeletal muscle. In brown trout, skeletal muscle (red and white) accounts for approximately half of the total glucose uptake by tissues despite having the lowest glucose uptake rates and is the only tissue which increases its glucose uptake rate in response to a glucose load (5). Therefore, skeletal muscle can be considered a major contributor of glucose disposal from the blood in fish and its ability to regulate its glucose uptake rate suggests the possible involvement of a regulatable facilitative glucose transport system. However, it should be noted that glucose entry into skeletal muscle could also be determined by changes in hexokinase activity and intracellular glucose concentrations (28).
Fish skeletal muscle has been shown to express several isoforms of facilitated glucose transporters. To date, four members of the family of facilitated glucose transporters (GLUT1-4) have been cloned and identified in different species of teleost fish (7, 20-22, 27, 35, 44, 45, 49). In particular, GLUT1 and GLUT4 are expressed in fish skeletal muscle (8, 12, 22, 35, 43). Functional studies of fish GLUT1 and GLUT4 homologs expressed in Xenopus oocytes have demonstrated that these transporters are indeed able to transport glucose and that they differ in their affinity for glucose, being that for GLUT4 higher than that for GLUT1, albeit lower than that of their mammalian counterparts (7, 43). In addition, we have recently shown that insulin directly stimulates glucose uptake in trout muscle cells by increasing the abundance of GLUT4 at the plasma membrane, like in mammals (11). Nevertheless, little is known about the regulation of the expression of fish GLUT4 by insulin or IGF-I. Previous in vivo studies
4
from our laboratory have shown a direct correlation between blood insulin levels and mRNA and protein expression levels of GLUT4 in trout red skeletal muscle (8, 12). In contrast to GLUT4, GLUT1 mRNA expression in both white and red trout skeletal muscle remained invariable to the changes in plasma insulin (8). All these observations indicate that fish GLUT4 and GLUT1 are structural and functional homologs of mammalian GLUT4 and GLUT1, respectively.
The aim of this work was to investigate the expression of GLUT4 and GLUT1 throughout trout muscle differentiation, the regulation of the expression of these transporters by insulin and IGF-I in myoblasts and myotubes as well as glucose uptake under basal and insulin-stimulated conditions in myoblasts and myotubes. To address this issue we used a primary culture of trout muscle satellite cells, a system that can reproduce the differentiation process taking place in skeletal muscle, shows insulin and IGF-I binding (10) and which has been used to study the direct metabolic effects of insulin and IGF-I in trout muscle (9). The results from our study indicate that the basal expression of GLUT4, but not of GLUT1, markedly increases throughout the differentiation process of trout skeletal muscle cells and that the expression of both GLUT4 and GLUT1 is stimulated by insulin and IGF-I in myoblasts and myotubes.
Materials and Methods
Animals Rainbow trout (Oncorhynchus mykiss) of 5-10 g were purchased from the Piscifactoria Truites del Segre (Oliana, Lleida, Spain) and were maintained in the facilities of the Faculty of Biology at the University of Barcelona in a closed-water flow circuit with
5
water at a temperature of 12ºC. Animals were fed ad libitum with a commercial diet and fasted 24 h prior to the experiments. Brown trout (Salmo trutta) of 5-10 g, obtained from the Piscifactoria de Bagà (Generalitat de Catalunya; Barcelona, Spain), were maintained and fed under the same conditions as described above. The experimental protocols used for trout in this study have been reviewed and approved by the Ethics and Animal Welfare Committee of the University of Barcelona, Spain.
Isolation of trout muscle satellite cells Animals (40 to 80 for each isolation) were sacrificed by a blow to the head and immersed in 70% ethanol for 30 seconds to sterilize external surfaces. Muscle satellite cells from rainbow trout and brown trout were isolated and cultured following a protocol previously described (10, 15), with some modifications. Briefly, after removal of the skin, dorsal white muscle was isolated in sterile conditions and collected in DMEM medium containing 9 mM NaHCO3, 20 mM Hepes, 15% horse serum and antibiotic-antimycotic cocktail (100 U/ml penicillin, 100 μg/ml streptomycin, 25 μg/ml amphotericin B, 75 μg/ml gentamycin) at pH 7.4. After mechanical dissociation of the muscle in small pieces, the tissue was enzymatically digested with a 0.2% collagenase solution in DMEM for 1 h at 18ºC and gentle shaking. The suspension was centrifuged (300 g for 10 min at 15ºC) and the resulting pellet was subjected to two rounds of enzymatic digestion with a 0.1% trypsin solution in DMEM for 20 min at 18ºC and gentle agitation. After each round of trypsinization the suspension was centrifuged and the supernatant was diluted in 4 volumes of cold DMEM supplemented with 15% horse serum and the same antibiotic-antimycotic cocktail mentioned before. After two washes with DMEM, the cellular suspension was filtered through 100 and 40 μm nylon filters. Cells were counted and cultured on 6-well plates (NUNC, Roskilde, Denmark) at a
6
density of 3-4x106 cells/well. Plates were previously treated with poly-L-lysine and laminin to facilitate satellite cell adhesion. Media and chemicals used in the isolation procedure were obtained from Sigma (Tres Cantos, Spain).
