1 TARGETED DISRUPTION OF THE MEPRIN ...

Page 1 of Articles 44 in PresS. Am J Physiol Renal Physiol (January 2, 2008). doi:10.1152/ajprenal.00214.2007

TARGETED DISRUPTION OF THE MEPRIN METALLOPROTEINASE BETA GENE PROTECTS AGAINST RENAL ISCHEMIA/REPERFUSION INJURY IN MICE John Bylander1, Qing Li2, Ganesan Ramesh2, Binzhi Zhang2, W. Brian Reeves2, and Judith S Bond1*

1

Departments of Biochemistry and Molecular Biology and 2Medicine, Penn State

University College of Medicine, Hershey, PA

RUNNING TITLE: Meprin

deletion and acute renal failure

SUBJECT: Pathophysiology of renal disease *

Correspondence Address: Judith S Bond Department of Biochemistry and Molecular Biology Penn State University College of Medicine 500 University Drive Hershey, PA 17033 TEL. NO. (717) 531-8586 FAX. NO. (717) 531-7072 E-mail: [email protected]

1 Copyright © 2008 by the American Physiological Society.

Page 2 of 44

ABSTRACT Meprins are membrane-bound and secreted metalloproteinases consisting of and/or

subunits that are highly expressed in mouse kidney proximal tubules.

Previous studies have implied that the meprin / isoform is deleterious when renal tissue is subjected to ischemia/reperfusion (I/R). In order to delineate the roles of the meprin isoforms in renal disease, mice deficient in meprin

( KO) and their

wild-type (WT) counterparts were subjected to I/R. WT mice were markedly more susceptible to renal injury after I/R than the KO mice as determined by blood urea nitrogen levels. Urinary levels of inflammatory cytokines IL-6 and KC were significantly higher in WT compared to KO mice by 6 h post I/R. At 96 h post ischemia, kidney mRNA expression levels for TNF , TGF , iNOS, and HSP-27 were significantly higher in the WT compared to KO mice. For WT mice subjected to I/R there was a rapid [3 h] redistribution of meprin

subunits in cells in S3

segments of proximal tubules, followed by shedding of apical cell membrane and detachment of cells. These studies indicate that meprin

is important in the

pathogenesis of renal injury following I/R, and that the redistribution of active meprin / is a major contributor to renal injury and subsequent inflammation. KEY WORDS: metalloproteases, kidney, ischemia reperfusion, knockout mice, inflammation.

2

Page 3 of 44

INTRODUCTION ISCHEMIC ACUTE TUBULAR NECROSIS is a frequent cause of acute renal failure (ARF), a common disorder that affects about 5% of all hospitalized patients and has a mortality rate of over 50% (51). The mortality rate has not decreased significantly over the past 50 years (18). An understanding of the cellular and molecular mechanisms involved in ischemic kidney injury is critical to developing effective treatments to reduce mortality. Work in experimental animal models of renal ischemia reperfusion (I/R) has established that the S3, or pars recta, segment of the proximal tubule is the most susceptible to injury (22, 29). Meprins are multimeric metalloproteinases composed of two subunits,

and ,

that are highly expressed in the kidney, intestine and certain leukocytes in mammals (7). The subunits form homo- or hetero disulfide-bridged dimers, resulting in - , - , or - isoforms. In adult mouse kidneys that express both subunits (e.g., C57BL/6 mice), meprins are estimated to make up more than five percent of total brush border membrane protein (12). Expression is localized to the apical membrane of proximal tubule cells in the S3 [pars recta] segment (12). The subunit retains a hydrophobic transmembrane domain as a Type I protein, whereas this domain is removed by proteolytic processing of the meprin

subunit during

biosynthesis. Thus, the / dimer (referred to as meprin B) and the / isoform (referred to as heteromeric meprin A) are membrane-bound proteases, whereas the / isoform (homomeric meprin A) is secreted into the lumen of the proximal tubule.

3

Page 4 of 44

Meprins are proposed to be the major matrix degrading activity in rodent kidney, capable of degrading several extracellular matrix proteins (4, 5, 50). The meprin

and

subunits have some overlapping and some distinct substrate and

peptide bond specificities. Thus, both subunits can degrade gastrin releasing peptide, laminins, collagen IV, gelatin, nidogen and fibronectin. Meprin

(in

homomeric or heteromeric meprin A) cleaves monocyte chemotactic protein 1 (MCP-1), bradykinin, LH-RH, -MSH; while meprin

(in dimeric meprin B) cleaves

gastrin 17 and osteopontin (5). Previous studies with inbred strains of mice that express different isoforms of meprin metalloproteases have implicated these proteases in the pathology of acute renal failure. For example, inbred strains of mice that have high levels of heteromeric forms of meprin (meprin / ) in the kidney (e.g., C57BL/6, BALB/c mice) display more severe damage in response to ischemia/reperfusion (I/R) compared to inbred strains that express only meprin B (dimers of meprin , e.g., C3H/He) (47). The inbred strains of mice differ in the expression of a variety of genes, so that the specific role of meprins in the response to I/R is not clear from these studies. Studies in rats have also implicated meprins in I/R renal injury (10). For example, it has been demonstrated that administration of actinonin (a selective inhibitor of meprins) decreases the damage to the kidney subjected to I/R. However, because actinonin is not a specific inhibitor of meprins (aminopeptidases, mitochondrial deformylase, and some matrix metalloproteinases are also inhibited by this compound), the conclusion that meprins are the damaging agent in ARF is not definitive (3, 27).

