1 Mapping of Post-translational Modifications of

JBC Papers in Press. Published on March 28, 2015 as Manuscript M114.620443 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M114.620443

Mapping of Post-translational Modifications of Transition Proteins, TP1 and TP2 and Identification of Protein Arginine Methyltransferase 4 and Lysine Methyltransferase 7 as Methyltransferase for TP2. Gupta Nikhil1, Madapura M. Pradeepa2, Bhat U. Anayat1 & Rao M. R. Satyanarayana 1* 1

From the Chromatin Biology Laboratory, Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur P.O. Bangalore-560064, India.

2

Present address: MRC Human Genetics Unit, MRC Institute of Genetics and Molecular Medicine at University of Edinburgh, Crewe Road, Edinburgh EH4 2XU, UK. Running title: Post-translational modification repertoire of TP1 and TP2

*To whom correspondence should be addressed: Prof. M.R.S. Rao, Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur P.O. Bangalore-560064, India, Tel: +91-80-2208 2864; Fax: +91-80-2208 2758; Email: [email protected]

Background: Transition proteins replace 90% of the nucleosomal histones during nucleo-histone to nucleo-protamine chromatin reconfiguration in mammalian spermiogenesis. Results: Major transition proteins, TP1 and TP2 harbor several post-translational modifications. TP2 gets methylated by PRMT4 and KMT7 methyltransferase. Conclusion: Endogenous transition proteins, TP1 and TP2 exhibit extensive post-translational modifications. Significance: Provides insight into the chromatin remodeling events during spermiogenesis and establishment of the sperm epigenome.

Here, we report the identification of 16 and 19 novel post-translational modifications on rat endogenous transition proteins, TP1 and TP2 respectively, by mass spectrometry. By in vitro assays and mutational analysis, we demonstrate that protein arginine methyltransferase PRMT4 (CARM1) methylates TP2 at Arg71, Arg75 and Arg92 residues and lysine methyltransferase KMT7 (Set9) methylates TP2 at Lys88 and Lys91 residues. Further studies with modification specific antibodies which recognize TP2K88me1 and TP2R92me1 modifications showed that they appear in elongating to condensing spermatids and is predominantly associated with the chromatin bound TP2. This work establishes the repertoire of PTMs that occur on TP1 and TP2, which may play a significant role in various chromatin templated events during spermiogenesis and in the establishment of the sperm epigenome.

ABSTRACT In a unique global chromatin remodeling process during mammalian spermiogenesis, 90% of the nucleosomal histones are replaced by testisspecific transition proteins, TP1, TP2 and TP4. These proteins are further substituted by spermspecific protamines, P1 and P2, to form a highly condensed sperm chromatin. In spermatozoa, a small proportion of chromatin, which ranges from 1-10% in mammals, retain the nucleosomal architecture and is implicated to play a role in transgenerational inheritance. However, there is still no mechanistic understanding about the interaction of chromatin machinery with histones and transition proteins, which facilitate this selective histone replacement from chromatin.

INTRODUCTION Eukaryotic genomic DNA is packaged with canonical histones and its variants constituting the nucleosomal architecture of chromatin. Chromatin proteins, including histones, harbor several post-translational modifications and this epigenetic landscape of chromatin proteins along with effector proteins determines the chromatin structure and mediates several chromatin templated processes (1, 2). This chromatin architecture is continuously 1

Copyright 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Downloaded from http://www.jbc.org/ by guest on March 29, 2015

Keywords: mass spectrometry (MS), post‐translational modification (PTM), protein methylation, epigenetics, chromatin remodeling

modifications, reflecting their expression status in embryogenesis (9, 16). Recently, mouse sperm protamines also have been demonstrated to harbor post-translational modifications (17). Thus, sperm chromatin has a defined epigenetic signature and is suggested to play a fundamental role in transgenerational inheritance (17, 18). However, the mechanism of selective histone replacement at defined chromatin regions during spermiogenesis is not known (6). The genomic positioning of residual histones in sperm chromatin is determined in early spermatids when majority of the histones are replaced by transition proteins. This is indicative of a role that transition proteins may play to establish the sperm epigenome. Transition proteins are believed to have evolved in mammals (4); however, a TP-like protein has been described in drosophila (3, 19). In mammals, TPs are indispensable as TP1-/- and TP2-/- double mutant mice are infertile (20). Transition proteins TP1, TP2 and TP4 constitute 90% of chromatin basic proteins in condensing spermatids before protamine deposition. The levels of TP1 are 2.5 times that of TP2 while TP4 represents only 2% of the total basic proteins of condensing spermatids (4). TP1 is a 6kDa protein with DNA melting property (21), and stimulates DNA repair activity both in vitro and in vivo (22). TP2 is a 13kDa protein with zinc-dependent DNA and chromatin condensation property (23–26). TP2 possesses nuclear localization signal and makes an active entry into the spermatid nucleus (26, 27). TP4 is a 16kDa protein and has been demonstrated to induce DNA destabilization (28). Major transition proteins TP1 and TP2 have been shown to harbor post-translational modifications by in vitro methods. Both TP1 and TP2 get phosphorylated in vitro by PKA and PKC kinases (29). The phosphorylation of TP2 by PKA-cs results in a weaker association with DNA (30, 31). Further, TP2 gets acetylated by KAT3B (p300) which reduces its association with DNA and also its interaction with NPM3 (nuclear chaperone of TP2) (32). However, so far no study has demonstrated the identification of modification sites on the endogenous protein. Global chromatin remodeling during mammalian spermiogenesis is poorly understood with little information being available about chaperones, chromatin remodelers, DNA repair pathways, nuclear shaping, proteasomal pathways, 2


reconfigured during male germ cell differentiation. Mammalian spermatogenesis is a developmental process in which diploid spermatogonial stem cells differentiate to haploid spermatozoa. Spermiogenesis is the last phase of spermatogenesis during which haploid round spermatids undergo change in their cellular and nuclear morphology to form mature sperms, accompanied by a remarkable change in chromatin structure and composition (3–7). The nucleosomal architecture of haploid round spermatids is transformed into toroidal nucleoprotamine fiber in the mature spermatozoa in a two-step process. In the first step, intermediate basic proteins, transition proteins replace 90% of the histones. In the second step, highly basic proteins, protamines replace transition proteins to occupy 90-99% of the sperm chromatin in different mammals (3–9). In rat, spermiogenesis comprises of 19 steps, during the first 8 steps, haploid round spermatids are transcriptionally active and then it ceases in step 9 or 10 to initiate the chromatin reconfiguration process (4). Histone eviction begins with histone H4 hyperacetylation during steps 9-12, initiating the deposition of the transition proteins. Brdt, a double bromodomain protein is suggested to facilitate eviction of histones by recognizing acetylated histone H4 and through its interaction with Smarce1 (BAF57), a key member of ATP dependent remodeling complex SWI/SNF (10, 11). Transition proteins (TP1, TP2 and TP4) replace most of the histones and briefly organize the chromatin during spermiogenesis steps 12-15. Protamines (P1 and P2) gets deposited with a concomitant complete replacement of the transition proteins during steps 16-19 to decorate the sperm chromatin (3, 4). A small fraction of the sperm chromatin which is about 10% in humans and 1% in rodents remain nucleosomal at specific genomic loci (8, 9, 12). Sperm nucleosomes are largely present in intergenic and intronic regions, and associate with retrotransposable elements and centromeric repeats. A small subset of sperm nucleosomes are retained in the promoter regions of development regulatory proteins, which get activated in preimplantation embryos (13–15). Retained nucleosomes also include non-canonical histone variants H2A-Bbd, H2AL1/L2, H2BL1, TH2B and H3.3 (3). Many of the sperm nucleosomal loci exhibit characteristic active and repressive histone

chromatin modification writers, erasers and effectors involved in the chromatin restructuring events (3, 6). Based on the premise that similar to the known diverse biological functions of histone modifications, the post-translational modifications of transition proteins may also play a critical role in the chromatin restructuring process during mammalian spermiogenesis, we embarked to comprehensively identify PTMs of the two major transition proteins, TP1 and TP2. Through mass spectrometric analysis of purified endogenous TP1 and TP2, we demonstrate 16 novel modifications for TP1, and 19 novel modifications for TP2 which include arginine mono and/or dimethylation, lysine acetylation, lysine mono and/or di-methylation, serine acetylation, threonine and serine phosphorylation. Furthermore, we demonstrate PRMT4 (also known as CARM1) and KMT7 (also known as Set7/9 or Set9) as the enzymes responsible for the catalysis of arginine and lysine methylation of TP2 respectively. The results described here establish the PTM repertoire of TP1 and TP2, which in combination with the diverse roles of chromatin modifiers and readers should provide insights into the molecular mechanisms underlining the global chromatin remodeling event during the late steps of mammalian male germ cell differentiation and consequently establishment of the sperm epigenome.

animals were approved by the animal ethics committee of Jawaharlal Nehru Centre for Advanced Scientific Research, Bangalore, India.

Expression and purification of TP2 protein TP2 plasmid constructs were transformed into E. coli Rosetta cells (Novagen). Protein expression was induced with 1mM IPTG for 4 h at 37°C shaking. Bacterial cells from 1L culture were pelleted at 3,300g for 10min at 4°C. Bacterial cell pellet was resuspended in 25-30 ml lysis buffer (50mM Tris-HCl pH 8.0, 0.57M NaCl, 10mM βmercaptoethanol, 0.2mM PMSF) and 1mg/ml chicken egg white lysozyme. After 30 min incubation on ice with intermittent vortexing, cells were lysed by sonication at a pulse of 5 sec on / 7 sec off; 40% amplitude for 10 min and centrifuged at 13,400g at 4°C for 60 min. Supernatant was centrifuged again for 40 min followed by another spin of 30 min till supernatant got clarified. Heparin agarose beads (Sigma) were equilibrated in lysis buffer, 500 μl of beads were added to the supernatant and kept for 4 h (to O/N) binding in an end-to-end rotor at 4°C. The supernatant was passed thrice through column at a slow flow rate allowing beads to settle followed by wash with 5 volumes of lysis buffer. Bound proteins were eluted by step gradient of increasing salt concentration of 0.6M, 1M, and 1.4M NaCl in lysis buffer and 500µl fractions were collected. The fractions were checked on 15% SDS-PAGE gel for the presence of TP2protein and the selected

EXPERIMENTAL PROCEDURES Cell culture and transfections PRMT4 mammalian expression constructs with N-terminal flag tag were transfected in HEK293T cells (ATCC) by Lipofactamine 2000 reagent (Invitrogen). Transfection was carried out in 90mm dishes according to the manufacturer’s instructions. The ratio of reagent to plasmid DNA used was 2:1 and 1μg/ml of plasmid was transfected. M2 agarose beads were used to immunoprecipitate PRMT4 variants and beads were used as an enzyme source for in vitro methylation assays as previously described (33). Animals Male Wistar Rats (Rattus norvegicus), female rabbits (New Zealand White) and female mice (BALB/c) were obtained from the institute animal facility. All procedures for handling 3


Plasmid constructs RNA was isolated from rat round spermatids using TRIzol reagent (Invitrogen) and the cDNAs were synthesized using oligo(dT) primers by ThermoScript reverse transcriptase (Invitrogen) following manufacturer’s instructions. Complementary cDNAs of PRMT4 variants were cloned in p3XFLAG-CMV-10 vector between HindIII and BglII sites. Recombinant TP2 bacterial expression plasmid which is codon optimized was used for TP2 protein expression as previously described (32, 34, 35). This plasmid construct was used as template for introducing mutations. Plasmids expressing mutant PRMT4 or rTP2 were generated by site-directed mutagenesis (Agilent) following manufacturer’s protocol. Primer sequences used for cloning and mutagenesis are listed in Table 1.

fractions were dialyzed against 1% acetic acid with 10μM ZnSO4. Dialyzed samples were lyophilized and reconstituted in water.

0.1M glycine pH 2.5 and immediately neutralized by adding 1/10th volume of Tris-HCl pH 10 and dialysed against PBS. Affinity purified antibody was stored in small aliquots at -20˚C.

Antibodies The following antibodies were used: antiPRMT4 (P4995, Sigma, WB: 1:500, IF: 1:50), anti-KMT7 (ab119400, Abcam, WB: 1:500, IF: 1:50), anti-H3 (39163, Active motif, WB: 1:5,000), anti-H3R17me2a (07-214, Millipore, WB: 1:500), anti-Rme1 (8015, Cell signaling, WB: 1:1000), anti-Rme2a (39231, Active motif, WB: 1:500), anti-Rme2s (07-413, Millipore, WB: 1:500), anti-Kme1/2 (ab23366, Abcam, WB: 1:500) and anti-H4 (05-858, Millipore, WB: 1:10,000). Anti-TP1 and anti-TP2 antibodies were obtained as previously described (36). Immunization and purification of antibodies TP2 polyclonal antibodies were raised by immunizing female New Zealand White rabbits and BALB/c mice with recombinant TP2 expressed and purified from E. coli. Rat TP2 K88me1 (KLH-CRKTLEGKme1VSKRKA) and R92me1 (KLH-CEGKVSKRme1KAVRRR) polyclonal antibodies were raised by injecting synthetic peptides in female BALB/c mice and female New Zealand White rabbits respectively. Antigens were conjugated to keyhole limpet hemocyanin (KLH) via the cysteine residue. After sufficient boosters, blood was collected from the marginal ear vein of rabbit. The blood was collected from mouse by retro-orbital blood collection method. Blood was kept at room temperature to allow it to clot. Separated serum was transferred to fresh tubes. Antibodies were purified by sequential precipitation by caprylic acid and ammonium sulphate (CA-AS) and resuspended in PBS (37).