Cell culture Trout muscle cells were maintained at 18ºC with DMEM containing 9 mM NaHCO3, 20 mM Hepes, 10% fetal bovine serum and antibiotic-antimycotic cocktail (100 U/ml penicillin, 100 μg/ml streptomycin, 25 μg/ml amphotericin B) under an air atmosphere. After 24 h of plating, plates were washed to eliminate those cells not adhered to the well. Medium was routinely renewed each 24 or 48 h. All cultures were monitored by observation with an inverted microscope (Zeiss Axiovert 25).
RNA isolation and cDNA synthesis Total RNA from muscle cells incubated in the absence or presence of salmon insulin (kindly donated by Dr. Erika Plisetskaya) or trout IGF-I (IBT Systems, Reutlingen, Germany) was purified using the Nucleospin RNA II kit (Macherey-Nagel, Düren, Germany). The cDNA synthesis reaction was performed using 1 μg of total RNA and a final concentration of 5 mM MgCl2, 1x Mg-free PCR buffer, 1 mM dNTPs, 2 U/μl RNase OUT (Invitrogen, Prat de Llobregat, Spain), 2.5 U/μl MuLV reverse transcriptase (RT) (Applied Biosystems, Barcelona, Spain) and 2.5 μM Random Hexamers (Applied Biosystems) in a total volume of 20 μl. Tubes were incubated at room temperature for 10 min and reverse transcription was performed using a thermocycler (PTC-200, MJ Research, Waltham, United States) at 42oC for 50 min followed by 95oC for 10 min to inactivate the RT.
7
GLUT4 and GLUT1 expression analysis by real-time PCR cDNA from rainbow trout muscle cells was amplified with the LightCycler FastStart DNA MasterPLUS SYBR Green I kit (Roche, Sant Cugat del Vallès, Spain) by real-time quantitative PCR using a LightCycler instrument and software (Roche). cDNA was diluted 1:5 to detect GLUT4 and GLUT1, whereas it was diluted 1:400 to detect ribosomic RNA 18S. Primers used for trout GLUT4 (AF247395), GLUT1 (AF247728) and 18S (AF308735) amplification were designed using Wisconsin Package Version 9.0 (Genetics Computer Group) and their sequences are shown in Table 1. Final concentration of each primer was 0.4 μM in all cases.
The following settings in the LightCycler instrument were used to amplify GLUT4. An initial activation step of 10 min at 95ºC was followed by 3-step cycling (40 cycles): 5 s at 95ºC (denaturation), 8 s at 60ºC (annealing), 11 s at 72ºC (extension). Fluorescent data were acquired after each extension phase for 2 s at 85ºC. All steps had a temperature transition rate of 20ºC/s. After amplification, a melting curve analysis from 60ºC to 95ºC with heating rate of 0.05ºC/s with a continuous fluorescence acquisition was done. Protocols used for GLUT1 and 18S detection only differed in annealing temperature (65ºC and 50ºC for GLUT1 and 18S, respectively), fluorescence quantification temperature (87ºC for 18S) and extension time (9 s for GLUT1 and 18S). PCR specificity was routinely checked by the melting curve obtained from the software and by agarose gel electrophoresis, where only one DNA fragment of expected size was observed in all cases. In parallel to the samples, a standard curve generated with serial dilutions of plasmid containing the target sequence (GLUT4, GLUT1 or 18S) was included in each run. Concentration values expressed as arbitrary units were assigned to each dilution. Ct values obtained from standards were used by the software to generate
8
a standard curve and interpolate sample Ct values. GLUT4 and GLUT1 expression in each sample was normalized using the ribosomic RNA 18S as a housekeeping gene. Real-time PCR assays were conducted in duplicate for each sample.