4

Page 5 of 44

In order to explore further the role of meprins in renal disease, the meprin gene was deleted by homologous recombination (33). The meprin KO mice did not express meprin

mRNA or protein in the kidney, while meprin

mRNA and

protein were produced at the same level as in WT mice. Because of the lack of meprin

protein, there was no meprin

or

bound to the kidney proximal tubule

membrane; the meprin A homooligomeric isoform was secreted as an inactive protein into the urine of meprin KO mice at approximately twice the concentration as in the WT. The null mice did not exhibit any obvious abnormal phenotype and were fertile. For the studies herein, the meprin KO mice and their WT counterparts were subjected to renal ischemia-reperfusion (I/R) to determine whether the lack of meprin

and active meprin

at the kidney proximal brush

border membrane affects the pathological sequellae that develop with ischemic injury.

5

Page 6 of 44

MATERIALS AND METHODS Animals and induction of ischemia. Homozygous meprin KO mice derived by homologous recombination in embryonic stem cells were described previously (33). Because meprin KO mice were produced in C57BL/6 (B6) with 129/Sv strain embryonic stem cells, C57BL/6 x 129/Sv F2 littermates were used as wild-type (WT) controls for most experiments. Mice were housed in an animal facility that was maintained at 25ºC with a 12 h-light/12 h-dark cycle. Animals had free access to water and standard rodent chow. Urine samples were obtained prior to surgery and at times of serum collection. The mice were housed and maintained in the Penn State University College of Medicine animal care facility in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals under an IACUC protocol. Renal Ischemia-reperfusion was performed according to an established procedure with minor modifications (36). Male mice aged 9-10 wks and weighing 26-29 g were anesthetized with intraperitoneal administration of Nembutal (50 mg/kg). Immediately after loss of righting reflex, they were placed on a heated surgical pad (surface temperature 37°C), where they were kept during the entire procedure. Two incisions 5 mm lateral to the spine were made and the left and right renal pedicle exposed and clamped for 26 min with Kleinert-Kutz microvessel clamps. The time of ischemia was chosen to obtain a reversible model of ischemic ARF and to avoid animal mortality. The reperfusion was monitored de visu. The incisions were closed in two layers using 4/0 resorbable sutures. Animals were kept on the heated pad until restoration of the righting reflex. Sham surgery was

6

Page 7 of 44

performed on B6/129 F2 mice, which were sacrificed at 24 h and used as controls. Sham surgery was performed in an identical fashion, except that the renal pedicles were not clamped. The mice were volume resuscitated with 0.5 ml of warm normal saline administered subcutaneously during surgery and kept for 4 h post-operatively in an incubator at 30°C to maintain body temperature. Mice were sacrificed at various intervals following reperfusion and kidneys were harvested for assessment of renal injury and mRNA quantitation. One longitudinal half of right kidney tissue was fixed in methyl Carnoy’s (methanol:chloroform:acetic acid, 6:3:1) and the other in 10% buffered formalin. Left kidneys were processed for RNA. Blood and urine. Tail blood samples (60 microliters) were collected under light isoflurane anesthesia in Li-Hep capillary collection tubes (Microvette CB300LH, Sarstedt) at 6, 24, 48 and 72 h of reperfusion. Plasma was collected after centrifugation at 8500 rpm for 6 min and frozen at –20 oC until analysis. Urine samples were collected at times of blood sampling and frozen at –20 oC. Biochemical analysis. Renal function was assessed by measurement of blood urea nitrogen (BUN) by Vitros DT60II chemistry slides (Ortho Clinical Diagnostics, Rochester, NY) and serum creatinine (Cat no D2072B, Diazyme Labs, USA). RNA Preparation. At time of sacrifice, total RNA was extracted from the left kidneys using TRIzol (Invitrogen, Carlsbad, CA). The quantity and integrity of total RNA were determined by A260/A280 and agarose/formaldehyde gel electrophoresis, respectively.

7

Page 8 of 44

Real-time PCR. Synthesis of cDNA was performed with 2 µg of each RNA preparation, Superscript III Reverse transcriptase (Invitrogen) and hexanucleotide random primers (Roche, Indianapolis, IN). A reaction without reverse transcriptase was run in parallel for each RNA sample to control for DNA amplification. PCR Primers were designed with Primer express 1.5 software (Applied Biosystems) and the Spidey data-mining tool (NCBI) was used to minimize DNA amplification. Primers were as follows: meprin- forward CGCCTCAAGTCTTGTGTGGATT; reverse, ATTTCATGTTCAATGGTGGCCTT (product size, 164 bp); meprinforward, AGGATTCAGCCAGGCAAGGA; reverse, CGTGACGATGGTAGACTCTGTCC (product size, 144 bp); heat shock protein-27 (HSP-27) forward, CTTCACCCGGAAATACACGCT; reverse, GGCCTCGAAAGTAACCGGAA (product size 151 bp; inducible nitric oxide synthase (iNOS) forward CCCTGCTTTGTGCGAAGTGT; reverse ATGCGGCCTCCTTTGAGC (product size 158): -actin: forward, TGACGTTGACATCCGTAAAGACC; reverse, CTCAGGAGGAGCAATGATCTTGA (product size, 148 bp). tumor necrosis factor- (TNF- ) forward GCATGATCCGCGACGTGGAA, reverse AGATCCATGCCGTTGGCCAG (product size 352 bp). transforming growth factor- (TGF- ) forward TGACGTCACTGGAGTTGTACGG, reverse GGTTCATGTCATGGATGGTGC (product size 219 bp). Interleukin-6 (IL-6) forward GATGCTACCAAACTGGATATAATC, reverse GGTCCTTAGCCACTCCTTCTGTG (product size 249 bp). CXCL1 (KC) forward CCAAACCGAAGTCATAGCCACA, reverse CGGTGCCATCAGAGCAGTCT(146 bp). Quantitative fluorescent real-time-