Purification of endogenous TP1 and TP2 Rat testes (6 animals, 60-80 day old) were decapsulated and homogenized in 5 volumes of cell lysis buffer (10mM Tris-HCl pH 7.4, 10mM NaCl, 3mM MgCl2, 0.1% NP-40, 1mM PMSF, 10mM NaHSO3, 10mM sodium butyrate, 1μM TSA, protease inhibitor cocktail, phosphatase inhibitor cocktail). The homogenate was filtered through 4 layers of bandage cloth and centrifuged at 1,500g for 10 min at 4°C. The pellet of crude nuclei was resuspended in 5 volumes of 0.4N HCl, kept on ice with occasional vortexing for 30 min and centrifuged at 10,000g for 10 min at 4°C. Acid soluble proteins were precipitated with step gradient of 0-3% and 3-30% of trichloroacetic acid (TCA), sequentially washed with ice cold acetone containing 0.05% HCl and three times with ice cold acetone. The pellet was dissolved in water. Proteins from the 3-30% TCA fraction were fractionated in two rounds of chromatography on a C18 column (Water’s XBridge BEH300 Prep C18,

Affinity purification of antibody with immobilized peptide SulfoLink® immobilization kit for peptides (Thermo Scientific) was used to affinity purify the antibody. Briefly, peptide was coupled to the SulfoLink Column as per the manufacturer’s protocol. Non-specific sites were blocked by Lcysteine. Column was washed extensively with PBS. IgG was bound to the peptide coupled column for 3 hours at 4˚C. The column was washed with PBS and antibody was eluted with 4


Affinity purification of antibody by antigen/protein immobilization on membrane The purified rTP2 protein was resolved by SDS-PAGE and transferred on to nitrocellulose membrane using semidry transfer apparatus (GE Healthcare) as described above. After transfer, membrane was stained with ponceau S staining solution (0.1% (w/v) ponceau, 1% (v/v) acetic acid), protein band was marked and additional membrane was cut and discarded. Membrane was washed extensively to remove ponceau S stain. The membrane was blocked with PBS-T (137mM NaCl, 2.7mM KCl, 10mM Na2HPO4.2H2O, 2mM KH2PO4, pH 7.4 containing 0.05% Tween-20) containing 5% milk powder at room temperature for 1 hour. Membrane was washed extensively with PBS and IgG was bound to the membrane for 3 hours at 4˚C. Nitrocellulose membrane was washed with PBS followed by washes with water and antibody was eluted with 0.1M glycine pH 2.5 and immediately neutralized by adding 1/10th volume of Tris-HCl pH 10 and dialysed against PBS. Affinity purified antibody was stored in small aliquots at -20˚C.

resolution (FWHM) and 17,500 FWHM resolution, respectively. In the second approach, endogenous TPs were cleaved by trypsin, chymotrypsin and elastase independently to generate suitable peptides from the entire length of protein. Endogenous TP1 and TP2 proteins were resolved in 15% SDS-PAGE and gel bands containing 2μg protein each were digested with trypsin, chymotrypsin and elastase independently. The TP1 and TP2, gel bands were excised and washed with 25mM ammonium bicarbonate. Reduction and alkylation were performed sequentially with 10mM dithiothreiotol, incubated at 60°C and followed by treatment with 50mM iodoacetamide at room temperature. Digestion was performed either with trypsin (sequencing grade, Promega) at 37°C for 4 h or with chymotrypsin (sequencing grade, promega) at 37°C for 12 h or with elastase (promega) at 37˚C for 12 h and the reaction was terminated by adding formic acid to a final concentration of 0.1%. The supernatant was used directly for LC-MS/MS analysis. The gel digests were analyzed by nano LC/MS/MS using an EasynLC 1000 HPLC system interfaced to a ThermoFisher Q Exactive at MS Bioworks, LLC (Ann arbour, MI, USA). Peptides were loaded on a trapping column and eluted over a 75μm analytical column at 300nL/min; both columns were packed with PepMap C18 3μm resin (ThemoFisher). Peptide elution was performed using a gradient of solvent A (0.1% formic acid in water) and solvent B (0.1% formic acid in acetonitrile). The gradient conditions employed were: 2-25% of solvent B in 20 min, 25-50% of solvent B in 5 min, 50-90% of solvent B in 1 min and 90-2% of solvent B in 1min. The mass spectrometer was operated in data-dependent mode, with MS and MS/MS performed in the Orbitrap at 70,000 full width at half maximal resolution (FWHM) and 17,500 FWHM resolution, respectively. Ions were selected once and then excluded for 30 seconds. The 15 most abundant ions were selected for MS/MS analysis. All the tandem mass spectra were first converted to MGF (Mascot Generic Format) files by Thermo Proteome Discoverer v1.4 (ThermoFisher) and then searched against the rat database (UniProtKB-Reference Proteome Set, taxonomy ID 10116, 27340 sequences) by MASCOT v2.4.0. MS/MS spectra cut-off score

Mass spectrometry, data analysis and validation Two approaches were employed for the mass spectrometric characterization of the posttranslational modifications of endogenous transition proteins, TP1 and TP2. In the first approach, TPs were chemically derivatized with propionic anhydride, before and after proteolytic cleavage by trypsin (38). The lyophilized protein sample obtained after RP-HPLC separation comprising of endogenous TP1 and TP2 was reconstituted in 100mM ammonium bicarbonate pH 8.0. About 20ug protein was propionylated in vitro twice, before and after trypsin digestion as previously described (38). The tryptic peptides were analyzed by LC-MS/MS (Easy-nLC 1000-QExactive, Thermo) at PTM Biolabs, Co., Ltd (Chicago, IL, USA). Peptides were loaded on a trapping column (Acclaim PepMap 100, 2cm long, 75µm ID, 3µm resin, ThermoFisher) and eluted over an analytical column (Acclaim PepMap, RSLC, 15cm long, 50µm ID, 2µm resin, ThermoFisher) at 300nL/min. The mass spectrometer was operated in data-dependent mode, with MS and MS/MS performed in the Orbitrap at 70,000 full width at half maximal

5


5 µm OBD, 19mm × 150 mm) using AKTA purifier 10 (General Electric) by employing a gradient of solvent A (5% acetonitrile, 0.1% TFA) and solvent B (90% acetonitrile, 0.1% TFA). The gradient conditions employed during the first run were: 0-19% of solvent B in 15 min, 19-23% of solvent B in 30 min and 23-100% of solvent B in 10 min at a flow rate of 2ml/min. Fractions containing the transition proteins, obtained during 19-23% of solvent B separation, were pooled and separated further using the following gradient conditions: 0-18% of solvent B in 15 min, 19-21% of solvent B in 30 min and 21-100% of solvent B in 10 min at a flow rate of 2ml/min. The peak corresponding to the transition proteins, TP1 and TP2 appeared at 19.5% of solvent B. Fractions were collected and dried to completion in a SpeedVac (ThermoFisher) and resuspended in water. An aliquot of the protein fractions was checked for their composition in 15% SDS-PAGE and confirmed by western blotting with anti-TP1 and TP2 antibodies. Fractions containing transition proteins were lyophilized and stored at -20°C.

RNA purification and quantitative real-time PCR assays Total RNA for cDNA synthesis was obtained from 10-day old rat testis for gametic diploid cells and from elutriated tetraploid (pachytene spermatocytes) and haploid cells (round spermatids) by the TRIzol method (Invitrogen) according to the manufacturer’s instructions. RNA was subjected to DNaseI treatment (New England Biolab) to remove any contaminating genomic DNA. Complementary DNAs were synthesized by SuperScript reverse transcriptase (Invitrogen). Real-time PCR analysis was performed with three biological replicates using EvaGreen dye (Qarta) in Corbett Rotor-gene 6000 machine. Melt curve analysis was done to ensure specific amplification. Difference in values of Ct (threshold cycle) were used to calculate the fold difference in expression of mRNA in gametic diploid, tetraploid and haploid cells by the DeltaDelta Ct method (2−deltadelta Ct) of analysis. Nascent polypeptide-associated complex α (NACA) was used as an internal normalization control, since its expression level across different spermatogenic cells was found to be unchanged in microarray experiments (27). Primer sequences used for quantitative and semi-quantitative PCR are listed in Table 1.

Centrifugal elutriation and flow cytometric analysis 6


Rat testes were decapsulated and minced, seminiferous tubules were digested with 10mg of collagenase in 25ml of DMEM at 30°C for 1 h. Cells were filtered through 4 layers of bandage cloth and cells were pelleted at 500g for 10 min at 4°C and resuspended in 8-10 ml of running buffer DPBS (PBS, 0.1% Glucose, 0.2% BSA). Cells were injected into the elutriation rotor and were separated as previously described (27). The fractions collected were washed with DPBS, microscopically analyzed after DAPI staining and an aliquot was fixed in 70% ethanol overnight at 20°C. Rest of the cells were immediately frozen in liquid nitrogen and stored at -80°C. The cell pellet of fixed cells was obtained by centrifugation at 500g for 10 min at 4°C. Cells were washed 3 times with DPBS and suspended in staining buffer (0.3 % NP-40, 50μg/ml RNase A, 25 μg/ml ethidium bromide). Cells were incubated at 37°C for 1 h and staining was allowed to continue at 4°C for at least 2-3 h and then purity was monitored by flow cytometry.

was set at 20. We adhered to 1% protein and peptide FDR criteria during the database searching. Peptides with post-translational modification were manually validated to be correct. Manual validation for all the modified peptides was performed by considering the mass error on the parent ion and also by b and y ions of the modified peptides. For modification like phosphorylation, characteristic neutral loss was also considered in addition. The search parameters employed were as following: mass error was set as ±10 ppm for peptide mass tolerance and 0.02 Da for fragment mass tolerance. Enzyme was specified as trypsin or none (for chymotrypsin and elastase) allowing up to 3 missing cleavages for direct digestion approach and up to 6 missed cleavages for propionylated samples for tryptic peptides. Carbamidomethyl on Cys was specified as fixed modification whereas acetylation on Lys/Ser, phosphorylation on Ser/Thr/Tyr, methylation of Lys (mono, di, tri)/Arg (mono, di), crotonylation on Lys and succinylation on Lys were specified as variable modifications. Propionylation on Lys and peptide N-termini were also included when analyzing samples derivatized with propionic anhydride. Mascot DAT files were parsed into the Scaffold software for validation, filtering and to create a non-redundant list per sample. Data were filtered using a minimum protein value of 99.9%, a minimum peptide value of 80% (Prophet scores) and requiring at least two unique peptides per protein. Scaffold results were exported as mzIdentML and imported into Scaffold PTM in order to assign site localization probabilities using Ascore (39). All the spectra generated with acceptable Ascore and localization probability for modified peptides were manually validated to be correct. Quantitation of PTM was done using Qual Browser with a mass tolerance of 10 ppm. Although multiple charge states were detected, only the same charge states were considered for quantitation. The data is expressed as a ratio of the peak area of a modified peptide to unmodified peptide. Mass spectra and fragmentation table for all the identified posttranslational modifications are listed in supplemental Data S1 and S2 for TP1 and TP2 respectively.

Extraction of acid soluble proteins The purified nuclei were resuspended in 0.4N HCl or 10% perchloric acid (PCA), homogenized and kept on ice for 30 min. The sample was centrifuged for 10 min at 10,000g at 4°C to pellet the residual chromatin. The extracted proteins were precipitated by 30% trichloroacetic acid (TCA) at 4°C. After keeping on ice for 30 min the proteins were recovered by centrifugation at 12,000g at 4°C for 10 min. The pellet of proteins so obtained was sequentially washed with ice cold acetone containing 0.05% HCl and three times with ice cold acetone. The pellet recovered was dried, dissolved in water and stored in aliquots at -20°C.

In vitro methylation reaction Proteins were incubated in 1X HMT buffer (as recommended by manufacturer), 1μl (1.1μCi) S-adenosyl-L-[3H-methyl] methionine and methyltransferase enzyme (PRMT1, M0234, NEB; PRMT4, 14-575, Millipore; PRMT4 and PRMT4-E267Q, 31347 and 31348, Active Motif; PRMT5, SRP0145, Sigma; KMT7, 14-469, Millipore) in a 30μl reaction volume and incubated at 30°C for 30 min. To visualize the radiolabeled proteins, the reaction products were precipitated with 25% trichloroacetic acid, sequentially washed with ice cold acetone containing 0.05% HCl and three times with ice cold acetone, resuspended in water and resolved electrophoretically on 15% SDS-PAGE and subjected to fluorography using a solution containing 22.5% 2, 5-diphenyloxazole in DMSO. Gels were dried and autoradiography was performed at -80°C for 2-3 days.

Extraction of nuclear proteins Rat testicular nuclei or sonication resistant spermatid (SRS) nuclei were lysed in nuclear lysis buffer (20mM HEPES pH 7.9, 20% v/v glycerol, 420mM KCl, 1.5mM MgCl2, 0.2mM EDTA, 0.1mM DTT, 0.2% Triton X-100 and protease inhibitor cocktail) and centrifuged at 10,000g for 10 min at 4°C to obtain nuclear proteins.