Glucose uptake measurements Rainbow trout muscle cells isolated and maintained as described above were cultured for 2 and 10 days and at the day of the experiment cells were serum starved for 4 h and subsequently preincubated in the absence or presence of human insulin (1000 nM) for 30 min at 18ºC. After the preincubation, cells were washed twice with PBS and incubated with HEPES buffered saline containing 50 μM 2-deoxyglucose (2 μCi/ml 2[3H]-DG) for 30 min at 18oC. After this period, transport solution was removed and cells were rinsed three times with ice-cold PBS containing 50 mM 2-DG. Finally, cells were lysed with 0.1 N NaOH, 0.1% SDS and the radioactivity was determined by scintillation counting using a β-counter (Packard Bioscience, Meriden, CT). Protein concentration was measured by the Bradford method (6). Non-specific uptake was carried out with the presence of 50 μM cytochalasin B in the transport solution, and these values were subtracted from all other values.
Statistical analysis In all the experiments described, statistical significance was determined by one-way ANOVA, followed by the Fisher’s Protected Least Significant Difference test (13).
9
Results
GLUT4 and GLUT1 expression during trout muscle cell differentiation In trout muscle cells, GLUT4 and GLUT1 mRNA levels were examined throughout trout myoblast differentiation by quantitative real-time PCR. In all cultures, a significant increase in the expression of GLUT4 was observed (Fig. 1A) in parallel with the progression of myoblast differentiation, from spindle-shaped mononucleated cells during the first days of culture to the formation of large myotubes at day 10 in culture (data not shown). The magnitude of the change of GLUT4 expression between nondifferentiated (day 1; myoblasts) and differentiated cells (day 10; myotubes) was in the range of 8- to 56-fold. In contrast, the expression of GLUT1 remained more constant than that of GLUT4 (Fig. 1B), reaching maximal increases of 2-fold over day 1 in all the experiments.
Time-related effects of insulin treatment on GLUT4 and GLUT1 expression in trout muscle cells In order to study the time-dependence of the hormonal regulation of the expression of GLUT4 and GLUT1, trout muscle cells at day 5 of culture (at an intermediate timepoint in the differentiation process) were serum-deprived for 4 h and subsequently incubated in the absence or presence of 100 nM salmon insulin during different periods of time. Insulin stimulated the expression of GLUT4 as early as 3 h after treatment, although no statistically significant increase was observed until 6 h of incubation. This stimulatory effect was observed up to 18 h, reaching maximal stimulation of approximately 2.5-fold over the non-stimulated controls (Fig. 2A). Similarly, insulin significantly increased the expression of GLUT1 at 12 h and 18 h of incubation (Fig. 2B).
10
Dose-related effects of insulin and IGF-I on GLUT4 and GLUT1 expression in trout muscle cells After 5 days in culture, cells previously deprived of serum were incubated with increasing concentrations of insulin and IGF-I during 18 h and the relative expression of GLUT4 and GLUT1 was quantified. In trout muscle cells treated with insulin, GLUT4 expression increased in response to insulin at doses as low as 10 nM and achieved its maximum levels when cells were incubated with 1000 nM insulin (4.83 ± 0.45 fold over basal) (Fig. 3A). Furthermore, IGF-I significantly increased the amount of GLUT4 mRNA, although it appeared to have a maximal effect at a dose of 10 nM. GLUT1 mRNA expression also increased in response to both hormones (Fig. 3B). In the case of insulin treatment, a significant stimulatory effect on GLUT1 expression was observed only at the 1000 nM dosage. IGF-I also caused a significant increase of GLUT1 mRNA at doses as low as 10 nM.
Insulin and IGF-I effects on GLUT4 and GLUT1 expression in relation to the state of trout muscle cell differentiation The effects of insulin and IGF-I on GLUT4 and GLUT1 expression were examined at different stages during the trout muscle cell culture: at day 2 (undifferentiated cells; myoblasts) and at day 10 (differentiated cells; myotubes). Insulin (100 nM) caused a similar increase in GLUT4 expression at day 2 and at day 10 (Fig. 4A). In contrast, GLUT1 mRNA levels did not increase significantly in trout muscle cells treated with insulin after day 2 or 10 of culture (Fig. 4B). Like insulin, IGF-I (10 nM) caused a similar increase in the expression of GLUT4 at days 2 and 10 (Fig. 4A). However, IGFI strongly and significantly induced GLUT1 expression in trout muscle cells at day 2 (up to approximately 12-fold) and, to a lesser extent (approximately 3-fold), at day 10
11
(Fig. 4B). It should be noted that in these experiments the basal expression of GLUT4 and GLUT1 was lower in myoblasts than in myotubes (data not shown), as observed in the cell differentiation experiments (Fig. 1).