8

Page 9 of 44

PCR analysis was performed in an ABI 7700 sequence detector (Applied Biosystems) using the QuantiTect SYBR-Green PCR kit and 300 nM gene-specific primers. The cycle profile was 15 min at 95°C followed by 40 cycles of 15s at 94°C, 30 s at 55° and 30 s at 71°C. Analyses of 40 ng cDNA for meprin- , TGF- , TNF- , IL-6, iNOS and HSP27 and 16 ng for meprin- and -actin were performed in triplicate, and reverse transcriptase negative control reactions in duplicate. For determination of standard curves and PCR efficiencies, standards were prepared using dilutions of C57Bl/6 mouse kidney total RNA. Differences between slopes were less than 0.1, and PCR efficiencies were > 1.97 for all primer pairs. Data were normalized to -actin and analyzed by the comparative threshold cycle method. The results are presented as fold expression relative to sham-operated mice.

Immunohistochemical analysis. Paraffin-fixed renal tissue specimens were cut into 4-5 µm sections and placed onto polylysine coated slides. Sections were deparaffinized and rehydrated. Tissue was permeabilized for 10 min in 0.2 % Triton in PBS, washed and incubated with 3 % hydrogen peroxide in 20 % methanol to quench endogenous peroxides. Sections were then blocked sequentially with PBS/0.2% BSA, Background Buster (Vector Laboratories) and 2 % normal goat serum/ 0.5 % BSA in PBS followed by incubation overnight at 4o C with either antimeprin antibody, anti-DPPIV antibody or corresponding preimmune sera. Preimmune sera controls were performed for all ischemic tissues on consecutive sections. Slides were then washed and incubated with a biotinylated secondary antibody for 1 h followed by ABC reagent. Color was developed with a metal9

Page 10 of 44

enhanced DAB reagent (Pierce), counterstained with hematoxylin, and mounted. For confocal microscopy, the above protocol was amended by omitting the hydrogen peroxide quench and using as secondary antibody, Cy-3 labeled goat anti-rabbit IgG (Molecular Probes). Slides were washed and mounted in Prolong Gold (Molecular Probes) containing the fluorescent nuclear stain Hoechst 33258 (0.1 µg/ml). Images of fluorescent labeled sections of mouse kidney tissue were captured with a Leica TCS SP2 AOBS confocal microscope (512x512 resolution). Formalin fixed tissue was also prepared for determination of naphthol AS-D chloroacetate esterase (kit no. 91A; Sigma). The esterase stain identifies infiltrating neutrophils and monocytes; 10 x40 fields of esterase-stained sections were examined to quantify leukocytes.

Chemicals. All chemicals and reagents were purchased from Sigma Chemicals (St. Louis, MO), unless otherwise stated. Anti-meprin

and anti-meprin

antibodies were produced in the laboratory of Judith S. Bond. Rabbit anti-mouse DPPIV was purchased from R&D Systems (Minneapolis, MN). Urinary cytokines. To quantify urinary cytokines and inflammatory markers, urine samples collected at 6 and 24 h after reperfusion were analyzed in duplicate, using mixtures of specific antibody coated beads (Linco Research, St. Charles, MO). Data were collected using the Luminex-100 system Version 1.7 (Luminex Corp. Austin, TX). Data analysis was performed using the MasterPlex QT 2.5 (MiraiBio, Alameda, CA). Concentrations of cytokines were normalized to creatinine levels in the urine (Diazyme Laboratories, San Diego, CA).

10

Page 11 of 44

Statistical Analysis. Results are expressed as the mean + SEM. Differences between groups were compared using an analysis of variance and the student ttest. Differences were considered significant if the P value was less than 0.05.

11

Page 12 of 44

RESULTS Kidney function after ischemia/reperfusion. In order to gain insights into the role of kidney meprins in the development of kidney injury, meprin KO and their WT counterpart mice were subjected to I/R. BUN values were analyzed at various time points to assess kidney function (Fig. 1A). At all time points (6 to 72 h) after ischemic renal injury, the meprin KO mice had significantly lower BUN values than the WT mice indicating better preservation of renal function. Immediately after the 26 min ischemic insult, all groups had BUN levels of approximately 16 mg/dl. By six h after reperfusion, meprin

KO mouse BUN values rose to 38 + 5 mg/dl plasma,

compared to values of 64 + 3 mg/dl for WT mice, p < 0.0001. The increase in plasma BUN values above baseline in the WT animals was 4 -fold greater than in the KO animals at 24 h of reperfusion and throughout the course of the experiment. Plasma creatinine values mirrored those of BUN (Fig. 1B). Creatinine and BUN values for sham controls of both genotypes were similar. Figure 1A shows the combined data from two separate experiments (n = 14). Two WT mice died between 24 and 48 h, whereas no meprin KO mice died during either experiment. These results clearly demonstrate that the meprin KO mice are more tolerant to I/R kidney injury than WT mice. Expression of immune system markers after I/R. To determine whether meprin

deletion was associated with an altered inflammatory response in I/R

injury, mRNA expression of chemokines, cytokines and stress response genes was measured in mice subjected to I/R. The expression of TNF , TNF , iNOS, and HSP-27 in WT kidneys were all significantly elevated compared to values in kidney 12