V8 protease digestion of TP2 and autoradiography In vitro methylated TP2 (3μg) was digested with V8 protease (from Staphylococcus aureus, Sigma) in 50mM ammonium bicarbonate pH 7.8 at 37°C for 8 h at an enzyme to protein ratio of 1:50 and the products were separated on

Separation of nucleoplasm and chromatin fractions from testis nuclei 7


Nucleoplasmic (soluble) and chromatin (insoluble) fractions were prepared as previously described (40). Rat testicular nuclei were lysed in 5 volumes of nucleoplasm extraction buffer (3mM EDTA, 0.2 mM EGTA) twice and incubated on a rotator for 30 min at 4°C. Nucleoplasmic fraction (supernatant) was obtained by centrifuging at 6,500g for 10 min at 4°C and chromatin was obtained as pellet. Chromatin pellet was lysed in high-salt solubilisation buffer (50mM Tris–Cl pH 8.0, 2.5M NaCl, 0.05% NP40 and protease inhibitor cocktail), incubated on a rotator for 30 min at 4°C and centrifuged at 16,000g for 10 min at 4°C to obtain chromatin proteins. The extracted proteins were precipitated by 30% trichloroacetic acid (TCA) at 4°C. After keeping on ice for 30 min the proteins were recovered by centrifugation at 12,000g at 4°C for 10 min. The pellet of proteins so obtained was sequentially washed with ice cold acetone containing 0.05% HCl and three times with ice cold acetone. The pellet recovered was dried, dissolved in water and stored in aliquots at -20°C.

Isolation of sonication resistant spermatid (SRS) nuclei Rat testes were homogenized in 6-8 volumes of buffer A (10mM Tris-HCl pH 7.4, 10mM sodium metabisulphite, 0.1mM PMSF, 0.34M sucrose, 0.1% Triton X-100). The homogenate was filtered through 4 layers of bandage cloth and centrifuged at 4,000g for 10 min at 4°C. The pellet of crude nuclei was suspended in 3-5 volumes of buffer B (10mM Tris-HCl pH 7.4, 10mM sodium metabisulphite, 0.1mM PMSF) and subjected to sonication at a pulse of 10 sec on / 10 sec off; 40% amplitude for 15 min. Sonicate was centrifuged at 10,000g for 10 min. The pellet was resuspended in 3-5 volumes of buffer B and the suspension was layered over 10ml cushion of 1.5M sucrose in buffer B and centrifuged at 3,000g for 30 min at 4°C. The pellet contained purified SRS nuclei (>98%) comprising elongating and condensing spermatids, as observed under microscope.

15% SDS-PAGE gel. The gel was exposed for autoradiography as described above.

5% skimmed milk powder, peptide blocked antibodies were allowed to bind with the blotted protein for 1 h at room temperature. Rest of the steps are same as western blot protocol described above.

Western blotting The protein samples were resolved by SDS-PAGE and electrophoretically transferred onto nitrocellulose membranes using standard procedures. After transfer, the membrane was blocked using 5% skimmed milk powder in wash buffer PBST (1X PBS with 0.1% Tween-20) for 1 h at room temperature. The membrane was then incubated with primary antibody for 2 h or overnight at 4°C on a rocking platform. The unbound antibody was removed by washing the membrane with wash buffer and probed with an appropriate HRP-conjugated secondary antibody in PBST with 1% skimmed milk powder and incubated for 1 h. The membrane was then washed extensively and developed using the chemiluminescence kit (ThermoScientific).

AUT-PAGE Endogenous TP1 and TP2 protein (10μg each) was resolved in AUT-PAGE and transferred to nitrocellulose membrane as previously described (41), and subsequently probed with antiTP1 and anti-TP2 antibodies.

Dot blot analysis Peptide, 2µg each (backbone peptide: TP2 K88 - CPKNRKTLEGKVSKRKAVRRR and TP2 R92 - CEGKVSKRKAVRRR; methylated peptide: TP2 K88me1 CPKNRKTLEGKme1VSKRKAVRRR and TP2 R92me1 - CEGKVSKRme1KAVRRR) was spotted onto nitrocellulose membrane and once the membrane was dry, it was blocked with PBST having 5% skimmed milk powder for 1 h. After blocking, the membrane was incubated with primary antibody (prepared in blocking buffer) for 1 h. Blot was washed thrice with PBST and it was incubated with secondary antibody (prepared in blocking buffer) for 1 h. After incubation, the blot was washed thrice with PBST, once with PBS and then ECL substrate was added and autoradiography was performed. All the synthetic peptides were purchased from Storkbio Ltd. Peptide competition assay Peptide competition assay was performed to block the antibody epitopes by pre-incubating with ~50 fold molar excess of peptide used for immunization. TP2 K88me1 and R92me1 methylation specific antibody was blocked independently with methylated peptide TP2 K88me1 - CPKNRKTLEGKme1VSKRKAVRRR and TP2 R92me1 - CEGKVSKRme1KAVRRR respectively for 3 h. After blocking the blot with

Phylogenetic analysis To determine the sequence divergence of transition proteins TP1 and TP2 among mammals, sequences of eight mammals were retrieved from UniProt (TP1: rat-P02317, mouse-P10856, humanP09430, chimpanzee-F7VJM6, rhesus macaqueF7VJL8, dog-E2RER7, cow-P17305, pig-P17306; TP2: rat-P11101, mouse-P11378, human-Q05952, 8


Decondensation and immunofluorescence of testicular cells Total testicular cells were decondensed by resuspending in decondensation buffer (PBS, 10mM dithiothreitol) and incubated at 4°C for 1 h in an end to end rotor (36). Cells were obtained after centrifuging at 1,500g for 10 min at 4°C and were washed twice with ice cold PBS. Total testicular cell smears were fixed with 4% paraformaldehyde (in PBS) and permeabilized with 0.1% Triton X-100 (in PBS) for 15 min. 1% BSA in PBS was used for blocking non-specific sites. Smears were incubated with primary antibodies (anti-PRMT4, anti-KMT7, anti-TP2, anti-TP2 K88me1 and anti-TP2 R92me1); counterstained with corresponding secondary antibodies conjugated with alexa fluor 488 and/or alexa fluor 568. Nuclei were stained with DAPI (Sigma). Colocalization experiments were carried out by simultaneous incubation of smears with two different primary antibodies raised in different organisms. Images were acquired by Zeiss confocal laser scanning microscope (LSM 510 META, Carl Zeiss). Analysis for colocalization was done using LSM browser software which creates a scatter plot and gives the number of colocalized and individual pixels. A cut-mask image shows only the region containing colocalized pixels.

chimpanzee-B3LF34, rhesus macaque-Q9N1A3, dog-O77645, cow-P26377, pig-P29258). Sequence alignment was carried out using MUSCLE software and the phylogenetic tree was constructed by the neighbor-joining method using MEGA software version 6. Bootstrap re-sampling and reconstruction was done 1000 times to confirm reliability of the phylogenetic tree analysis. The evolutionary distances were computed using the JTT matrix-based method and are in the units of the number of amino acid substitutions per site. All positions with less than 95% site coverage were eliminated, that is, fewer than 5% alignment gaps, missing data, and ambiguous bases were allowed at any position. (42). RESULTS Purification of endogenous TP1 and TP2 from rat testis Rat testicular nuclei were extracted with 0.4N HCl and acid soluble proteins were precipitated sequentially using a step gradient of 0-3% and 3-30% of TCA. Transition proteins, TP1 and TP2, get precipitated in the 3-30% TCA fraction (Fig. 1A). Proteins present in 3-30% TCA fraction were loaded on a C-18 column and separated by RP-HPLC. In the first chromatographic run, transition proteins were partially separated from bulk of the other basic proteins (Fig. 1B). Fractions containing TPs as monitored by western blot analysis were pooled (Fig. 1C) and then fractioned using a shallower gradient of solvent B in the second run (Fig. 1D). Fractions containing transition proteins, TP1 and TP2 were pooled and checked for purity in SDSPAGE and their identity was confirmed by western blotting using anti-TP1 and anti-TP2 antibodies (Fig. 1E). In order to examine the presence of differentially modified forms, endogenous purified transition proteins were resolved in AUT-PAGE, as it can separate variants and post-translationally modified forms of basic proteins (41). Multiple bands were observed for TP2 (13kDa) which also reacted with anti-TP2 antibodies, indicating the presence of multiple covalently modified forms of endogenous TP2. However, TP1 owing to its small size (6.4 kDa) migrated along with the dye front as a sharp band even in the AUT-PAGE (Fig. 1F).

9


Mass spectrometry analysis of endogenous TP1 and TP2 Transition proteins are highly basic proteins with lysine and arginine constituting about 38% and 24% of the rat TP1 and TP2 protein respectively. This means regions with frequent lysine and arginine residues after trypsin digestion will result in very short peptides, which are technically unsuitable for characterization by mass spectrometry. To circumvent this problem, two independent approaches were employed. In the first approach, TPs were chemically derivatized with propionic anhydride before and after proteolytic cleavage by trypsin. Propionic anhydride derivatization adds propionyl group at the peptide N-termini, unmodified and monomethylated lysine thus neutralizing their charge, making peptides less hydrophilic and suitable for separation by RP-HPLC (38). In the second approach, endogenous TPs were cleaved by trypsin, chymotrypsin and elastase independently, to generate suitable peptides from the entire length of protein. Sequence coverage of 91% was obtained for TP1 and 16 novel modifications on 15 different amino acid residues were identified. These include serine phosphorylation at Ser36, Ser37 and Ser48, lysine methylation at Lys25 and Lys39, lysine acetylation at Lys6, Lys22, Lys32, Lys35, Lys39 and Lys42 and arginine methylation at Arg5, Arg13, Arg18, Arg34, and Arg41. In addition, K32ac was observed only in association with R34me (Fig. 2A). Spectral information of identified post-translational modifications of TP1 is listed in Table 2 (see supplemental Data S1 for MS plots of TP1 PTMs and corresponding fragmentation table). For TP2, a sequence coverage of 84% was achieved, covering most of the N-terminal twothird of the protein. A small stretch of C-terminal sequence of TP2 (residues 97-114) was not covered in the mass spectrometry analysis owing to the presence of many arginine residues within this sequence. For endogenous TP2, 19 novel modifications on 15 different amino acid residues were identified. These include serine phosphorylation at Ser17, Ser23, Ser51, Ser68, Ser70 and Ser90, serine acetylation at Ser7 and Ser37, threonine phosphorylation at Thr84, lysine methylation at Lys83, Lys88 and Lys91, lysine acetylation at Lys4, Lys57, Lys83, Lys88, Lys91

and arginine methylation at Arg92 (Fig. 2B). Earlier in vitro studies have shown that acetylation and phosphorylation of TP2 occur in its Cterminus which reduces its DNA condensation property (25, 30, 32). In the C-terminus (residues 87-114) of endogenous TP2, 7 PTMs on 4 residues were identified including the sites for acetylation and phosphorylation. This provides further support for the earlier in vitro studies (30–32). However, the region harboring PKA phosphorylation sites, Thr101 and Ser109, identified by in vitro biochemical and mutational analysis (30) was not covered in the present mass spectrometry analysis. Spectral information of identified posttranslational modifications of TP2 is listed in Table 3 (see supplemental Data S2 for MS plots of TP2 PTMs and corresponding fragmentation table).

on the non-conserved amino acid residues are lineage and/or organism specific. In the subsequent work, we focused on the novel arginine and lysine methylation of the two major transition proteins.

Sequence divergence of TP1 and TP2 and conservation of its PTM sites in mammals To determine the extent of sequence divergence of the two major transition proteins, TP1 and TP2 during evolution, phylogenetic analysis was carried out using TP1 and TP2 sequences of eight mammals belonging to four animal orders. This includes rat and mouse from rodentia; human, rhesus macaque and chimpanzee from primates; pig and cow from cetartiodactyla and dog from carnivora (43). Among the two major transition proteins, TP2 sequence has diverged more than TP1 across mammalian species as indicated by the differences in their branch length (Fig. 3A and 3B). This is indicative of different evolutionary constraints on TP1 and TP2, and possibly the two major transition proteins fulfil distinct roles in mammalian spermiogenesis. For better appreciation of the post-translational modifications of transition proteins, TP1 and TP2, sequence conservation of the modified residues across selected mammals was analyzed. Most of the post-translationally modified amino acid residues of TP1 are conserved across the analyzed mammals except for the phosphorylation sites Ser36, Ser37 and Ser48 (Fig. 3C). Among the 15 post-translationally modified amino acid residues of TP2, only 4 residues are conserved. Many of the phosphorylation and arginine methylation sites are present only in rodents (Fig. 3D). This presumably indicates that some of these modifications present 10