Glucose transport characteristics of trout muscle cells In order to examine the functional consequence of the changes in glucose transporter expression in trout muscle cells, we investigated the uptake of glucose under basal and insulin-stimulated conditions in trout muscle cells at day 2 and at day 10 of culture. Our results indicate that, in parallel to the increase in the basal expression of GLUT4 and, to a much lesser extent, GLUT1 in trout muscle cells, insulin-stimulated glucose uptake significantly increased between day 2 (1.7 fold) and day 10 (2.5-fold) (Fig. 5). Basal glucose uptake did not show statistically significant differences between day 2 and day 10 (3.27 ± 0.77 and 4.62 ± 0.71 pmol 2-DG/μg protein, respectively).
Discussion In the present study, we examined the expression of the glucose transporters GLUT4 and GLUT1 throughout the course of in vitro differentiation of trout muscle cells and its regulation by insulin and IGF-I. For this purpose we used a well-characterized primary culture of trout skeletal muscle cells (10, 15, 36, 37) that provides a useful tool to reproduce the muscle differentiation process in vitro and study the biology of fish muscle cells. Importantly, trout muscle cells have receptors for insulin and IGF-I and IGF-I binding has been shown to gradually increase during myogenesis (10, 33).
The results of the present study indicate that the amount of GLUT4 mRNA gradually increased throughout the differentiation process of trout muscle cells in culture from
12
myoblasts to myotubes, supporting our recent observation that the amount of immunoreactive endogenous GLUT4 protein in cultured trout muscle cells is higher in myotubes than in myoblasts (11). These data are in agreement with previous studies on human myosatellite cells in culture (2) which demonstrated that GLUT4 expression is higher in myotubes than in myoblasts. In the same way, Guillet-Deniau et al. (18) observed that GLUT4 mRNA was not present in muscle satellite cells isolated from rat fetuses until 11 days of culture. This feature has also been described in the mouse muscle cell line C2C12 (41). In contrast, GLUT4 expression dramatically decreased with de-differentiation of adult rat cardiomyocytes (39). For this reason the GLUT4 gene is often used as a marker of muscle differentiation (19, 24) and the results of the present study would support the notion that the increase in the expression of GLUT4 throughout the process of muscle cell differentiation represents an evolutionary conserved feature of skeletal muscle in vertebrates.
One of the major objectives of this study was to investigate the regulation of GLUT4 mRNA levels in trout muscle cells by insulin and IGF-I. We show here that GLUT4 expression is stimulated by insulin and IGF-I in trout muscle cells and that the response is similar in cells at the myoblast and myotube stages. Our results are in agreement with previous studies using human muscle satellite cells in primary culture (3), rat cardiomyocytes (34) and fetal brown adipocytes (47). Conversely, studies using muscle and adipogenic cell lines such as L6 or 3T3-L1 cells, respectively, have reported a down-regulatory effect of insulin and IGF-I on GLUT4 gene expression (16, 26). The observed ability of insulin to stimulate GLUT4 mRNA expression in vitro in trout muscle cells is consistent with the results of a previous in vivo study from our group that established a relationship between insulin plasma levels and GLUT4 mRNA levels in
13
skeletal muscle in trout (8). More recently, we have shown that insulin and arginine administration increase whereas fasting decreases GLUT4 protein content in trout skeletal muscle (12), supporting the notion that circulating insulin may regulate the expression of GLUT4, both at the mRNA and protein levels, in skeletal muscle. Therefore, the present study provides the first evidence in fish (and in non-mammalian vertebrates) that insulin is able to regulate GLUT4 mRNA content in trout skeletal muscle by exerting its function directly on muscle cells. Furthermore, we suggest that insulin may increase GLUT4 mRNA levels in trout muscle cells by stimulating the transcriptional activity of the GLUT4 gene. Although the trout GLUT4 promoter has not yet been identified, several putative binding sites for transcription factors such as MEF2, MyoD and C/EBP have been found in the sequence of GLUT4 promoter from another teleost fish, Fugu rubripes (Morata and Planas, unpublished data). These same response elements have been identified in the mammalian GLUT4 promoter and have been involved in the tissue-specific and insulin-regulated expression of GLUT4 (14, 23, 46). Current studies in our laboratory are aimed at the identification and functional characterization of teleost GLUT4 promoter regions.