Page 13 of 44

of sham-operated WT mice (Fig. 2). By contrast, the levels of these inflammatory markers were not elevated, or only modestly elevated, in meprin KO mouse kidneys subjected to I/R. TNF- and iNOS mRNA levels of meprin KO mice subjected to I/R were similar to sham-operated controls and significantly lower than WT levels at 96 h of reperfusion. Expression of HSP-27 and TGF mRNA levels in meprin KO mice were somewhat elevated after I/R, but were significantly lower (by approximately half) than WT levels. There was no difference in renal mRNA expression levels of any of these genes between WT and KO knockout mice at baseline and at 96 h after sham surgery. These results indicate that the inflammatory response of I/R is more severe in WT than in meprin KO mice. The levels of proinflammatory mediators in the urine also revealed a difference between WT and meprin KO mice subjected to I/R. For example, IL-6 and KC (CXCL1) were elevated markedly in the urine of WT mice at 6 and 24 h post-ischemia, and to a much lower extent in the meprin KO mice (Fig. 3). Consistent with the upregulation of these markers, leukocyte infiltration was increased after I/R in the kidney of WT relative to meprin KO and sham operated mice (Fig. 4). Taken together, the inflammatory response after IR injury was significantly muted in kidneys of mice without meprins on the brush border membrane. Renal histology in WT and KO mice after I/R. There were marked differences in the renal histology of WT and KO mouse kidneys at 96 h after I/R (Fig. 5). In order to visualize the differences in the proximal tubules of the two genotypes, kidney sections were stained for dipeptidyl peptidase IV (DPPIV), an

13

Page 14 of 44

abundant brush border membrane protease (17). In WT mice, DPPIV staining revealed much more brush border disruption and collapse, patchy staining and a predominance of dilated tubules containing detached DPPIV staining material. Staining in KO mice, by contrast, remained predominantly on intact brush border membranes and fewer than 10 % of tubules contained detached membrane. Renal meprin localization after ischemia/reperfusion in WT mice. To determine whether the localization and redistribution of meprin / after I/R is consistent with an early role in initiating tubular injury, WT mice were subjected to renal I/R and kidney tissue sections were prepared for immunohistochemical analyses after 3, 6 or 24 h of I/R (Fig. 6-10). In sham-operated animals, meprin was localized exclusively to the apical brush borders of proximal straight [S3] segments of proximal tubules at the corticomedullary junction and in bundles of S3 segments extending into the outer cortex (Fig. 6A -C). Meprin

subunits localized

exclusively to apical brush borders. No signal was detected when the preimmune rabbit serum was used on an adjacent section (Fig. 6D). In WT mouse kidney, meprin

co-localized with meprin

at the brush border membrane (data not

shown). The localization of meprin

in WT mouse kidney changed markedly after 3 h

of reperfusion (Fig. 6). Meprin localized to dilated tubules and membranous material associated with tubular segments in the inner medulla (Fig. 7A). Nearly all S3 tubule segments contain detached cells (arrows, Fig. 7B). In the cortical region, tubules were dilated and meprin localization was patchy and more diffuse (Fig. 7C). Higher magnification of the corticomedullary junction region, revealed not only

14

Page 15 of 44

meprin on cells in the lumen (solid arrows), but redistribution to lateral surfaces and between intact cells still attached to the basement membrane (Fig. 8). To examine further the intracellular localization and redistribution of meprin in ischemic mouse kidney, meprins were labeled with fluorescent secondary antibodies in optical sections using confocal microscopy (Fig. 9). In sham–operated animals (Fig. 9A), optical sections 0.4 microns thick showed meprin

exclusively

localized to brush border membranes extending into the tubular lumen. By three h of reperfusion in ischemic kidney (Fig. 9B), meprin

is localized not only at the

luminal surface but in the cytoplasm surrounding but not inside of nuclei of intact cells. No staining of ischemic tissue was observed when preimmune serum was usedon consecutive sections (data not shown). By 6 h of reperfusion, there was increased accumulation of meprincontaining cells and cellular debris in tubular lumens in the corticomedullary junction region (Fig 10A and B). Meprin was found in the inner medulla localized to material in tubule lumens within the loop of Henle and collecting ducts (Fig. 10C). Higher magnification of the corticomedullary region reveals meprin reaching to tubular basement membranes and into the interstitium (Fig. 10B). Of note, some tubules were dilated and filled with amorphous material which did not stain for meprin (open arrows). By 24 h of I/R, tubules were disrupted, dilated and filled with meprin-positive debris in juxtamedullary regions (Fig. 11A). Meprin was found on all sides of cells and in acellular tubules. There was an overall loss of meprin cortical regions (Fig 11C).

15

staining in the outer

Page 16 of 44

DISCUSSION

The work herein demonstrates that the deletion of the meprin subsequent lack of expression of meprin

and/or

gene, and

protein at the kidney brush

border membrane, results in less damage to kidney tissue upon exposure to I/R. In the meprin KO mouse there is less disruption and shedding of membranes in proximal tubules cells, a less severe inflammatory response, and better preservation of kidney function after I/R compared to the WT mouse. The histological data show that there is a marked redistribution of meprin proteins in the WT kidney in response to I/R, and we propose that the relocalization of meprin proteases causes severe damage to kidney proteins (in the cytosol, at cell junctions and/or at the basal lateral membrane) that is responsible for a cascade of reactions that lead to cellular damage and an inflammatory response. This work is the first to demonstrate the role of meprins in mice with similar genetic backgrounds. The inbred strains of mice that have been investigated in the past express high levels of both meprin

and

in the kidney (such as C57BL/6,

DBA mice, designated ‘high meprin mice’) or meprin

only (such as C3H/HeJ, CBA

mice, ‘low meprin mice’) (6). These inbred strains differ in their histocompatibility genes in the MHC on chromosome 17, and meprin

is linked to this locus (26, 37).