Arginine methylation of transition proteins, TP1 and TP2 Arginine methylation is mediated by protein arginine methyltransferases (PRMTs). Among these, type I PRMTs (1, 2, 3, 4, 6 and 8) and type II PRMTs (5 and 7) catalyze the reaction of the formation of asymmetric dimethylarginines (ADMA) and symmetric dimethylarginines (SDMA) respectively, through monomethylarginine (MMA) intermediate on the terminal nitrogen (ω) of the guanidino group of arginine. PRMT7 generates only MMA for some substrates, referred to as type III activity. In yeast, type IV activity has been described where internal nitrogen (δ) of guanidino group gets methylated. Besides these, there are additional putative PRMTs like PRMT9 (FBXO11), PRMT10 and FBXO10, which are not well characterized (44– 46). Role of arginine methylation of nuclear basic proteins in mammalian spermatogenesis has not been studied in detail except that PRMT5 has been shown to methylate piwi proteins during spermiogenesis (47). To confirm the observed arginine methylation of transition proteins, TP1 and TP2 in mass spectrometry analysis, endogenously purified proteins were probed with methylarginine antibodies. Both the transition proteins, TP1 and TP2 showed the presence of monomethyarginine (MMA) and asymmetric dimethylarginine (ADMA). However, no signal was observed for symmetric dimethylarginine (SDMA) (Fig. 4A). In order to identify PRMT(s) responsible for the methylation of transition proteins during spermiogenesis, the expression pattern of rat PRMTs were checked by quantitative PCR in haploid spermatids (round spermatids), stage where transcripts for transition proteins are made. PRMT1, PRMT4, and PRMT5 showed higher transcript levels compared to other PRMTs (Fig. 4B). The expression of these selected PRMTs was further checked in gametic diploid spermatogonial cells (GD), tetraploid pachytene spermatocytes (P) and haploid round spermatids (RS) and they all showed elevation in expression at progressive stages of differentiation. PRMT4

reaction was performed using an active site mutant of PRMT4 harboring E267Q mutation, which abolishes its methyltransferase activity (48). As expected, PRMT4-E267Q could not methylate both histone H3 (positive control) and rTP2 (Fig. 4G). In our subsequent study, we focused on TP2 methylation by PRMT4, as its detailed characterization and identification of the modification site(s) can be better appreciated in the context of the known functional domains of TP2. PRMT4 splice variants with methyltransferase domain can methylate TP2 The appearance and localization pattern of PRMT4 protein was examined at different steps of spermiogenesis by immunofluorescence. PRMT4 is abundantly present in transcriptionally active round spermatids, reflecting its presumptive role in transcription process. PRMT4 is present at reduced levels in elongating spermatids and is present in all the steps where TP2 is expressed (Fig. 5A). The presence of PRMT4 in sonication resistant spermatids was confirmed by western blot analysis using SRS nuclear lysate. Multiple bands were observed in western blot, which could be either due to the presence of alternatively spliced variants or due to post-translational modifications of PRMT4 (Fig. 5B). Notably, PRMT4 is an established transcriptional coactivator and catalyzes H3R17me2a modification (49). H3R17me2a modification was indeed observed in histone H3 extracted from both round spermatids and SRS nuclei, demonstrating that PRMT4 is enzymatically active in spermatids (Fig. 5C). H3R17me2a observed in elongating spermatids is puzzling and probably it may serve some transcription independent function as step 11 onward spermatids are transcriptionally inert. Notably, H3R17me2a has not been identified on the retained nucleosomes in the sperm (17). Since multiple bands were observed for PRMT4 in the western blot analysis of SRS nuclear lysate (Fig. 5B), it was pertinent to check all PRMT4 variants for their ability to methylate TP2 in vitro. All the known four splice variants of PRMT4 were cloned using round spermatid cDNA of rat and in addition, a novel PRMT4 v5 was identified, and its sequence variation is depicted in Fig. 5D. A graphical representation of the exonintron structure of the C-terminus of rat PRMT4 11


showed a much higher level of expression uniquely in the round spermatids (Fig. 4C). Four alternative splice variants of PRMT4 v1, v2, v3 and v4 have been reported in rat. They share a common N-terminus which encompasses methyltransferase domain and differences among the variants are limited to the C-terminus (33). Expression levels of PRMT4 v2 and v3 were analyzed by quantitative PCR using primers for unique stretches of amino acid sequences present in their C-termini. The results indicate that v2 and v3 transcripts do not account for the observed upregulation of PRMT4 in round spermatids and therefore these PRMT4 transcripts must correspond to other splice variants (Fig. 4C). To investigate whether PRMT1, PRMT4 and PRMT5 can methylate the transition proteins TP1 and TP2 and/or other spermatid protein/s, an in vitro methylation reaction of acid soluble spermatid proteins was performed. Acid soluble proteins were extracted using 0.4N HCl and 10% PCA (perchloric acid) from the sonication resistant spermatid nuclei (SRS) which comprise of elongating and condensing spermatids. All the three tested PRMTs methylated several basic proteins from SRS including the proteins at the position of transition proteins and histones (Fig. 4D). This is indicative of important role of arginine methylation in mammalian spermiogenesis. We observed differences in the methylation pattern between in vitro methylation reaction of acid soluble proteins extracted by 0.4N HCl and 10% PCA at the position of TP1 and TP2 protein and this could be due to inaccessibility of sites which may be hindered upon by association with other proteins present in the extract (Fig. 4D). To confirm the methylation of TPs, in vitro methylation assay was performed using endogenous TP1 and TP2 from rat testis as substrates. TP1 and TP2 appeared to be potential substrate for PRMT1 and PRMT4 respectively, while a faint signal was observed at the position of TP1 with PRMT4 and at the position of TP2 with PRMT5 (Fig. 4E). Since we had bacterial expression construct of codon optimized recombinant TP2 (34, 35), in vitro methylation reaction of rTP2 was performed. PRMT4 methylated rTP2 while PRMT1 and PRMT5 showed no activity for rTP2 in the tested buffer conditions (Fig. 4F). To further establish that TP2 is a substrate for PRMT4, in vitro methylation

spectrometry analysis, while the remaining 8 sites are clustered in the unmapped C-terminus (residues 97-114). In order to identify site/s of methylation, in vitro methylated TP2 by PRMT4 was subjected to V8 protease digestion which cleaves at the lone Glu86, resulting in a 2/3rd Nterminus fragment (residues 1-86) and a 1/3rd Cterminus fragment (residues 87-114). N-terminus of TP2 was found to be methylated to a much higher extent than the C-terminal fragment which included the Arg92 residue (Fig. 6B). In vitro methylation reaction was performed with the TP2R92K mutant protein and a 20% reduction was observed. This indicates that Arg92 can account for the TP2 C-terminal modification (Fig. 6C). In order to have a complete landscape of arginine methylation of TP2 by PRMT4, all the 6 arginine residues present in the N-terminus of rat TP2 were mutated to lysine and subjected to in vitro methylation reaction by PRMT4. Densitometric analysis revealed Arg75 as the major site while reduced methylation levels were observed for R66K, R71K and R82K mutant TP2 proteins (Fig. 6D). Since 4 residues showed reduction in methylation with R75K accounting for ~50% reduction, three combination mutant TP2 proteins R66K, R75K; R71K, R75K and R75K, R82K with R75K being common in them were prepared. Methylation of TP2 with R71K, R75K mutation by PRMT4 reduced methylation levels by more than 90% (Fig. 6E). TP2 Arg71 and Arg75 were reconfirmed as the in vitro sites of PRMT4 methylation in the N-terminus of TP2 (Fig. 6F). In Fig. 5G and 5H, it was observed that any variant with intact methyltransferase domain can methylate TP2. We used PRMT41-490 with intact methyltransferase domain to methylate TP2 with R71K, R75K mutation. These mutations in TP2 sequence abolished methylation, further confirming them as the major sites for methylation in vitro (Fig. 6G). N-terminal region of TP2 was covered in the mass spectrometry analysis but did not reveal the presence of methylation at Arg71and Arg75. This suggests that it could be of low abundance or may not have been detected in mass spectrometry due to some technical reasons. Alternatively, PRMT4 preferentially methylates at Arg92 in vivo although it can methylate Arg71and Arg75 in vitro, suggesting that additional factors might regulate site accessibility for methylation in vivo.

PRMT4 methylates TP2 at Arg71, Arg75 and Arg92 Mass spectrometry analysis of endogenous TP2 revealed the presence of peptides with arginine methylation at residue Arg92 harboring mono-methylation and di-methylation (Fig. 6A). Rat TP2 protein contains 16 arginine residues of which 8 sites were covered in the mass 12


and its isoforms is depicted in Fig. 5E. All the PRMT4 variants (v1-v5) have an intact methyltransferase domain in their N-termini, with arrows indicating differences among the variants. Earlier, it was observed that PRMT4 transcripts in round spermatids belong to a variant other than v2 and v3 (Fig. 4C). To identify the most abundant variant, primer sets indicated in Fig. 5E, were used to amplify PRMT4 isoforms by semi-quantitative PCR. Blue-green primer set generates different size amplicons for v1, v2, v4 and v5 while a blueyellow primer set amplifies only v3. Expected variant amplicon sizes were demonstrated by using cloned PRMT4 variants as template. PRMT4 v1 was found to be the most abundant transcript in round spermatids followed by much reduced levels of v3 while v2, v4 and v5 were barely detectable (Fig. 5F). In the present study, commercially available recombinant mouse PRMT4 enzyme (cat. no. 14-575, Millipore), that has the same sequence as the v1 of rat PRMT4, was used for in vitro methylation of TP2 (Fig. 4F). In order to test the potential of other PRMT4 variants to methylate TP2, their mammalian expression constructs with N-terminal FLAG tag were transfected in HEK293T cells. The expressed PRMT4 variants were captured on M2 agarose beads and used as enzyme source. All PRMT4 variants methylated histone H3 and TP2. The active site mutant of PRMT4-E267Q (negative control) did not methylate histone H3 and TP2 (Fig. 5G). The first 490 residues of PRMT4 comprising of pre-core, core and C-extension sequence from post core region accounts for intact methyltransferase domain and is essential for its catalytic activity (50). PRMT41-490 methylated both histone H3 and TP2 (Fig. 5H). The results clearly show that all PRMT4 variants containing the intact methyltransferase domain could methylate both histone H3 and TP2, despite their differences in their C-terminal sequences.

TP2K88me1 and TP2R92me1 are present in elongating to condensing spermatids To get insights into role of TP2 methylation, modification specific antibodies were raised against K88me1 and R92me1 peptides. TP2K88me1 and TP2R92me1 were identified in the mass spectrometry analysis of endogenous protein and established as methylation site for KMT7 and PRMT4 respectively by in vitro mutational analysis. Dot blot analysis was performed to check the specificity of antiTP2K88me1 and anti-TP2R92me1 affinity purified antibodies. Both antibodies reacted only with respective methylated peptides but not with the corresponding backbone sequence (Fig. 9A). To validate further the mono-specificity of antiTP2K88me1 and anti-TP2R92me1 antibodies,

KMT7 methylates TP2 at Lys88 and Lys91 Further experiments were directed to establish the presence of KMT7 in the haploid spermatids. Primers were designed which amplified different regions of KMT7 and it confirmed the presence of KMT7 transcripts in 13


round spermatids (Fig. 8A). Indirect immunofluorescence was also performed to look for protein expression in elongating/condensing spermatids. KMT7 was found to be present in all the steps where TP2 is expressed, with most of the KMT7 being localized in the cytoplasm of the spermatid nuclei and relatively less KMT7 pixels were observed within the spermatid nuclei (Fig. 8B). To confirm that KMT7 is indeed present in the elongating and condensing spermatid nuclei, western blot analysis was performed which established the presence of KMT7 in the SRS nuclear lysate (Fig. 8C). Mass spectrometry data of endogenous TP2 revealed lysine methylation at Lys83, Lys88 and Lys91 amino acid residues. In vitro methylation of rTP2 by KMT7 was performed and then subjected to V8 protease digestion. Autoradiogram showed that only the C-terminus of TP2 gets methylated by KMT7 (Fig. 8D). This indicates that Lys88 and Lys91 could be the possible sites for KMT7 since K83 resides in the N-terminal fragment generated after V8 protease cleavage. Lys88 and Lys91 residues present in the C-terminus of rat TP2 were mutated to arginine and subjected to in vitro methylation by KMT7. In vitro methylation assay revealed Lys88 as the major site of methylation as it resulted in more than 80% loss of modification, with Lys91 being a minor site (Fig. 8E). It is quite possible that K83me2 could be a potential substrate for some other lysine methyltransferase; however this has not been addressed in the present study.

Lysine methylation of TP2 by KMT7 Lysine methylation is catalyzed by lysine methyltransferases (KMTs) which are classified into 8 distinct subfamilies based on the presence of protein domains like SET domain or sharing of homologous sequences. They transfer one, two or three methyl groups from S-adenosyl-Lmethionine to the ε–amino group of lysine to generate mono-, di-, or tri-methyl lysine in histones and various non-histone proteins (51, 52). Mass spectrometry analysis of endogenous transition proteins revealed TP1 to be monomethylated at Lys25 and Lys39 and TP2 to be dimethylated at Lys83 and mono-methylated at Lys88 and Lys91 (Fig. 7A). Lysine methylation of endogenous transition proteins was reconfirmed by probing purified endogenous protein with mono and dimethyllysine antibody (Fig. 7B). Among lysine methyltransferases, KMT7 is known to methylate many non-histone proteins (52). Based on the site of methylation in known substrates and peptide array, KMT7 appears to have broad recognition sequence motif (53, 54). We tested the possibility of KMT7 mediated methylation of spermatid proteins. As previously observed with arginine methyltransferases, KMT7 also methylated many basic proteins extracted by 0.4N HCl and 10% PCA from sonication resistant spermatid nuclei, suggesting the importance of protein methylation in mammalian spermiogenesis (Fig. 7C). Further, both endogenous TP1 and TP2 get methylated by KMT7 in vitro, with TP2 being a better substrate (Fig. 7D). Surprisingly, a double band was observed at position of TP2; the upper band could be a modified form of TP2, which could be a better substrate for KMT7 or some minor impurity migrating at that position getting methylated by KMT7. KMT7 mediated methylation of TP2 was further confirmed by performing an in vitro methylation reaction using recombinant TP2 as the substrate (Fig. 7E). Histone H3 which is a known substrate for KMT7 served as a positive control.