In mammals, GLUT1 is the other major GLUT isoform expressed in skeletal muscle, together with GLUT4 (25). The levels of GLUT1 mRNA increased modestly during the in vitro differentiation of trout muscle cells, in contrast to what is known in mammals (2, 18, 41, 48). In addition, the effects of insulin on GLUT1 expression did not appear to be very consistent since insulin stimulated the expression of GLUT1 in day-5 myocytes (requiring 100 nM in the time-course experiments and 1000 nM in the doseresponse experiments) but not in muscle cells at day-2 (myoblasts) or day-10 (myotubes). We have previously reported that GLUT1 expression in trout skeletal
14
muscle was not affected by changes in the circulating levels of insulin (8), suggesting that insulin is not a major player in the regulation of GLUT1 expression in trout skeletal muscle. In mammalian primary cultures of adipocytes and myosatellite cells, GLUT1 expression does not change in response to an insulin treatment (3, 18, 23). Interestingly, in the trout muscle cell culture IGF-I caused a marked increase in GLUT1 expression at day 2 and a more modest increase at day 10. Since IGF-I is also known to stimulate the proliferation of trout myoblasts (9), it is possible that the increased expression of GLUT1 could contribute to a greater fuel intake to face the increased energy demand imposed by the proliferative activity of IGF-I.
The increase in the expression of GLUT1 and, more importantly, GLUT4 during in vitro differentiation of trout muscle cells was accompanied by a significant increase in the insulin-stimulated uptake of glucose, similar to the situation in mammalian cells (30). These results suggest that the number of functional glucose transporter molecules increased in trout muscle cells during the in vitro differentiation process. Since insulin increases glucose uptake in trout muscle cells by stimulating the translocation of endogenous GLUT4 to the plasma membrane (11), the higher insulin-stimulated glucose uptake in myotubes (day 10) over myoblasts (day 2) could be explained by an increase in the amount of newly-synthesized GLUT4 molecules (as suggested by the higher basal expression of GLUT4 in myotubes) that contribute to the insulinresponsive compartment and that could be mobilized to the plasma membrane in response to insulin.
Perspectives and Significance The results from the present study on the differentiation-induced expression of GLUT4, and to a much lesser extent of GLUT1, and on the ability of insulin and IGF-I to 15
directly stimulate GLUT1 and GLUT4 expression in trout muscle cells indicate that the mechanisms regulating the expression of GLUT1 and GLUT4 in skeletal muscle are already present in fish. Due to the similarities in the regulation of GLUT1 and GLUT4 expression between fish and mammals, it is evident that these mechanisms have been remarkably well conserved during vertebrate evolution, underscoring the importance of the maintenance of glucose homeostasis throughout vertebrates. The present results, coupled with the known stimulation of GLUT4 translocation to the plasma membrane by insulin in trout muscle cells (11), support the idea that the relative glucose intolerance of teleost fish, and in particular of salmonid fish, may not be explained by peripheral resistance to insulin. Instead, the lower ability of fish to clear a glucose load could be due, at least in part, to the lower affinity for glucose of fish GLUT1 (43) and GLUT4 (7), when compared to mammals.
16
Acknowledgements
This work was funded by grants AGL2002-03987 and AGL2005-01230 (J.V.P). M.D. was supported by a fellowship from the Departament d’Universitats, Recerca i Societat de la Informació (Generalitat de Catalunya) and Y.V. was supported by a FPI fellowship from the Spanish Ministry of Education and Science.
17
References
1.
Ablett RF, Sinnhuber RO, Selivonchick DP. The effect of bovine insulin on
[14C]glucose and [3H]leucine incorporation in fed and fasted rainbow trout (Salmo gairdneri). Gen Comp Endocrinol 44: 418-427, 1981. 2.
Al-Khalili L, Chibalin AV, Kannisto K, Zhang BB, Permert J, Holman GD,
Ehrenborg E, Ding VD, Zierath JR, Krook A. Insulin action in cultured human skeletal muscle cells during differentiation: assessment of cell surface GLUT4 and GLUT1 content. Cell Mol Life Sci 60: 991-998, 2003. 3.
Al-Khalili L, Forsgren M, Kannisto K, Zierath JR, Lonnqvist F, Krook A.
Enhanced insulin-stimulated glycogen synthesis in response to insulin, metformin or rosiglitazone is associated with increased mRNA expression of GLUT4 and peroxisomal proliferator activator receptor gamma co-activator 1. Diabetologia 48: 1173-1179, 2005. 4.
Bilan PJ, Mitsumoto Y, Ramlal T, Klip A. Acute and long-term effects of
insulin-like growth factor I on glucose transporters in muscle cells. Translocation and biosynthesis. FEBS Lett 298: 285-290, 1992. 5.
Blasco J, Fernandez-Borras J, Marimon I, Requena A. Plasma glucose
kinetics and tissue uptake in brown trout in vivo: Effect of an intravascular glucose load. J Comp Physiol B-Biochem System Environ Phys 165: 534-541, 1996. 6.
Bradford MM. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254, 1976. 7.