Most of the ‘low meprin strains’ are of the k-haplotype. The MHC genes are involved in inflammatory processes and self-nonself recognition. The meprin KO mice on the C57BL/6x129 background all have the same MHC genes; so that the differences observed in different meprin genotypes in the response to ischemia cannot be attributed to the MHC genes. 16

Page 17 of 44

In the normal mouse kidney, membrane-bound meprin

and secreted

homooligomeric meprin A (the - oligomer) are present in latent forms, that is they contain prosequences that prevent proteolytic activity (9, 49). By contrast, membrane-bound meprin

in the heterooligomeric form is activated; the

prosequence is removed by a yet unidentified protease. Our studies indicate that the latent secreted homooligomeric meprin A (present in the WT and KO mice) is not a toxic agent in I/R. However, the activity of meprin isoforms in the urine of WT and KO mice after I/R has not been measured, and therefore there might be differences between the genotypes in meprin activity after ischemia. It is more likely, however, that the active membrane-bound heterooligomeric meprin A is the damaging factor in vivo after I/R. This is consistent with previous findings that show that the lack of membrane-bound meprin A in inbred mice and infusion of actinonin (a particularly good inhibitor of meprin ) into rats (that express both meprin

and

) protects against I/R-induced kidney damage and secretion of nidogen fragments in the urine (10). Furthermore, in a sepsis-induced model of acute renal failure, actinonin prevented ARF in aged mice, and pre-treatment of mice with actinonin protected against cisplatin nephrotoxicity (21, 24). Actinonin is not a specific inhibitor of meprins, and thus the action of this inhibitor from previous studies rendered suggestive rather than definitive conclusions. The present studies in genetically altered mice show more definitively that meprins are active factors in I/R-induced kidney damage. The pathogenesis of ischemic ARF is multi-factorial, and our studies demonstrate that meprins are among the factors that participate in the cascade of 17

Page 18 of 44

reactions leading to damage. Other factors that have been implicated in the injury to the kidney include cellular apoptosis and necrosis (46), inflammation (28), reactive oxygen species (45), leucocyte adhesion molecules, dendritic cellendothelial cell interactions (44), T-cell recruitment and activation (35), C5b-9 (52) and poly(ADP-ribose) polymerase (13). The present studies indicate that after IR, meprins relocalize to the lateral and basolateral membranes of proximal cells in S3 segments in mice. Meprins could contribute to cellular injury by damaging cell-cell interactions by hydrolyzing cell junction proteins (e.g., E-cadherin (Lottaz D; personal communication), or extracellular matrix proteins (e.g., laminin, nidogen, fibrinogen, collagen IV) as these proteins have been demonstrated to be substrates for meprins in vitro (5, 11, 49). Studies in rats had suggested the possibility that meprins might enter the cytoplasmic compartment of tubular cells after IR injury (10). In the present study, a series of confocal optical sections less than 0.4 micros thick, revealed intracellular localization of meprins throughout the cytoplasmic compartment of intact cells 3 h after injury. In addition, subcellular fractionation data (not shown) support the contention that meprins redistribute to the cytoplasm after I/R. Thus meprins could contribute to cell injury and inflammation by hydrolyzing cytosolic proteins such as PKA and latent IL-1 (11, 20). Ultimately, redistribution of meprins will have to be examined by electron microscopy to confirm the cytoplasmic localization. .Meprins could initiate or accelerate cell detachment thru hydrolysis of focal attachment proteins which are important in stabilizing focal adhesions. These substrates would not be encountered by meprins in the normal proximal tubule cell.

18

Page 19 of 44

Only upon relocalization of the meprin after I/R would substrates in compartments other than the brush border membrane and apical lumen be encountered. Meprins may also contribute to release and activation of cytokines that participate in the inflammatory response (e.g., TNF ). For example, proteolytic activation and release of membrane-bound TNF- and IL-1 have been shown to occur in experimental models of ischemia reperfusion injury (15, 20, 39). A database of predicted hydrolysis sites in potential meprin substrates, indicated meprins could efficiently release and activate membrane-bound TNF- and IL-1 (8). It is also possible that membrane-bound meprins have a specific role in the ischemic response. It has been known that OS-9 interacts with the C-terminal tail of meprin , and it was proposed that this interaction is important for ER-to-Golgi transport of the protease (30). Recently, there are data indicating that the cytoplasmic tail of meprin

is involved in a complex with hypoxia-inducible factor

1 (HIF1 ) and OS-9 (2, 16). HIF1 may play an important cytoprotective role in IR injury (42, 48). OS-9 also interacts with HIF1 to promote oxygen-dependent degradation of HIF1 (by the proteosome). Treatment of rats with SnCl2, a hemeoxygenase inducer, prior to ischemia/reperfusion was correlated with protection against IR injury (1). This raises the possibility that meprin

is involved in oxygen

sensing and in the response of the kidney proximal tubule cells to hypoxia. The urinary KC and IL-6 levels in mice subjected to I/R were significantly lower in meprin KO relative to WT mice. The extent of early elevation in urinary IL-6 correlated with the eventual severity of subsequent injury (Fig. 3). Deletion or blockade of IL-6 has been shown to protect against renal I/R injury (34). Neutrophil