with the condensation of nuclei moving from head to tail region. Cut-mask image representing the colocalized pixels and pixel counts for TP2, TP2K88me1 and TP2R92me1 are depicted for each of the presented spermatid (Fig. 9E and 9F). DISCUSSION Essential steps involved in chromatin reorganization during mammalian spermiogenesis have been known for more than three decades but the molecular mechanism(s) which transform the nucleo-histone architecture to nucleo-protamine fiber via the deposition of intermediate basic proteins, transition proteins still remains elusive. Besides the changes in chromatin constitution, multiple events takes place during spermiogenesis namely a) global transcriptional shut down, b) DNA repair, c) territorial movement of chromosomes, d) shaping of spermatid nuclei, e) establishment of specialized chromatin domains and f) proteasomal machinery to remove evicted chromatin proteins during spermiogenesis (3). This is indicative of the necessity for the involvement of chromatin remodeling machinery, chaperones, chromatin readers, repair machinery and their interaction with transition proteins and protamines. We now report for the first time, a comprehensive study of the post-translational modification repertoire of the transition proteins, TP1 and TP2, which constitute majority of the chromatin basic protein in spermatids. These PTMs may play an active role in several aspects of spermiogenesis processes. The presence of post-translational modifications can alter transition protein interaction with DNA and ensuing chromatin condensation. In the case of TP1, basic amino acids flanking Tyr33 and Tyr51 have been proposed to be involved in the destabilization of chromatin as determined by the quenching of tyrosine fluorescence upon binding of TP1 with DNA (21). Notably, TP1 does not have a defined condensation domain as none of the TP1 peptides could mimic the condensation achieved by full-length protein suggesting involvement of basic amino acids across the length of protein (55). It is possible that post-translational modifications identified on TP1 can modulate its destabilization property (Fig. 10A). Three functional domains have been elucidated for TP2 including two zinc fingers in its N-terminus (zinc finger 1: His12, His14, His16 & His24; zinc finger 14


western blot analysis was performed with acid soluble proteins extracted from 35 and 70 day old rat testis nuclei. 70 day old adult rat testis contains all the germ cells including mature spermatozoa whereas 35 day old rats are devoid of spermatids and therefore lacks spermatid-specific transition proteins. Both methylation specific antibodies and anti-TP2 antibodies picked a single band in the lane with proteins extracted from adult rat (70 day old) testicular nuclei. This signal was completely abolished when methylation specific antibodies were pre-incubated with ~50 molar excess (peptide to IgG) of respective methylated peptides as indicated (Fig. 9B). In order to establish whether TP2K88me1 and TP2R92me1 are present on in nucleoplasmic or bound to chromatin, total testicular nuclei was fractionated into soluble and chromatin fractions. Western blot analysis revealed that both TP2K88me1 and TP2R92me1 predominantly associate with chromatin (Fig. 9C). Next we were curious to examine at what steps of spermiogenesis the methylation of TP2 is taking place. Polyclonal anti-TP2 antibodies used in earlier experiments were raised against rat endogenous TP2 and may recognize epitope(s) comprising of post-translational modifications present on the endogenous protein. To avoid any complications that can arise from such overlapping specificity, rTP2 was expressed in E. coli and was used to raise TP2 polyclonal antibodies by immunizing female New Zealand White rabbits and BALB/c mice as described in experimental procedures. The specificity of these antibodies was confirmed by western blot analysis with rat testicular lysate (Fig. 9D). Immunofluorescence experiment with these antibodies revealed the same localization pattern of TP2 as with the previous anti-TP2 antibodies raised against the endogenous TP2 in different steps of spermiogenesis. Immunofluorescence experiment using anti-rTP2 antibody as a reference showed that TP2K88me1 and TP2R92me1 show very similar progression across steps of spermiogenesis. TP2K88me1 and TP2R92me1 appear in the elongating spermatids and later show elevated levels in elongated spermatids. During midspermiogenesis, TP2K88me1 and TP2R92me1 staining is present throughout the nucleus. TP2, TP2K88me1 and TP2R92me1 signal progressively disappeared from head to the tail region of the differentiating spermatids. This was accompanied

interaction properties, may also mediate interaction with the chromatin machinery to bring about histone replacement and other spermiogenic events. TP2 protein is already known to interact with two chaperones, HSPA2 and NPM3 (32, 61). Interaction of NPM3 with TP2 gets abolished in the presence of TP2 C-terminal acetylation catalyzed by KAT3B (p300) (32). Many of the histone modification reader proteins are expressed during spermiogenesis like Brdt, Cdyl, NRDc (10, 11, 62–65) and it is quite likely that some of these readers may recognize PTMs of TPs and protamines and confer structural/functional changes to spermatid chromatin architecture. Acetylation mediated proteasomal degradation has been shown to be necessary for the removal of evicted acetylated histone H4 during spermiogenesis (66) and a similar mechanism might also operate for the transition proteins for their degradation in late spermiogenic steps. In this context, notably, both endogenous major transition proteins, TP1 and TP2, are acetylated as demonstrated in the present study. Chromosomes occupy specific positions in the spermatozoal nucleus and this territorial reorganization begins in spermatids with simultaneous shaping of nuclei during spermiogenesis associated with change in chromatin composition (67, 68). Phosphorylated protamine P1 interacts with lamin B receptor (LBR), a component of inner nuclear membrane (69). Transition proteins TP1 and TP2 show distinct staining pattern with AT- and GC-rich DNA as they are spatio-temporally organized during spermiogenesis (36). It is possible that TPs by virtue of their modification(s) may interact with the components of nuclear lamina (similar to phosphorylated protamine P1) and manchette and help in the reorganization of chromatin and shaping of nuclei (68). Among all the PTMs associated with TP2, the presence of TP2K88me1 and TP2R92me1 has been demonstrated in elongating and condensing spermatids by modification specific antibodies (Fig 9). Availability of these two modification specific antibodies would facilitate efforts in future to identify interacting proteins and to address some of the proposed functions mentioned above. Protein modifying enzymes have been extensively characterized with respect to histones, however, not much is known about their presence and role in chromatin remodeling events during 15


2: Cys29, Cys31, Cys35 & Cys38), DNA condensation domain in C-terminus (residues 87114) (23–26, 56) and the nuclear localization signal (residues 87-95) (26, 27). In this study, several PTM sites have been identified within or in the vicinity of these functional domains and it would be worth investigating whether these modifications modulate the functions exhibited by these functional domains (Fig. 10B). Earlier in vitro studies have shown that TP2 acetylation by KAT3B (p300) enzyme or phosphorylation by PKA-cs enzyme in its C-terminus reduces its ability to condense DNA (25, 30, 32). In this study, 7 PTMs were identified in the C-terminus of TP2, confirming the presence of some of the earlier postulated sites (Fig. 10B). In comparison to TP1, which exhibits good sequence conservation, the TP2 sequence has diverged across mammalian species. Notably, TP2 and protamine (PRM1 and PRM2) genes, are located in same the chromatin loop domain (57), and all of them exhibit positive Darwinian selection (58–60). It is plausible that TP1 may fulfil conserved functions across mammals, while TP2 may additionally help in creating organism specific imprint in the spermatozoa. This is further exemplified by the fact that TP2 appears one step before TP1 in spermiogenesis and requires an active process to enter the nucleus, while TP1 makes a passive entry into the nucleus. Many of the amino acid residues which undergo posttranslational modification on endogenous transition proteins, TP1 and TP2, are present on non-conserved amino acids. In some cases homologous amino acids are present in other organisms which may get post-translationally modified conferring functional conservation but many others lack any such homologous amino acid residues and thus appear to be lineage and/or organism specific. Interestingly, most of the PTMs identified on mouse protamines are also present on non-conserved amino acid residues (17). This indicates that sequence divergence of transition proteins and protamines and the presence of posttranslational modifications on non-conserved residues might contribute to the remodeling of sperm chromatin in a unique manner characteristic to each of the different mammalian species. It is intuitive to believe that posttranslational modifications of transition proteins in addition to modulating their DNA/chromatin

involved in the sperm epigenome establishment, its transmission to the zygote and influence of the environment. Selective histone replacement by transition proteins during mid-spermiogenesis can create an imprint, which we propose as spermatid epigenome which may directly or indirectly influence the sperm epigenome landscape. Some of questions to be addressed to understand this transformation process are: a) Whether the genomic distribution of histones and protamines is entirely decided during the replacement of histones by transition proteins or protamines also displace some of the histones directly, besides occupying the transition protein bound chromatin loci? b) Whether chromatin regions which escape histone eviction, bear characteristic epigenetic marks? c) Whether PTMs of testicular sperm histones and protamines are identical or different from what has been identified in the mature sperm? d) Besides possible role of PTMs of TPs and protamines in chromatin-templated processes, do these PTM marks specific chromatin domains and also influence DNA methylation pattern? It would be worthwhile to map the epigenomic landscape of a few mammalian model organisms, from condensing spermatids, and compare them with mature epididymal sperm, particularly with respect to positioning and PTM repertoire of nucleosomal histones, transition proteins and protamines to understand how spermatid epigenome finally shapes the sperm epigenome.

16


spermiogenesis and more specifically with respect to transition proteins and protamines (30, 31, 70). The present study has demonstrated the presence of various PRMTs and KMT7 in spermatids and also the existence of several uncharacterized potential substrates (Fig. 4D and Fig. 7C). For a comprehensive understanding of the mechanisms involved in chromatin remodeling events during spermiogenesis, it becomes necessary to identify and characterize the role of chromatin modifying enzymes that carry out covalent modification of basic proteins expressed in spermiogenesis process. For a very long time, sperm was believed to contribute just the genetic material to the offspring as histones are replaced by protamines in sperms to achieve compact packaging, hydrodynamic shape and resistance to genotoxic insults (71, 72). Studies in the last decade have shown that sperm also contributes to the epigenetic landscape of the zygote (73, 74) and carries the epigenetic information in four forms: non-random genomic occupancy of canonical histones, histone variants and protamines (8, 9, 12), presence of post-translational modifications on histones and protamines (9, 15, 17), DNA methylation pattern of spermatozoa (75–78) and spermatozoal RNA (79, 80). Environmental insults are known to alter sperm epigenome which results in off-springs with clinical manifestations (81). Therefore, this makes it very important to understand the mechanisms and the various steps

REFERENCES 1. 2. 3. 4. 5.

6. 7.

9.

10.

11.

12.

13.

14.

15.

16.

17. 18.

17


8.

Bannister, A. J., and Kouzarides, T. (2011) Regulation of chromatin by histone modifications. Cell Res. 21, 381–95 Bernstein, B. E., Meissner, A., and Lander, E. S. (2007) The mammalian epigenome. Cell. 128, 669–81 Rathke, C., Baarends, W. M., Awe, S., and Renkawitz-Pohl, R. (2014) Chromatin dynamics during spermiogenesis. Biochim. Biophys. Acta. 1839, 155–68 Meistrich, M. L., Mohapatra, B., Shirley, C. R., and Zhao, M. (2003) Roles of transition nuclear proteins in spermiogenesis. Chromosoma. 111, 483–8 Pradeepa, M. M., and Rao, M. R. S. (2007) Chromatin remodeling during mammalian spermatogenesis: role of testis specific histone variants and transition proteins. Soc. Reprod. Fertil. Suppl. 63, 1–10 Gaucher, J., Reynoird, N., Montellier, E., Boussouar, F., Rousseaux, S., and Khochbin, S. (2010) From meiosis to postmeiotic events: the secrets of histone disappearance. FEBS J. 277, 599–604 Sassone-Corsi, P. (2002) Unique chromatin remodeling and transcriptional regulation in spermatogenesis. Science. 296, 2176–8 Hammoud, S. S., Nix, D. A., Zhang, H., Purwar, J., Carrell, D. T., and Cairns, B. R. (2009) Distinctive chromatin in human sperm packages genes for embryo development. Nature. 460, 473–8 Brykczynska, U., Hisano, M., Erkek, S., Ramos, L., Oakeley, E. J., Roloff, T. C., Beisel, C., Schübeler, D., Stadler, M. B., and Peters, A. H. F. M. (2010) Repressive and active histone methylation mark distinct promoters in human and mouse spermatozoa. Nat. Struct. Mol. Biol. 17, 679–87 Dhar, S., Thota, A., and Rao, M. R. S. (2012) Insights into role of bromodomain, testis-specific (Brdt) in acetylated histone H4-dependent chromatin remodeling in mammalian spermiogenesis. J. Biol. Chem. 287, 6387–405 Gaucher, J., Boussouar, F., Montellier, E., Curtet, S., Buchou, T., Bertrand, S., Hery, P., Jounier, S., Depaux, A., Vitte, A.-L., Guardiola, P., Pernet, K., Debernardi, A., Lopez, F., Holota, H., Imbert, J., Wolgemuth, D. J., Gérard, M., Rousseaux, S., and Khochbin, S. (2012) Bromodomaindependent stage-specific male genome programming by Brdt. EMBO J. 31, 3809–3820 Gardiner-Garden, M., Ballesteros, M., Gordon, M., and Tam, P. P. (1998) Histone- and protamineDNA association: conservation of different patterns within the beta-globin domain in human sperm. Mol. Cell. Biol. 18, 3350–6 Samans, B., Yang, Y., Krebs, S., Sarode, G. V., Blum, H., Reichenbach, M., Wolf, E., Steger, K., Dansranjavin, T., and Schagdarsurengin, U. (2014) Uniformity of Nucleosome Preservation Pattern in Mammalian Sperm and Its Connection to Repetitive DNA Elements. Dev. Cell. 30, 23– 35 Carone, B. R., Hung, J.-H., Hainer, S. J., Chou, M.-T., Carone, D. M., Weng, Z., Fazzio, T. G., and Rando, O. J. (2014) High-Resolution Mapping of Chromatin Packaging in Mouse Embryonic Stem Cells and Sperm. Dev. Cell. 30, 11–22 Xue, Z., Huang, K., Cai, C., Cai, L., Jiang, C., Feng, Y., Liu, Z., Zeng, Q., Cheng, L., Sun, Y. E., Liu, J., Horvath, S., and Fan, G. (2013) Genetic programs in human and mouse early embryos revealed by single-cell RNA sequencing. Nature. 500, 593–7 Erkek, S., Hisano, M., Liang, C.-Y., Gill, M., Murr, R., Dieker, J., Schübeler, D., van der Vlag, J., Stadler, M. B., and Peters, A. H. F. M. (2013) Molecular determinants of nucleosome retention at CpG-rich sequences in mouse spermatozoa. Nat. Struct. Mol. Biol. 20, 868–75 Brunner, A. M., Nanni, P., and Mansuy, I. M. (2014) Epigenetic marking of sperm by posttranslational modification of histones and protamines. Epigenetics Chromatin. 7, 2 Carrell, D. T. (2012) Epigenetics of the male gamete. Fertil. Steril. 97, 267–74

19.