Capilla E, Diaz M, Albalat A, Navarro I, Pessin JE, Keller K, Planas JV.
Functional characterization of an insulin-responsive glucose transporter (GLUT4) from fish adipose tissue. Am J Physiol Endocrinol Metab 287: E348-357, 2004.
18
8.
Capilla E, Diaz M, Gutierrez J, Planas JV. Physiological regulation of the
expression of a GLUT4 homolog in fish skeletal muscle. Am J Physiol Endocrinol Metab 283: E44-49, 2002. 9.
Castillo J, Codina M, Martinez ML, Navarro I, Gutierrez J. Metabolic and
mitogenic effects of IGF-I and insulin on muscle cells of rainbow trout. Am J Physiol Regul Integr Comp Physiol 286: R935-941, 2004. 10.
Castillo J, Le Bail PY, Paboeuf G, Navarro I, Weil C, Fauconneau B,
Gutierrez J. IGF-I binding in primary culture of muscle cells of rainbow trout: changes during in vitro development. Am J Physiol Regul Integr Comp Physiol 283: R647-652, 2002. 11.
Diaz M, Antonescu CN, Capilla E, Klip A, Planas JV. Fish glucose
transporter (GLUT)-4 differs from rat GLUT4 in its traffic characteristics but can translocate to the cell surface in response to insulin in skeletal muscle cells. Endocrinology 148: 5248-5257, 2007. 12.
Diaz M, Capilla E, Planas JV. Physiological regulation of glucose transporter
(GLUT4) protein content in brown trout (Salmo trutta) skeletal muscle. J Exp Biol 210: 2346-2351, 2007. 13.
Dowdy S, Wearden S. Statistics for research. New York: J. Wiley and Sons,
1991. 14.
Ezaki O. Regulatory elements in the insulin-responsive glucose transporter
(GLUT4) gene. Biochem Biophys Res Comm 241: 1-6, 1997. 15.
Fauconneau B, Paboeuf G. Effect of fasting and refeeding on in vitro muscle
cell proliferation in rainbow trout (Oncorhynchus mykiss). Cell Tissue Res 301: 459463, 2000.
19
16.
Flores-Riveros JR, McLenithan JC, Ezaki O, Lane MD. Insulin down-
regulates expression of the insulin-responsive glucose transporter (GLUT4) gene: effects on transcription and mRNA turnover. Proc Natl Acad Sci U S A 90: 512-516, 1993. 17.
Florini JR, Ewton DZ, Coolican SA. Growth hormone and the insulin-like
growth factor system in myogenesis. Endocr Rev 17: 481-517, 1996. 18.
Guillet-Deniau I, Leturque A, Girard J. Expression and cellular localization
of glucose transporters (GLUT1, GLUT3, GLUT4) during differentiation of myogenic cells isolated from rat foetuses. J Cell Sci 107 ( Pt 3): 487-496, 1994. 19.
Hajduch E, Alessi DR, Hemmings BA, Hundal HS. Constitutive activation of
protein kinase B alpha by membrane targeting promotes glucose and system A amino acid transport, protein synthesis, and inactivation of glycogen synthase kinase 3 in L6 muscle cells. Diabetes 47: 1006-1013, 1998. 20.
Hall JR, MacCormack TJ, Barry CA, Driedzic WR. Sequence and
expression of a constitutive, facilitated glucose transporter (GLUT1) in Atlantic cod Gadus morhua. J Exp Biol 207: 4697-4706, 2004. 21.
Hall JR, Richards RC, MacCormack TJ, Ewart KV, Driedzic WR. Cloning
of GLUT3 cDNA from Atlantic cod (Gadus morhua) and expression of GLUT1 and GLUT3 in response to hypoxia. Biochim Biophys Acta 1730: 245-252, 2005. 22.
Hall JR, Short CE, Driedzic WR. Sequence of Atlantic cod (Gadus morhua)
GLUT4, GLUT2 and GPDH: Developmental stage expression, tissue expression and relationship to starvation-induced changes in blood glucose. J Exp Biol 209: 4490-4502, 2006.
20
23.
Hernandez R, Teruel T, Lorenzo M. Insulin and dexamethasone induce
GLUT4 gene expression in foetal brown adipocytes: synergistic effect through CCAAT/enhancer-binding protein alpha. Biochem J 372: 617-624, 2003. 24.
Kaliman P, Vinals F, Testar X, Palacin M, Zorzano A. Phosphatidylinositol
3-kinase inhibitors block differentiation of skeletal muscle cells. J Biol Chem 271: 19146-19151, 1996. 25.
Klip A, Paquet MR. Glucose transport and glucose transporters in muscle and
their metabolic regulation. Diabetes Care 13: 228-243, 1990. 26.