19

Page 20 of 44

infiltration in renal I/R was also significantly decreased in IL-6(-/-) mice and wildtype mice administered an IL-6 antibody (48). In the present study, leukocyte infiltration and the expression of inflammatory markers were decreased in the kidney of meprin KO relative to WT mice after injury. These results add new impetus to the possibility of using meprin metalloproteinase inhibition as prophylaxis against ischemic injury. Meprins are also endogenous ligands for mannose binding lectin (MBL) (23),a C-type serum lectin that plays a central role in the innate immune response and upon binding exogenous ligand, triggers complement acitviation via the lectin pathway (14). Both complement and MBL have been implicated in renal ischemia/reperfusion injury and diabetic kidney disease (19) and MBL knockout mice were protected against I/R (32). It is possible that translocation of meprin from the apical surface to the basolateral surface could lead to MBL dependent complement activation and subsequent renal injury (14, 23). The role of meprin in the pathogenesis of renal damage may vary in acute versus chronic disease processes. While the studies herein demonstrate that the high levels of membrane-bound meprin A are deleterious in an experimental model of ARF, there are several other studies indicating that low levels of kidney meprins are associated with chronic forms of nephropathy and fibrosis. For example, renal pathology associated with hydronephrosis (unilateral urethral obstruction) occurs with an early and progressive decline in rat meprin

and

mRNA and protein (40).

Microarray analysis demonstrated marked declines in mouse meprin in adriamycin-induced nephropathy (41). Meprin

20

expression

is down-regulated during

Page 21 of 44

transdifferentiation of renal tubule epithelial cells to a fibroblast-like phenotype in vitro on exposure to TGF- and EGF, suggesting a role in fibrogenesis. Meprin

is

also down-regulated in collagen IVA3 knockout mice that develop Alport's syndrome and renal pathology (43). In addition, the MEP

gene has been linked to

a heightened risk of diabetic nephropathy (DN) in patients with type 2 diabetes (38). Meprin

is chronically down-regulated in models of both type I and type II diabetes

(31). Thus, while in acute renal injury, high levels of meprin A may be deleterious, in chronic forms of nephropathy, low meprin A activity may result in increased fibrosis and progression of glomerulopathies such as in diabetic nephropathy. In summary, our results provide fresh support for the view that active brush border membrane meprin contributes to renal ischemic injury. The absence of meprin , and thus meprin

in the brush border, is associated with a decreased

inflammatory response to ischemia There is evidence that the meprin expression varies in human kidney on both the mRNA and protein level [(25); Erwin Sterchi, University of Berne, personal communication]. Thus, the level of meprin expression in humans could be a factor in individual susceptibility to renal ischemic injury. Meprin inhibitors in early stages of ARF could be useful therapeutically in people who express high levels of kidney meprins.

21

Page 22 of 44

ACKNOWLEDGEMENTS The authors wish to acknowledge the assistance of Rhona Ellis and the Penn State Hershey Confocal Imaging Facility and Rob Brucklacher and the Functional Genomics Core Facility of the Section of Research Resources, Penn State College of Medicine.

GRANTS

This work was supported by National Institutes of Health Grants DK-54625 and DK19691 (to J. S. Bond). and DK-063120 (to W. Brian Reeves).

22

Page 23 of 44

REFERENCES

1.

Akagi R, Takahashi T, and Sassa S. Cytoprotective effects of heme oxygenase

in acute renal failure. Contrib Nephrol 148: 70-85, 2005. 2.

Baek JH, Mahon PC, Oh J, Kelly B, Krishnamachary B, Pearson M, Chan

DA, Giaccia AJ, and Semenza GL. OS-9 interacts with hypoxia-inducible factor 1alpha and prolyl hydroxylases to promote oxygen-dependent degradation of HIF-1alpha. Mol Cell 17: 503-512, 2005. 3.

Bauvois B and Dauzonne D. Aminopeptidase-N/CD13 (EC 3.4.11.2) inhibitors:

chemistry, biological evaluations, and therapeutic prospects. Med Res Rev 26: 88-130, 2006. 4.

Bertenshaw GP and Bond JS. Handbook of proteolytic enzymes. Amsterdam ;

Boston: Elsvier Academic Press, 2004. 5.

Bertenshaw GP, Turk BE, Hubbard SJ, Matters GL, Bylander JE, Crisman

JM, Cantley LC, and Bond JS. Marked differences between metalloproteases meprin A and B in substrate and peptide bond specificity. J Biol Chem 276: 13248-13255, 2001. 6.

Beynon RJ and Bond JS. Deficiency of a kidney metalloproteinase activity in

inbred mouse strains. Science 219: 1351-1353, 1983. 7.

Bond JS, Matters GL, Banerjee S, and Dusheck RE. Meprin metalloprotease

expression and regulation in kidney, intestine, urinary tract infections and cancer. FEBS Letters 579: 3317-3322, 2005.

23

Page 24 of 44

8.

Boyd SE, Pike RN, Rudy GB, Whisstock JC, and Garcia de la Banda M.

PoPS: a computational tool for modeling and predicting protease specificity. J Bioinform Comput Biol 3: 551-585, 2005. 9.

Butler PE and Bond JS. A latent proteinase in mouse kidney membranes.

Characterization and relationship to meprin. J Biol Chem 263: 13419-13426, 1988. 10.

Carmago S, Shah SV, and Walker PD. Meprin, a brush-border enzyme, plays

an important role in hypoxic/ischemic acute renal tubular injury in rats. Kidney Int 61: 959-966, 2002. 11.

Chestukhin A, Litovchick L, Muradov K, Batkin M, and Shaltiel S. Unveiling

the substrate specificity of meprin beta on the basis of the site in protein kinase A cleaved by the kinase splitting membranal proteinase. J Biol Chem 272: 3153-3160, 1997. 12.

Craig SS, Reckelhoff JF, and Bond JS. Distribution of meprin in kidneys from

mice with high- and low-meprin activity. Am J Physiol 253: C535-540, 1987. 13.