20.

21.

22. 23. 24. 25.

27.

28.

29.

30.

31.

32.

33.

34. 35.

36.

18


26.

Rathke, C., Baarends, W. M., Jayaramaiah-Raja, S., Bartkuhn, M., Renkawitz, R., and RenkawitzPohl, R. (2007) Transition from a nucleosome-based to a protamine-based chromatin configuration during spermiogenesis in Drosophila. J. Cell Sci. 120, 1689–1700 Shirley, C. R., Hayashi, S., Mounsey, S., Yanagimachi, R., and Meistrich, M. L. (2004) Abnormalities and reduced reproductive potential of sperm from Tnp1- and Tnp2-null double mutant mice. Biol. Reprod. 71, 1220–9 Singh, J., and Rao, M. R. S. (1987) Interaction of rat testis protein, TP, with nucleic acids in vitro. Fluorescence quenching, UV absorption, and thermal denaturation studies. J. Biol. Chem. 262, 734–740 Caron, N., Veilleux, S., and Boissonneault, G. (2001) Stimulation of DNA repair by the spermatidal TP1 protein. Mol. Reprod. Dev. 58, 437–43 Baskaran, R., and Rao, M. R. S. (1990) Interaction of spermatid-specific protein TP2 with nucleic acids, in vitro. A comparative study with TP1. J. Biol. Chem. 265, 21039–21047 Kundu, T. K., and Rao, M. R. S. (1994) Characterization of the zinc-metalloprotein protein TP2 nature of rat spermatidal. FEBS Lett. 351, 6–10 Kundu, T. K., and Rao, M. R. S. (1995) DNA condensation by the rat spermatidal protein TP2 shows GC-rich sequence preference and is zinc dependent. Biochemistry. 34, 5143–5150 Meetei, A. R., Ullas, K. S., and Rao, M. R. S. (2000) Identification of two novel zinc finger modules and nuclear localization signal in rat spermatidal protein TP2 by site-directed mutagenesis. J. Biol. Chem. 275, 38500–7 Pradeepa, M. M., Manjunatha, S., Sathish, V., Agrawal, S., and Rao, M. R. S. (2008) Involvement of importin-4 in the transport of transition protein 2 into the spermatid nucleus. Mol. Cell. Biol. 28, 4331–41 Akama, K., Kondo, M., Sato, H., and Nakano, M. (1999) Transition protein 4 from boar late spermatid nuclei is a topological factor that stimulates DNA-relaxing activity of topoisomerase I. FEBS Lett. 442, 189–92 Lévesque, D., Veilleux, S., Caron, N., and Boissonneault, G. (1998) Architectural DNA-binding properties of the spermatidal transition proteins 1 and 2. Biochem. Biophys. Res. Commun. 252, 602–9 Meetei, A. R., Ullas, K. S., Vasupradha, V., and Rao, M. R. S. (2002) Involvement of protein kinase A in the phosphorylation of spermatidal protein TP2 and its effect on DNA condensation. Biochemistry. 41, 185–95 Ullas, K. S., and Rao, M. R. S. (2003) Phosphorylation of rat spermatidal protein TP2 by spermspecific protein kinase A and modulation of its transport into the haploid nucleus. J. Biol. Chem. 278, 52673–80 Pradeepa, M. M., Nikhil, G., Hari Kishore, A., Bharath, G. N., Kundu, T. K., and Rao, M. R. (2009) Acetylation of transition protein 2 (TP2) by KAT3B (p300) alters its DNA condensation property and interaction with putative histone chaperone NPM3. J. Biol. Chem. 284, 29956–67 Ohkura, N., Takahashi, M., Yaguchi, H., Nagamura, Y., and Tsukada, T. (2005) Coactivatorassociated arginine methyltransferase 1, CARM1, affects pre-mRNA splicing in an isoformspecific manner. J. Biol. Chem. 280, 28927–35 Meetei, A. R., and Rao, M. R. S. (1996) Cloning of cDNA encoding rat spermatidal protein TP2 and expression in Escherichia coli. Protein Expr. Purif. 8, 409–15 Meetei, A. R., and Rao, M. R. (1998) Hyperexpression of rat spermatidal protein TP2 in Escherichia coli by codon optimization and engineering the vector-encoded 5’ UTR. Protein Expr. Purif. 13, 184–90 Kolthur-Seetharam, U., Pradeepa, M. M., Gupta, N., Narayanaswamy, R., and Rao, M. R. S. (2009) Spatiotemporal organization of AT- and GC-rich DNA and their association with transition proteins TP1 and TP2 in rat condensing spermatids. J. Histochem. Cytochem. 57, 951–62

37.

38.

39.

40. 41. 42. 43.

45. 46.

47. 48.

49.

50.

51. 52. 53. 54.

55. 56.

19


44.

Perosa, F., Carbone, R., Ferrone, S., and Dammacco, F. (1990) Purification of human immunoglobulins by sequential precipitation with caprylic acid and ammonium sulphate. J. Immunol. Methods. 128, 9–16 Garcia, B. A., Mollah, S., Ueberheide, B. M., Busby, S. A., Muratore, T. L., Shabanowitz, J., and Hunt, D. F. (2007) Chemical derivatization of histones for facilitated analysis by mass spectrometry. Nat. Protoc. 2, 933–8 Beausoleil, S. A., Villén, J., Gerber, S. A., Rush, J., and Gygi, S. P. (2006) A probability-based approach for high-throughput protein phosphorylation analysis and site localization. Nat. Biotechnol. 24, 1285–92 Shechter, D., Dormann, H. L., Allis, C. D., and Hake, S. B. (2007) Extraction, purification and analysis of histones. Nat. Protoc. 2, 1445–57 Waterborg, J. H. (2002) Acid – Urea – Triton Polyacrylamide Gel Electrophoresis of Histones. Protein Protoc. Handb. Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729 Song, S., Liu, L., Edwards, S. V, and Wu, S. (2012) Resolving conflict in eutherian mammal phylogeny using phylogenomics and the multispecies coalescent model. Proc. Natl. Acad. Sci. U. S. A. 109, 14942–7 Bedford, M. T., and Clarke, S. G. (2009) Protein Arginine Methylation in Mammals: Who, What, and Why. Mol. Cell. 33, 1–13 Yang, Y., and Bedford, M. T. (2013) Protein arginine methyltransferases and cancer. Nat. Rev. Cancer. 13, 37–50 Cook, J. R., Lee, J.-H., Yang, Z.-H., Krause, C. D., Herth, N., Hoffmann, R., and Pestka, S. (2006) FBXO11/PRMT9, a new protein arginine methyltransferase, symmetrically dimethylates arginine residues. Biochem. Biophys. Res. Commun. 342, 472–81 Siomi, M. C., Mannen, T., and Siomi, H. (2010) How does the royal family of Tudor rule the PIWI-interacting RNA pathway? Genes Dev. 24, 636–46 Lee, Y.-H., Koh, S. S., Zhang, X., Cheng, X., and Stallcup, M. R. (2002) Synergy among nuclear receptor coactivators: selective requirement for protein methyltransferase and acetyltransferase activities. Mol. Cell. Biol. 22, 3621–3632 Schurter, B. T., Koh, S. S., Chen, D., Bunick, G. J., Harp, J. M., Hanson, B. L., Henschen-Edman, a, Mackay, D. R., Stallcup, M. R., and Aswad, D. W. (2001) Methylation of histone H3 by coactivator-associated arginine methyltransferase 1. Biochemistry. 40, 5747–56 Yue, W. W., Hassler, M., Roe, S. M., Thompson-Vale, V., and Pearl, L. H. (2007) Insights into histone code syntax from structural and biochemical studies of CARM1 methyltransferase. EMBO J. 26, 4402–12 Zhang, X., Wen, H., and Shi, X. (2012) Lysine methylation: Beyond histones. Acta Biochim. Biophys. Sin. (Shanghai). 44, 14–27 Lanouette, S., Mongeon, V., Figeys, D., and Couture, J.-F. (2014) The functional diversity of protein lysine methylation. Mol. Syst. Biol. 10, 724 Del Rizzo, P. A., and Trievel, R. C. (2011) Substrate and product specificities of SET domain methyltransferases. Epigenetics. 6, 1059–1067 Dhayalan, A., Kudithipudi, S., Rathert, P., and Jeltsch, A. (2011) Specificity Analysis-Based Identification of New Methylation Targets of the SET7 / 9 Protein Lysine Methyltransferase. Chem. Biol. 18, 111–120 Brewer, L., Corzett, M., and Balhorn, R. (2002) Condensation of DNA by spermatid basic nuclear proteins. J. Biol. Chem. 277, 38895–900 Baskaran, R., and Rao, M. R. (1991) Mammalian spermatid specific protein, TP2, is a zinc metalloprotein with two finger motifs. Biochem. Biophys. Res. Commun. 179, 1491–1499

57.

58. 59. 60. 61.

62. 63.

65.

66.

67.

68. 69.

70.

71. 72. 73. 74. 75. 76.

20


64.

Martins, R. P., Charles Ostermeier, G., Krawetz, S. A., and Ostermeier, G. C. (2004) Nuclear matrix interactions at the human protamine domain: A working model of potentiation. J. Biol. Chem. 279, 51862–51868 Wyckoff, G. J., Wang, W., and Wu, C. I. (2000) Rapid evolution of male reproductive genes in the descent of man. Nature. 403, 304–309 Swanson, W. J., and Vacquier, V. D. (2002) REPRODUCTIVE PROTEIN EVOLUTION. Annu. Rev. Ecol. Syst. 33, 161–179 Vicens, A., Lüke, L., and Roldan, E. R. S. (2014) Proteins involved in motility and sperm-egg interaction evolve more rapidly in mouse spermatozoa. PLoS One. 9, e91302 Govin, J., Caron, C., Escoffier, E., Ferro, M., Kuhn, L., Rousseaux, S., Eddy, E. M., Garin, J., and Khochbin, S. (2006) Post-meiotic shifts in HSPA2/HSP70.2 chaperone activity during mouse spermatogenesis. J. Biol. Chem. 281, 37888–92 Caron, C., Pivot-Pajot, C., van Grunsven, L. A., Col, E., Lestrat, C., Rousseaux, S., and Khochbin, S. (2003) Cdyl: a new transcriptional co-repressor. EMBO Rep. 4, 877–82 Escamilla-Del-Arenal, M., da Rocha, S. T., Spruijt, C. G., Masui, O., Renaud, O., Smits, A. H., Margueron, R., Vermeulen, M., and Heard, E. (2013) Cdyl, a new partner of the inactive X chromosome and potential reader of H3K27me3 and H3K9me2. Mol. Cell. Biol. 33, 5005–20 Chesneau, V., Prat, A., Segretain, D., Hospital, V., Dupaix, A., Foulon, T., Jégou, B., and Cohen, P. (1996) NRD convertase: a putative processing endoprotease associated with the axoneme and the manchette in late spermatids. J. Cell Sci. 109, 2737–45 Li, J. J., Chu, M., Wang, S., Chan, D., Qi, S., Wu, M., Zhou, Z., Nishi, E., Qin, J., and Wong, J. (2012) Identification and characterization of nardilysin as a novel dimethyl H3K4-binding protein involved in transcriptional regulation. J. Biol. Chem. 287, 10089–98 Qian, M.-X., Pang, Y., Liu, C. H., Haratake, K., Du, B.-Y., Ji, D.-Y., Wang, G.-F., Zhu, Q.-Q., Song, W., Yu, Y., Zhang, X.-X., Huang, H.-T., Miao, S., Chen, L.-B., Zhang, Z.-H., Liang, Y.-N., Liu, S., Cha, H., Yang, D., Zhai, Y., Komatsu, T., Tsuruta, F., Li, H., Cao, C., Li, W., Li, G.-H., Cheng, Y., Chiba, T., Wang, L., Goldberg, A. L., Shen, Y., and Qiu, X.-B. (2013) Acetylationmediated proteasomal degradation of core histones during DNA repair and spermatogenesis. Cell. 153, 1012–24 Foster, H. A., Abeydeera, L. R., Griffin, D. K., and Bridger, J. M. (2005) Non-random chromosome positioning in mammalian sperm nuclei, with migration of the sex chromosomes during late spermatogenesis. J. Cell Sci. 118, 1811–1820 Kierszenbaum, A. L., and Tres, L. L. (2004) The acrosome-acroplaxome-manchette complex and the shaping of the spermatid head. Arch. Histol. Cytol. 67, 271–284 Mylonis, I., Drosou, V., Brancorsini, S., Nikolakaki, E., Sassone-Corsi, P., and Giannakouros, T. (2004) Temporal association of protamine 1 with the inner nuclear membrane protein lamin B receptor during spermiogenesis. J. Biol. Chem. 279, 11626–11631 Wu, J. Y., Ribar, T. J., Cummings, D. E., Burton, K. A., McKnight, G. S., and Means, a R. (2000) Spermiogenesis and exchange of basic nuclear proteins are impaired in male germ cells lacking Camk4. Nat. Genet. 25, 448–52 Braun, R. E. (2001) Packaging paternal chromosomes with protamine. Nat. Genet. 28, 10–12 Balhorn, R. (2007) The protamine family of sperm nuclear proteins. Genome Biol. 8, 227 Lane, M., Robker, R. L., and Robertson, S. A. (2014) Parenting from before conception. Science 345, 756–760 Rando, O. J. (2012) Daddy issues: paternal effects on phenotype. Cell. 151, 702–8 Lucifero, D., Mertineit, C., Clarke, H. J., Bestor, T. H., and Trasler, J. M. (2002) Methylation dynamics of imprinted genes in mouse germ cells. Genomics. 79, 530–538 Niemitz, E. L., and Feinberg, A. P. (2004) Epigenetics and assisted reproductive technology: a call for investigation. Am. J. Hum. Genet. 74, 599–609

77.