Koivisto UM, Martinez-Valdez H, Bilan PJ, Burdett E, Ramlal T, Klip A.
Differential regulation of the GLUT-1 and GLUT-4 glucose transport systems by glucose and insulin in L6 muscle cells in culture. J Biol Chem 266: 2615-2621, 1991. 27.
Krasnov A, Teerijoki H, Molsa H. Rainbow trout (Onchorhynchus mykiss)
hepatic glucose transporter. Biochim Biophys Acta 1520: 174-178, 2001. 28.
MacCormack TJ, Driedzic WR. The impact of hypoxia on in vivo glucose
uptake in a hypoglycemic fish, Myoxocephalus scorpius. Am J Physiol Regul Integr Comp Physiol 292: R1033-1042, 2007. 29.
McGowan KM, Long SD, Pekala PH. Glucose transporter gene expression:
regulation of transcription and mRNA stability. Pharmacol Ther 66: 465-505, 1995. 30.
Mitsumoto Y, Burdett E, Grant A, Klip A. Differential expression of the
GLUT1 and GLUT4 glucose transporters during differentiation of L6 muscle cells. Biochem Biophys Res Comm 175: 652-659, 1991. 31.
Mommsen TP. Paradigms of growth in fish. Comp Biochem Physiol B Biochem
Mol Biol 129: 207-219, 2001. 32.
Mommsen TP, Plisetskaya EM. Insulin in Fishes and Agnathans - History,
Structure, and Metabolic-Regulation. Rev Aquat Sci 4: 225-259, 1991.
21
33.
Montserrat N, Sanchez-Gurmaches J, Garcia de la Serrana D, Navarro MI,
Gutierrez J. IGF-I binding and receptor signal transduction in primary cell culture of muscle cells of gilthead sea bream: changes throughout in vitro development. Cell Tissue Res 330: 503-513, 2007. 34.
Petersen S, Bahr M, Eckel J. Insulin-dependent regulation of Glut4 gene
expression in ventricular cardiomyocytes: evidence for a direct effect on Glut4 transcription. Biochem Biophys Res Comm 213: 533-540, 1995. 35.
Planas JV, Capilla E, Gutierrez J. Molecular identification of a glucose
transporter from fish muscle. FEBS Lett 481: 266-270, 2000. 36.
Powell RL, Dodson MV, Cloud JG. Cultivation and Differentiation of Satellite
Cells from Skeletal-Muscle of the Rainbow-Trout Salmo-Gairdneri. J Exp Zool 250: 333-338, 1989. 37.
Rescan PY, Gauvry L, Paboeuf G. A gene with homology to myogenin is
expressed in developing myotomal musculature of the rainbow trout and in vitro during the conversion of myosatellite cells to myotubes. FEBS Lett 362: 89-92, 1995. 38.
Rodnick KJ, Slot JW, Studelska DR, Hanpeter DE, Robinson LJ, Geuze
HJ, James DE. Immunocytochemical and biochemical studies of GLUT4 in rat skeletal muscle. J Biol Chem 267: 6278-6285, 1992. 39.
Rosenblatt-Velin N, Lerch R, Papageorgiou I, Montessuit C. Insulin
resistance in adult cardiomyocytes undergoing dedifferentiation: role of GLUT4 expression and translocation. Faseb J 18: 872-874, 2004. 40.
Shepherd PR, Kahn BB. Glucose transporters and insulin action--implications
for insulin resistance and diabetes mellitus. N Engl J Med 341: 248-257, 1999.
22
41.
Shimokawa T, Kato M, Ezaki O, Hashimoto S. Transcriptional regulation of
muscle-specific genes during myoblast differentiation. Biochem Biophys Res Comm 246: 287-292, 1998. 42.
Tashima L, Cahill GF, Jr. Effects of insulin in the toadfish, Opsanus tau. Gen
Comp Endocrinol 11: 262-271, 1968. 43.
Teerijoki H, Krasnov A, Gorodilov Y, Krishna S, Molsa H. Rainbow trout
glucose transporter (OnmyGLUT1): functional assessment in Xenopus laevis oocytes and expression in fish embryos. J Exp Biol 204: 2667-2673, 2001. 44.
Teerijoki H, Krasnov A, Pitkanen TI, Molsa H. Cloning and characterization
of glucose transporter in teleost fish rainbow trout (Oncorhynchus mykiss). Biochim Biophys Acta 1494: 290-294, 2000. 45.