Devalaraja-Narashimha K, Singaravelu K, and Padanilam BJ. Poly(ADP-

ribose) polymerase-mediated cell injury in acute renal failure. Pharmacol Res 52: 44-59, 2005. 14.

Eisen DP and Minchinton RM. Impact of mannose-binding lectin on

susceptibility to infectious diseases. Clin Infect Dis 37: 1496-1505, 2003. 15.

Eissner G, Kirchner S, Lindner H, Kolch W, Janosch P, Grell M, Scheurich

P, Andreesen R, and Holler E. Reverse signaling through transmembrane TNF confers resistance to lipopolysaccharide in human monocytes and macrophages. J Immunol 164: 6193-6198, 2000.

24

Page 25 of 44

16.

Flashman E, McDonough MA, and Schofield CJ. OS-9: another piece in the

HIF complex story. Mol Cell 17: 472-473, 2005. 17.

Girardi AC, Degray BC, Nagy T, Biemesderfer D, and Aronson PS.

Association of Na(+)-H(+) exchanger isoform NHE3 and dipeptidyl peptidase IV in the renal proximal tubule. J Biol Chem 276: 46671-46677, 2001. 18.

Han WK and Bonventre JV. Biologic markers for the early detection of acute

kidney injury. Curr Opin Crit Care 10: 476-482, 2004. 19.

Hansen TK. Mannose-binding lectin (MBL) and vascular complications in

diabetes. Horm Metab Res 37 Suppl 1: 95-98, 2005. 20.

Herzog C, Kaushal GP, and Haun RS. Generation of biologically active

interleukin-1beta by meprin B. Cytokine 31: 394-403, 2005. 21.

Herzog C, Seth R, Shah SV, and Kaushal GP. Role of meprin A in renal

tubular epithelial cell injury. Kidney Int 71: 1009-1018, 2007. 22.

Heyman SN, Shina A, Brezis M, and Rosen S. Proximal tubular injury

attenuates outer medullary hypoxic damage: studies in perfused rat kidneys. Exp Nephrol 10: 259-266, 2002. 23.

Hirano M, Ma BY, Kawasaki N, Okimura K, Baba M, Nakagawa T, Miwa

K, Kawasaki N, Oka S, and Kawasaki T. Mannan-binding protein blocks the activation of metalloproteases meprin alpha and beta. J Immunol 175: 3177-3185, 2005. 24.

Holly MK, Dear JW, Hu X, Schechter AN, Gladwin MT, Hewitt SM, Yuen

PS, and Star RA. Biomarker and drug-target discovery using proteomics in a new rat model of sepsis-induced acute renal failure. Kidney Int 70: 496-506, 2006.

25

Page 26 of 44

25.

Jiang W and Le B. Structure and expression of the human MEP1A gene

encoding the alpha subunit of metalloendopeptidase meprin A. Arch Biochem Biophys 379: 183-187, 2000. 26.

Jiang W, Sadler PM, Jenkins NA, Gilbert DJ, Copeland NG, and Bond JS.

Tissue-specific expression and chromosomal localization of the alpha subunit of mouse meprin A. J Biol Chem 268: 10380-10385, 1993. 27.

Lee MD, She Y, Soskis MJ, Borella CP, Gardner JR, Hayes PA, Dy BM,

Heaney ML, Philips MR, Bornmann WG, Sirotnak FM, and Scheinberg DA. Human mitochondrial peptide deformylase, a new anticancer target of actinonin-based antibiotics. J Clin Invest 114: 1107-1116, 2004. 28.

Li L and Okusa MD. Blocking the immune response in ischemic acute kidney

injury: the role of adenosine 2A agonists. Nat Clin Pract Nephrol 2: 432-444, 2006. 29.

Lieberthal W and Nigam SK. Acute renal failure. I. Relative importance of

proximal vs. distal tubular injury. Am J Physiol 275: F623-631, 1998. 30.

Litovchick L, Friedmann E, and Shaltiel S. A selective interaction between OS-

9 and the carboxyl-terminal tail of meprin beta. J Biol Chem 277: 34413-34423, 2002. 31.

Mathew R, Futterweit S, Valderrama E, Tarectecan AA, Bylander JE, Bond

JS, and Trachtman H. Meprin-alpha in chronic diabetic nephropathy: interaction with the renin-angiotensin axis. Am J Physiol Renal Physiol 289: F911-921, 2005. 32.

Moller-Kristensen M, Wang W, Ruseva M, Thiel S, Nielsen S, Takahashi K,

Shi L, Ezekowitz A, Jensenius JC, and Gadjeva M. Mannan-binding lectin recognizes structures on ischaemic reperfused mouse kidneys and is implicated in tissue injury. Scand J Immunol 61: 426-434, 2005.

26

Page 27 of 44

33.

Norman LP, Jiang W, Han X, Saunders TL, and Bond JS. Targeted disruption

of the meprin beta gene in mice leads to underrepresentation of knockout mice and changes in renal gene expression profiles. Mol Cell Biol 23: 1221-1230, 2003. 34.

Patel NS, Chatterjee PK, Di Paola R, Mazzon E, Britti D, De Sarro A,

Cuzzocrea S, and Thiemermann C. Endogenous interleukin-6 enhances the renal injury, dysfunction, and inflammation caused by ischemia/reperfusion. J Pharmacol Exp Ther 312: 1170-1178, 2005. 35.

Rabb H. The T cell as a bridge between innate and adaptive immune systems:

implications for the kidney. Kidney Int 61: 1935-1946, 2002. 36.