78. 79. 80.

81.

Lane, N., Dean, W., Erhardt, S., Hajkova, P., Surani, A., Walter, J., and Reik, W. (2003) Resistance of IAPs to methylation reprogramming may provide a mechanism for epigenetic inheritance in the mouse. Genesis. 35, 88–93 Guibert, S., Forné, T., and Weber, M. (2012) Global profiling of DNA methylation erasure in mouse primordial germ cells. Genome Res. 22, 633–641 Kiani, J., and Rassoulzadegan, M. (2013) A load of small RNAs in the sperm - how many bits of hereditary information? Cell Res. 23, 18–9 Sendler, E., Johnson, G. D., Mao, S., Goodrich, R. J., Diamond, M. P., Hauser, R., and Krawetz, S. A. (2013) Stability, delivery and functions of human sperm RNAs at fertilization. Nucleic Acids Res. 41, 4104–4117 Soubry, A., Hoyo, C., Jirtle, R. L., and Murphy, S. K. (2014) A paternal environmental legacy: evidence for epigenetic inheritance through the male germ line. Bioessays. 36, 359–71


21

FOOTNOTES The sequence of PRMT4-v5 is deposited in GenBank under accession number KJ672502. ACKNOWLEDGEMENTS This work was supported by the Department of Biotechnology, India. M.R.S.R. acknowledges Department of Science and Technology for J. C. Bose and S.E.R.B. Distinguished fellowships. N.G. acknowledges Council of Scientific and Industrial Research, India for senior research fellowship. We thank B. S. Suma and Anitha G. for help with confocal microscopy and sanger sequencing respectively. We thank PTM Biolabs, Co., Ltd (Chicago, IL, USA) and MS Bioworks, LLC (Ann arbour, MI, USA) for mass spectrometry analysis. FIGURE LEGENDS

FIGURE 2. Post-translational modifications of endogenous transition proteins, TP1 and TP2. Posttranslational modifications identified by mass spectrometry of the endogenous transition protein, TP1 (A) and TP2 (B) are depicted. Sequence coverage was 91% and 84% for TP1 and TP2 respectively and covered regions are shown in box filled with vermillion color. PTMs are indicated by ac for acetylation, me1 and me2 for mono- and di-methylation and ph for phosphorylation. (See Table 2 and Table 3 for spectral information of identified post-translational modifications of TP1 and TP2 respectively) FIGURE 3. Sequence divergence of TP1 and TP2 and conservation of its PTM sites in mammals. The evolutionary history of transition protein TP1 (A) and TP2 (B) inferred using the Neighbor-Joining method is depicted. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The analysis involved TP1 and TP2 amino acid sequences from 8 mammals as indicated. The presented tree is unrooted. The optimal tree with the sum of branch length of 0.28693632 is shown for TP1 and optimal tree with the sum of branch length of 1.27529097 is shown for TP2. TP2 amino acid sequence has diverged more than TP1 across mammals as indicated by the difference in the branch length. Conservation of identified PTM sites in mammalian TP1 (C) and TP2 (D) across selected mammals (TP1: rat (P02317), mouse (P10856), human (P09430), chimpanzee (F7VJM6), rhesus macaque (F7VJL8), dog (E2RER7), cow (P17305) and pig (P17306); TP2: rat (P11101), mouse (P11378), human (Q05952), chimpanzee (B3LF34), rhesus macaque (Q9N1A3), dog (O77645), cow (P26377) and pig (P29258)). Mammals belonging to specific animal orders (rodentia, primates, carnivore and cetartiodactyla) are color

22


FIGURE 1. Purification of endogenous rat testicular TP1 and TP2. A, Fractionation of 0.4N HCl acid soluble proteins extracted from rat testicular nuclei by step gradient of TCA as indicated. Transition proteins get precipitated in the 3-30% TCA fraction as confirmed by western blotting using anti-TP1 and anti-TP2 antibodies. B, RP-HPLC chromatogram showing partial separation of transition proteins from the testis acid soluble proteins from 3-30% TCA fraction (see experimental procedures for details). C, Coomassie stained protein pattern of the two peaks from RP-HPLC (lane 1 corresponds to peak1 and lane 2 corresponds to peak 2). Presence of TP1 and TP2 in peak 1 was confirmed by western blotting using anti-TP1 and anti-TP2 antibodies. D, RP-HPLC chromatogram depicting the separation of proteins present in the peak 1 using a shallower gradient of solvent B. Peak corresponding to TP1 and TP2 protein is indicated. Coomassie stained gel showing separation of TP1 and TP2 in the fractions from the depicted peak. Fractions within the rectangular box were pooled. E, Coomassie stained gel showing the purity of transition protein used for identification of post-translational modifications and their identity was confirmed as TP1 and TP2 by western blotting. F, AUT-PAGE gel showing differentially modified forms of endogenous TP2 whereas TP1 migrated as a single band along with the dye front as seen in the coomassie stained gel and probed with anti-TP1 and anti-TP2 antibodies.

coded as indicated. PTM sites are indicated with black color. Sequences were aligned by Clustal Omega software. FIGURE 4. Arginine methylation of transition proteins by PRMT1 and PRMT4. A, Western blot analysis of endogenous transition proteins, TP1 and TP2 with anti-methylarginine antibodies. Both TP1 and TP2 reacted with the antibodies against monomethylarginine (MMA) and asymmetric dimethylarginine (ADMA) but not with symmetric dimethylarginine (SDMA). B, Expression levels of rat PRMT’s in round spermatids (haploid cells) as determined by quantitative PCR. Error bar indicates S.E.M. C, Stage wise expression of abundant PRMTs (PRMT1, PRMT4 and PRMT5) in the gametic diploid (GD), haploid (RS) and tetraploid pachytene spermatocytes (P) cells as determined by quantitative PCR. Error bar indicates S.E.M. D, In vitro methylation of acid soluble proteins extracted by 0.4N HCl (lane 1) and 10% PCA (lane 2) from rat sonication resistant spermatids (SRS) proteins by PRMT1, PRMT4 and PRMT5. Positions of TP1, TP2, H3 and H4 are indicated by arrows and their presence was confirmed by western blotting. E, In vitro methylation of purified endogenous transition proteins, TP1 and TP2 by PRMT1, PRMT4 and PRMT5. F, In vitro methylation of rTP2 by PRMT1, PRMT4 and PRMT5. TP2 is a bona fide substrate of PRMT4. G, In vitro methylation of rTP2 and positive control histone H3 with catalytically active PRMT4 and catalytically deficient PRMT4-E267Q.

FIGURE 6. Identification of the site of methylation of TP2 catalyzed by PRMT4. A, MS plots depicting TP2 R92me1 and R92me2 modifications identified on endogenous protein in mass spectrometry analysis. B, V8 protease digestion of in vitro methylated TP2 by PRMT4 which cleaves TP2 to generate 1-86 amino acids N-terminus and 87-114 amino acids C-terminus. N-terminus of TP2 is predominantly methylated whereas C-terminus also showed the presence of modification site. C, In vitro methylation of TP2-R92K mutant, indicating that Arg92 is the site for PRMT4 modification in the C23


FIGURE 5. All PRMT4 variants can methylate TP2. A, Localization of TP2 and PRMT4 in different steps of spermiogenesis (early spermatids to late spermatids represented from top to bottom). Scale bar, 5μm. B, Western blot analysis showing the presence of PRMT4 in sonication resistant spermatids (SRS) nuclear lysate. C, Western blot analysis of H3R17me2a (catalyzed by PRMT4) in acid soluble proteins extracted by 0.4N HCl from round spermatids (RS) and sonication resistant spermatid (SRS) nuclei. Acid soluble proteins from round spermatids has small quantity of TP2 which begins to express in step 9 whereas TP1 is present only in SRS nuclei acid soluble proteins which begins to express in step 10 of rat spermiogenesis. Western blot for histone H3 and H4 was used for assessing protein loading. D, Small stretch of rat chromosome 8 in rn5 rat genome database showing genomic sequence from C-terminus of PRMT4 gene highlighting difference between variant 1 and variant 5 (intron is depicted in black and exon is depicted in blue). Additional exonic sequence in PRMT4 variant 5 compared to variant 1 located in rat sequence is underlined with black color. E, Graphical representation of the rat PRMT4 gene organization highlighting C-terminus of PRMT4 isoforms generated by alternative splicing. Blue bars represent the exons whereas grey bars represent introns. Black vertical bars represent possible splice site and orange vertical bars represent stop codon. Black arrowheads represent the positions of splice sites indicating the differences in PRMT4 variants. A common set of primer (blue and green arrows) can amplify variant 1, 2, 4, and 5 generating different amplicon sizes. Another set (blue and yellow arrows) is for amplifying variant 3. PRMT4 N-terminus 1-490 has an intact methyltransferase domain; position of residue 490 is indicated. F, Semi-quantitative PCR to determine the presence of PRMT4 alternative splice variants in round spermatids. Cloned PRMT4 variants were amplified by primer sets mentioned above to demonstrate the expected amplicons. Amplicon size for different variants is indicated. PRMT4 v1 (more abundant) and v3 are present in round spermatids. G, In vitro methylation of histone H3 and TP2 using PRMT4 variants v2, v3, v4, v5 and PRMT4-E267Q expressed in HEK293T cells. H, In vitro methylation of histone H3 and TP2 using PRTMT41-490 fragment comprising 1-490 residues with intact methyltransferase domain.

terminus of TP2. D, In vitro methylation of TP2 arginine to lysine mutant proteins which reside in the Nterminus. R66K, R71K, R75K and R82K mutation resulted in reduced methylation level as seen in the autoradiogram. E, In vitro methylation of rTP2 with two arginine sites mutated to lysine with Arg75 being common in them. F, In vitro methylation of single site arginine to lysine rTP2 mutant proteins, Arg71 and Arg75. They are the major sites for PRMT4 methylation in vitro. G, In vitro methylation of TP2 R71K, R75K mutant proteins by PRTMT41-490 consisting of catalytically efficient methyltransferase domain. FIGURE 7. Lysine methyltransferase KMT7 methylates TP2. A, MS plots depicting lysine methylation sites on endogenous TP1 and TP2 identified by mass spectrometry analysis viz. K25me1 and K39me1 for TP1 and K83me2, K88me1 and K91me1 for TP2. B, Western blot analysis of endogenous transition proteins, TP1 and TP2 with antibodies against mono and dimethyllysine. C, In vitro methylation of 0.4N HCl (lane 1) and 10% PCA (lane 2) extract of rat sonication resistant spermatid (SRS) nuclear proteins by KMT7. KMT7 methylated several acid soluble proteins including at the position of TP2 as indicated. D, In vitro methylation of purified endogenous transition proteins, TP1 and TP2 and histone H3 (positive control) by KMT7. E, In vitro methylation of recombinant TP2 and histone H3 by KMT7.

FIGURE 9. TP2K88me1 and TP2R92me1 are present in elongating to condensing spermatids. A, Dot blot analysis of affinity purified anti-TP2K88me1 and anti-TP2R92me1 antibodies with respective unmethylated and methylated peptides. Spot 1 corresponds to backbone peptide and Spot 2 corresponds to the same peptide methylated at the respective amino acid. B, Western blot analysis of acid soluble proteins from 35 day (lane 1) and 70 day (lane 2) old rat testis nuclei with TP2K88me1 and TP2R92me1 antibodies in the presence or absence of peptide competition with 50 molar excess of respective methylated peptide as indicated. Western blot analysis with anti-TP2 antibodies served as positive control. C, Rat testis nuclei were separated into soluble (nucleoplasm, lane 1) and insoluble (chromatin, lane 2) fractions. Anti-GRP78 antibodies and Anti-histone H4 antibodies served as positive control to probe soluble fraction (lane 1) and insoluble fraction (lane 2) respectively. Ponceau staining indicates protein loading. D, Western blot analysis of rat testis nuclear lysate with affinity purified antibodies raised against recombinant TP2 in rabbit and mouse. E, and F, Localization of TP2K88me1 and TP2R92me1 in different steps of spermiogenesis (early spermatids to late spermatids represented from top to bottom) respectively with respect to the backbone staining of TP2. Scale bar, 5μm. The pixel counts for TP2 and methylation specific TP2 antibody for each step is represented in the right panel. FIGURE 10. PTMs in the context of functional properties of TP1 and TP2. A, PTM sites identified on TP1. Tyr33 and Tyr51 residues are also indicated. B, PTM sites in the context of functional domains of TP2 viz. zinc finger domains (zinc finger 1: His12, His14, His16 & His24; zinc finger 2: Cys29, Cys31, Cys35 & Cys38), nuclear localization signal (NLS, residues 87-95) and DNA condensing domain (residues 87-114) as depicted. In vitro phosphorylation sites for cs-PKA, Thr101 and Ser109, which were not covered in mass spectrometry analysis of endogenous TP2, are also depicted.

24


FIGURE 8. KMT7 methylates TP2 in the C-terminus at Lys88 and Lys91. A, Presence of KMT7 transcripts in round spermatids as detected by semi-quantitative PCR using three sets of primers as indicated. B, Localization of endogenous TP2 and KMT7 in spermatids at different steps of spermiogenesis (early spermatids to late spermatids represented from top to bottom). Scale bar, 5μm. C, Western blot analysis showing the presence of KMT7 in sonication resistant spermatid (SRS) nuclear lysate. D, V8 protease digestion of in vitro methylated TP2 by KMT7 which cleaves TP2 to generate 1-86 amino acids N-terminus and 87-114 amino acids C-terminus. C-terminus of TP2 gets methylated by KMT7. E, In vitro methylation of lysine to arginine site mutant TP2 proteins confirming Lys88 and Lys91 as the sites of methylation with Lys88 being the major site for KMT7 methylation.