Teerijoki H, Krasnov A, Pitkanen TI, Molsa H. Monosaccharide uptake in
common carp (Cyprinus carpio) EPC cells is mediated by a facilitative glucose carrier. Comp Biochem Physiol B-Biochem & Mol Biol 128: 483-491, 2001. 46.
Thai MV, Guruswamy S, Cao KT, Pessin JE, Olson AL. Myocyte enhancer
factor 2 (MEF2)-binding site is required for GLUT4 gene expression in transgenic mice. Regulation of MEF2 DNA binding activity in insulin-deficient diabetes. J Biol Chem 273: 14285-14292, 1998. 47.
Valverde AM, Navarro P, Teruel T, Conejo R, Benito M, Lorenzo M.
Insulin and insulin-like growth factor I up-regulate GLUT4 gene expression in fetal brown adipocytes, in a phosphoinositide 3-kinase-dependent manner. Biochem J 337 ( Pt 3): 397-405, 1999. 48.
Vinals F, Fandos C, Santalucia T, Ferre J, Testar X, Palacin M, Zorzano A.
Myogenesis and MyoD down-regulate Sp1. A mechanism for the repression of GLUT1 during muscle cell differentiation. J Biol Chem 272: 12913-12921, 1997.
23
49.
Zhang Z, Wu RS, Mok HO, Wang Y, Poon WW, Cheng SH, Kong RY.
Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus. Eur J Biochem 270: 3010-3017, 2003. 50.
Zorzano A, Palacin M, Guma A. Mechanisms regulating GLUT4 glucose
transporter expression and glucose transport in skeletal muscle. Acta Physiol Scand 183: 43-58, 2005.
24
Figure Legends Figure 1. Expression of GLUT4 (A) and GLUT1 (B) during in vitro differentiation of rainbow trout muscle cells. Results shown are the mean ± SE of one representative experiment, from a total of three independent experiments, each performed in duplicate and expressed as fold change relative to day 1. Different letters indicate significant differences (p < 0.05).
Figure 2. Expression of GLUT4 (A) and GLUT1 (B) in response to different times of exposure to insulin. Rainbow trout muscle cells (day 5) were incubated in the absence (white bars) or presence (black bars) of 100 nM salmon insulin for 3, 6, 12 and 18 h. Results shown are the mean ± SE of three independent experiments (except at 3 h which were two), each performed in duplicate, and are shown compared to the basal state, which was set to 1. Different letters indicate significant differences (p < 0.05).
Figure 3. Dose-related effects of insulin and IGF-I on GLUT4 (A) and GLUT1 (B) expression. Rainbow trout muscle cells (day 5) were incubated in the absence (white bars) or presence of increasing concentrations (from 1 to 1000 nM) of salmon insulin (black bars) or trout IGF-I (grey bars). Results shown are the mean ± SE of two independent experiments, each performed in duplicate, and are shown compared to the basal state, which was set to 1. Different letters indicate significant differences (p < 0.05).
Figure 4. Effects of insulin and IGF-I on GLUT4 (A) and GLUT1 (B) expression at day 2 and 10 of culture. Rainbow trout muscle cells (day 2 or day 10) were incubated in the absence (white bars) or presence of 100 nM salmon insulin (black bars) or 10 nM trout
25
IGF-I (grey bars) for 18 h at 18oC. Results shown are the mean ± SE of two independent experiments, each performed in duplicate, and are shown compared to the basal state, which was set to 1. Different letters indicate significant differences (p < 0.05).
Figure 5. Effects of insulin on the uptake of 2-deoxyglucose (2-DG) in rainbow trout muscle cells at day 2 and day 10. Rainbow trout muscle cells were incubated in the absence or presence of insulin (1000 nM) for 30 min at 18oC. After the incubation period, 2-DG uptake assay was performed as indicated in Material and Methods. Results shown are the mean ± SE of a representative experiment performed in triplicate and are shown compared to the basal state for each time, which were set to 1. Different letters indicate significant differences (p < 0.05).
26
Table 1. - Primers used for real-time PCR
5’-3’position
Amplicon size
GLUT4_Forward 5’ GTGCCAGGCTTATTGTCCATATTC 3’
151-174
357 pb
GLUT4_Reverse
508-485
Name of primer
Primer sequence
5’ TAGAGAAGATGGCTACCGACAG 3’
GLUT1_Forward 5’ AATATCGACAAGCCACGCTG 3’
307-326
GLUT1_Reverse
5’ GAGAAGGAGCCGAAGATACC 3’
576-557
18S_Forward
5’ CGAGCAATAACAGGTCTGTG 3’
1444-1462
18S_Reverse
5’ GGGCAGGGACTTAATCAA 3’
1654-1637
1
270 pb
211 pb