Rabb H, Daniels F, O'Donnell M, Haq M, Saba SR, Keane W, and Tang

WW. Pathophysiological role of T lymphocytes in renal ischemia-reperfusion injury in mice. Am J Physiol Renal Physiol 279: F525-531, 2000. 37.

Reckelhoff JF, Bond JS, Beynon RJ, Savarirayan S, and David CS. Proximity

of the Mep-1 gene to H-2D on chromosome 17 in mice. Immunogenetics 22: 617-623, 1985. 38.

Red Eagle AR, Hanson RL, Jiang W, Han X, Matters GL, Imperatore G,

Knowler WC, and Bond JS. Meprin beta metalloprotease gene polymorphisms associated with diabetic nephropathy in the Pima Indians. Hum Genet 118: 12-22, 2005. 39.

Reil JC, Gilles S, Zahler S, Brandl A, Drexler H, Hultner L, Matrisian LM,

Welsch U, and Becker BF. Insights from knock-out models concerning postischemic release of TNFalpha from isolated mouse hearts. J Mol Cell Cardiol 42: 133-141, 2007.

27

Page 28 of 44

40.

Ricardo SD, Bond JS, Johnson GD, Kaspar J, and Diamond JR. Expression

of subunits of the metalloendopeptidase meprin in renal cortex in experimental hydronephrosis. Am J Physiol 270: F669-676, 1996. 41.

Sadlier DM, Connolly SB, Kieran NE, Roxburgh S, Brazil DP, Kairaitis L,

Wang Y, Harris DC, Doran P, and Brady HR. Sequential extracellular matrix-focused and baited-global cluster analysis of serial transcriptomic profiles identifies candidate modulators of renal tubulointerstitial fibrosis in murine adriamycin-induced nephropathy. J Biol Chem 279: 29670-29680, 2004. 42.

Salom MG, Nieto Ceron S, Rodriguez F, Lopez B, Hernandez I, Gil Martinez

J, Martinez Losa A, and Fenoy FJ. Heme oxygenase-1 induction improves ischemic renal failure: role of nitric oxide and peroxynitrite. Am J Physiol Heart Circ Physiol 293: H3542-3549, 2007. 43.

Sampson NS, Ryan ST, Enke DA, Cosgrove D, Koteliansky V, and Gotwals

P. Global gene expression analysis reveals a role for the alpha 1 integrin in renal pathogenesis. J Biol Chem 276: 34182-34188, 2001. 44.

Schlichting CL, Schareck WD, and Weis M. Renal ischemia-reperfusion injury:

new implications of dendritic cell-endothelial cell interactions. Transplant Proc 38: 670673, 2006. 45.

Shah SV and Walker PD. Reactive oxygen metabolites in toxic acute renal

failure. Ren Fail 14: 363-370, 1992. 46.

Sheridan AM and Bonventre JV. Cell biology and molecular mechanisms of

injury in ischemic acute renal failure. Curr Opin Nephrol Hypertens 9: 427-434, 2000.

28

Page 29 of 44

47.

Trachtman H, Valderrama E, Dietrich JM, and Bond JS. The role of meprin

A in the pathogenesis of acute renal failure. Biochem Biophys Res Commun 208: 498505, 1995. 48.

Tracz MJ, Juncos JP, Croatt AJ, Ackerman AW, Grande JP, Knutson KL,

Kane GC, Terzic A, Griffin MD, and Nath KA. Deficiency of heme oxygenase-1 impairs renal hemodynamics and exaggerates systemic inflammatory responses to renal ischemia. Kidney Int 72: 1073-1080, 2007. 49.

Villa JP, Bertenshaw GP, Bylander JE, and Bond JS. Meprin proteolytic

complexes at the cell surface and in extracellular spaces. Biochem Soc Symp: 53-63, 2003. 50.

Walker PD, Kaushal GP, and Shah SV. Meprin A, the major matrix degrading

enzyme in renal tubules, produces a novel nidogen fragment in vitro and in vivo. Kidney Int 53: 1673-1680, 1998. 51.

Ympa YP, Sakr Y, Reinhart K, and Vincent JL. Has mortality from acute renal

failure decreased? A systematic review of the literature. Am J Med 118: 827-832, 2005. 52.

Zhou W, Farrar CA, Abe K, Pratt JR, Marsh JE, Wang Y, Stahl GL, and

Sacks SH. Predominant role for C5b-9 in renal ischemia/reperfusion injury. J Clin Invest 105: 1363-1371, 2000.

29

Page 30 of 44

FIGURE LEGENDS

Fig. 1. (A) Blood urea nitrogen (BUN) and (B) plasma creatinine levels following renal ischemia/reperfusion in wild-type (WT) and meprin -knockout ( KO) mice. Male WT and KO C57BL/6x129 F2 mice, 8 to 10 wk old, were subjected to 26 min of warm renal ischemia followed by up to 72 h of reperfusion. WT mice (square symbols); meprin KO mice (triangles): *, p < 0.02, *** p < 0.0001, by students’ t test. Values are averages + SEM; n = 13-14 and 6-7 for each group in A and B respectively.

Fig. 2. Expression of TNF- , TGF- , iNOS, and HSP27 mRNA in the kidney 96 h after I/R in WT and meprin KO mice. The mRNA was analyzed by Real-time PCR. WT (black bars); meprin KO (grey bars); sham-operated WT (open bars) mice. The mRNA levels were normalized to

-actin mRNA, and expressed as relative to

levels in sham-operated mouse kidneys. Values are means + SEM for 5 WT, 6 meprin KO, and 3 sham-operated mice of each genotype. * P