Gene

Accession ID

PRMT1

NM_024363.1

PRMT3

PRMT4

PRMT4 v2

PRMT4 v3

PRMT5

PRMT6

PRMT7

Primers Sequence (5’-3’) FP

ACACTGTGCTGCACGCTCG

RP

TCCACCACGTCCACCAGGG

FP

TGGCCGTGAGTGACGTGAGC

RP

GCAACTGCCGTGCACATGGC

FP

GCCAGCACCATGGCTCAGCA

NM_053557.1 V1-AB201114.1 V2-AB201115.1 V3-AB201116.1 V4-AB201117.1 V5-KJ672502

RP

TGTTGCCGCTGGGCTTCAGG

FP

TGCGCACACGTTCAAGCTACCAG

RP

ATGGACATGGGCGAGGCCATAGA

FP

AGCAGTGTTATTGCTGGCGGCTC

RP

CACTGGTTTAGCTGGCCACTGG

FP

AGTCGGAGGTGCTGGTGGCA

RP

CGCGGGTGGAAGACAGGCAT

FP

GGTGGAGCTGCCGGAGCAAG

RP

TCGGGGCCACGAAGAGCTCA

FP

CTCGGCAGCGTGCCATAGCA

RP

GCATCCAGTGGTCCCGCCAC

AB201115.1


Table 1. List of primers used for quantitative PCR, semi-quantitative PCR, cloning and mutations. *TP2 sequence has been codon optimized for bacterial expression as described in experimental procedures section. Primer sequences were designed based on codon optimized rTP2 DNA sequence. For R66K, R75K rTP2 and R75K, R82K rTP2 mutation, plasmid with one of the mutation was used as template and other mutation was introduced using the listed primer sequence. FP-Forward Primer, RP-Reverse primer.

Length (bp) 199

253

211

193

AB201116.1

126

NM_001108867.2

132

NM_001106466.1

161

NM_001014153.1

173

25

Purpose

Real time PCR

PRMT10

FBXO11

NACA

PRMT4

AAGGCAGTGCGGTTGGGCTC

RP

GCAGCCACGACGTCACAAGC

FP

TGGCCGCGCCAAGATGGAAG

RP

GCGATCAAGCCTCCGCCCTC

FP

TGCAGCACCTGGGAAGGTTGC

RP

GGTGCGCGTTGTGATGCTGG

FP

ATGTCCAAACTGGGTCTTCG

RP

GGACAGCCTTTGCTCTTGAC

FP

GCGGCTCCAGCGTGGGTCAC

152

XM_001071167.4

NM_181631.2

NM_001198562.1

V1-AB201114.1 V2-AB201115.1 V3-AB201116.1 V4-AB201117.1 V5-KJ672502

RP V1, 2, 4 & 5

GGTCGGGATGGACATGGGCG

RP V3

GACAGCGACAGTGGTGGCAGAG

FP

155

352

V1-224 V2-353 V3-139 V4-155 V5-245

208 RP

CCACATAGGTGCCTTGCAGA

FP

CTGCAAGGCACCTATGTGGA

RP

CCATAGAGCGCAGTCCTCTG

FP

CAGAGGACTGCGCTCTATGG

RP

TGGAGATGAGAGAGTCGGCA

FP

GATGACAAGCTTATGGCAGCGGCGGCAGCGACGG

NM_001109558.1

Semiquantitative PCR

227

KMT7 Set III

PRMT4

153

GACGGATTACCACACGGGTT

KMT7 Set I

KMT7 Set II


FBXO10

FP NM_001191599.1

223

V1-AB201114.1 V2-AB201115.1 V3-AB201116.1

RP

GAATTCAGATCTCTAACTCCCATAGTGCATGGTGTT 26

V1-1827 V2-1956 V3-1722

Cloning

V4-AB201117.1 V5-KJ672502

PRMT4-E267Q

V1-AB201114.1

GG

V4-1758 V5-1848

RP V3

GAATTCAGATCTCTATGACAGCGACAGTGGTGGC

RP

GAATTCAGATCTCTAGTAGTGTGAGCCAGGCGG

FP

GGCTACATGCTCTTCAACCAACGTATGCTTGAGAGC TACC

RP

GGTAGCTCTCAAGCATACGTTGGTTGAAGAGCATG TAGCC

FP

CCGCACCCGCACAGCTCCTCTAAACCTCAAAGTCA CACC

RP

GGTGTGACTTTGAGGTTTAGAGGAGCTGTGCGGGT GCGG

FP

GCCTGCAGCCACCACTGCAAAAGCTGCAGCCAAGC AGGC

RP

GCCTGCTTGGCTGCAGCTTTTGCAGTGGTGGCTGCA GGC

FP

CCCAAAACACCCATGCACTCTAAATACTCACCTTCA CGTCCCAGC

RP

GCTGGGACGTGAAGGTGAGTATTTAGAGTGCATGG GTGTTTTGGG

FP

CGTTACTCACCTTCAAAACCCAGCCACCGCGGCAG C

RP

GCTGCCGCGGTGGCTGGGTTTTGAAGGTGAGTAAC G

FP

CCTTCACGTCCCAGCCACAAAGGCAGCTGCCCG

RP

CGGGCAGCTGCCTTTGTGGCTGGGACGTGAAGG

V1-AB201114.1

R20K rTP2

R36K rTP2

NM_017057.2* R66K rTP2

R71K rTP2

R75K rTP2

27


PRMT41-490

V1,2, 4 &5

1470

Not applicable

Mutation

CGCGGCAGCTGCCCGAAAAACAAAAAAACCCTGGA AGGC

RP

GCCTTCCAGGGTTTTTTTGTTTTTCGGGCAGCTGCC GCG

FP

GAAGGCAAAGTGAGCAAAAAGAAAGCGGTGCGTC GCCG

RP

CGGCGACGCACCGCTTTCTTTTTGCTCACTTTGCCTT C

FP

CGTTACTCACCTTCAAAACCCAGCCACAAAGGCAG CTGC

RP

GCAGCTGCCTTTGTGGCTGGGTTTTGAAGGTGAGTA ACG

FP

CGTAAAACCCTGGAAGGCCGTGTGAGCAAACGTAA AGCG

RP

CGCTTTACGTTTGCTCACACGGCCTTCCAGGGTTTT ACG

FP

GAAGGCAAAGTGAGCAGACGTAAAGCGGTGCGTC

RP

GACGCACCGCTTTACGTCTGCTCACTTTGCCTTC

R82K rTP2

R92K rTP2

R71K, R75K rTP2

K88R rTP2

K91R rTP2

28


FP

Table 2. Spectral information of representative MS plots of PTMs of TP1. Site

Modification

m/z

z

Δppm

Peptide

Ascore

Localization probability

1

K6

Acetyl

562.817

2

+1.01

Lys6-Arg13

1000

1.000

2

K22

Acetyl

350.206

3

+2.48

Asn17-Lys25

123.10

1.000

K35

Acetyl

480.279

2

+0.126

Lys35-Arg41

30.97

1.000

4

K39

Acetyl

360.207

2

+2.93

Ser36-Arg41

30.97

1.000

5

K42

Acetyl

501.753

2

+2.57

Lys42-Arg49

1000

1.000

K25

Methyl

537.825

2

+0.194

Ala19-Arg26

1000

1.000

7

K39

Methyl

494.296

2

+0.838

Lys35-Arg41

1000

1.000

8

R5

Methyl

792.433

2

-5.96

Ser2-Arg13

244.47

1.000

R13

Dimethyl

661.884

2

-8.62

Lys6-Arg14

53.98

1.000

R18

Methyl

510.635

3

-8.00

Gly15-Arg26

217.77

1.000

R34

Methyl

745.934

2

-5.00

Lys32-Arg41

153.63

1.000

R41

Methyl

494.295

2

+0.206

Lys35-Arg41

1000

1.000

S36

Phospho

750.899

2

-2.22

Lys32-Arg41

24.95

1.000

S37

Phospho

527.272

2

+2.28

Lys35-Arg41

51.06

1.000

S48

Phospho

567.223

2

-2.05

Gly44-Arg52

1000

1.000

K32, R34

Acetyl, Methyl

492.955

3

-1.04

Lys32-Arg41

1000, 262.90

1.000, 1.000

S. No Type

3

Kac

6 Kme

10

13 14

Sph

15 16

Associ ated

29


Rme

Table 3. Spectral information of representative MS plots of PTMs of TP2. S. No Type

Site Modification

m/z

z

Δppm

Peptide

Ascore

Localization probability

Acetyl

689.666

3

+0.244

Met5-Gln22

247.98

1.000

2

S37

Acetyl

694.646

3

+2.56

Ser37-Lys57

22.53

1.000

3

K4

Acetyl

1187.056

2

-1.30

Met1-Arg20

157.19

1.000

4

K57

Acetyl

611.787

4

+0.0221 Ser37-Lys60

38.25

1.000

K83

Acetyl

678.399

2

+1.186

Lys83-Arg92

320.42

1.000

6

K88

Acetyl

650.387

2

+3.37

Lys83-Arg92

60.18

1.000

7

K91

Acetyl

770.4608

2

+2.398

Lys83-Lys93

30.97

1.000

8

K83

Dimethyl

671.407

2

-1.97

Lys83-Arg92

129.93

1.000

K88

Methyl

664.399

2

-2.06

Lys83-Arg92

1000

1.000

K91

Methyl

692.417

2

+4.30

Lys83-Arg92

1000

1.000

R92

Methyl

947.573

2

-4.74

Lys83-Arg96

98.40

1.000

R92

Dimethyl

954.581

2

-4.60

Lys83-Arg96

98.40

1.000

T84

Phospho

697.375

2

-1.53

Lys83-Arg92

76.76

1.000

14

S17

Phospho

418.684

4

+1.36

Thr11-His24

39.33

1.000

15

S23

Phospho

740.295

2

+2.03

Ser19-Ala30

41.11

1.000

S51

Phospho

453.685

2

+2.44

Ser48-Thr56

54.16

1.000

17

S68

Phospho

515.230

2

+1.97

Arg66-Ser73

27.96

1.000

18

S70

Phospho

583.760

2

+2.51

Tyr67-Arg75

24.95

0.994

19

S90

Phospho

725.390

2

+1.082

Lys83-Arg92

157.05

1.000

5

9

Kac

Kme

10 11 Rme 12 13

16

Tph

Sph

30


S7


FIGURE 1. Purification of endogenous rat testicular TP1 and TP2.

31

32


FIGURE 2. Post-translational modifications of endogenous transition proteins, TP1 and TP2.


FIGURE 3. Sequence divergence of TP1 and TP2 and conservation of its PTM sites in mammals.

33

34


FIGURE 4. Arginine methylation of transition proteins by PRMT1 and PRMT4.


FIGURE 5. All PRMT4 variants can methylate TP2.

35

36


FIGURE 6. Identification of the site of methylation of TP2 catalyzed by PRMT4.

37


FIGURE 7. Lysine methyltransferase KMT7 methylates TP2.

38


FIGURE 8. KMT7 methylates TP2 in the C-terminus at Lys88 and Lys91.


FIGURE 9. TP2K88me1 and TP2R92me1 are present in elongating to condensing spermatids.

39

40


FIGURE 10. PTMs in the context of functional properties of TP1 and TP2.

Genomics and Proteomics: Mapping of Post-translational Modifications of Transition Proteins, TP1 and TP2 and Identification of Protein Arginine Methyltransferase 4 and Lysine Methyltransferase 7 as Methyltransferase for TP2 Gupta Nikhil, Madapura M. Pradeepa, Bhat U. Anayat and Rao M. R. Satyanarayana J. Biol. Chem. published online March 28, 2015

Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites. Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts

Supplemental material: http://www.jbc.org/content/suppl/2015/03/28/M114.620443.DC1.html This article cites 0 references, 0 of which can be accessed free at http://www.jbc.org/content/early/2015/03/28/jbc.M114.620443.full.html#ref-list-1


Access the most updated version of this article at doi: 10.1074/jbc.M114.620443

1 Mapping of Post-translational Modifications of

1 Mapping of Post-translational Modifications of

Suggest Documents

Posttranslational Modifications of HIV-1 Integrase

Posttranslational Modifications of HIV-1 Integrase

Posttranslational modifications of proopiomelanocortin ... - ScienceOpen

Posttranslational modifications of cardiac ryanodine

Posttranslational Protein Modifications in Type 1 Diabetes

Intracellular Posttranslational Modifications of ... - Journal of Virology

Reactive Nitrogen Posttranslational Modifications of ... - Springer Link

Implication of Posttranslational Histone Modifications in ... - MDPI

Posttranslational modifications of Forkhead box O

Characterization of posttranslational modifications in neuron-specific ...

Posttranslational Modifications of Proteins in Type 1 Diabetes: The ...

Posttranslational Modifications of Proteins in Type 1 ... - BioMedSearch

Implication of Posttranslational Histone Modifications in Nucleotide ...

Intracellular Posttranslational Modifications of S1133 Avian Reovirus ...

Posttranslational Modifications of the Master Transcriptional Regulator ...

Unique Posttranslational Modifications of Chitin-Binding ... - CiteSeerX

Mutant TP53 Posttranslational Modifications

Heme oxygenase-1 posttranslational modifications in the ... - Statistics

Modifications Determined and Posttranslational Caused by a ...

Posttranslational Modifications, Localization, and Protein ... - PLOS

Histone posttranslational modifications predict specific alternative

Nitric oxide-mediated posttranslational modifications control ... - PLOS

Cataract-specific posttranslational modifications and ... - BioMedSearch

Subcellular Distribution, Secretion, and Posttranslational Modifications ...