The Journal of Immunology
12/15-Lipoxygenase Counteracts Inflammation and Tissue Damage in Arthritis Gerhard Kro¨nke,1* Julia Katzenbeisser,1* Stefan Uderhardt,* Mario M. Zaiss,* Carina Scholtysek,* Gernot Schabbauer,† Alexander Zarbock,‡ Marije I. Koenders,§ Roland Axmann,* Jochen Zwerina,* Hans W. Baenckler,* Wim van den Berg,§ Reinhard E. Voll,* Hartmut Ku¨hn,储 Leo A. B. Joosten,§¶ and Georg Schett2* Eicosanoids are essential mediators of the inflammatory response and contribute both to the initiation and the resolution of inflammation. Leukocyte-type 12/15-lipoxygenase (12/15-LO) represents a major enzyme involved in the generation of a subclass of eicosanoids, including the anti-inflammatory lipoxin A4 (LXA4). Nevertheless, the impact of 12/15-LO on chronic inflammatory diseases such as arthritis has remained elusive. By using two experimental models of arthritis, the K/BxN serum-transfer and a TNF transgenic mouse model, we show that deletion of 12/15-LO leads to uncontrolled inflammation and tissue damage. Consistent with these findings, 12/15-LO-deficient mice showed enhanced inflammatory gene expression and decreased levels of LXA4 within their inflamed synovia. In isolated macrophages, the addition of 12/15-LO-derived eicosanoids blocked both phosphorylation of p38MAPK and expression of a subset of proinflammatory genes. Conversely, 12/15-LO-deficient macrophages displayed significantly reduced levels of LXA4, which correlated with increased activation of p38MAPK and an enhanced inflammatory gene expression after stimulation with TNF-␣. Taken together, these results support an antiinflammatory and tissue-protective role of 12/15-LO and its products during chronic inflammatory disorders such as arthritis. The Journal of Immunology, 2009, 183: 3383–3389.
B
oth the initiation and resolution of inflammation are strictly controlled by regulatory feedback mechanisms to promote rapid clearance of the causative agent and limit tissue damage by reactive oxygen species and matrix-degrading enzymes. Improper regulation of this process has been implicated in the development of chronic inflammatory diseases such as arthritis and atherosclerosis (1). Bioactive lipid-mediators were shown to act as key modulators of inflammation (2, 3). During the initial phase of the inflammatory response, cyclooxygenase (COX)3-2 and 5-lipoxygenase (LO) catalyze the generation of prostaglandins and leukotrienes, respectively. These two groups of eicosanoids facilitate the inflammatory reaction by promoting edema formation and leukocyte influx (2). Inhibition of COX-2 and 5-LO, as well as genetic deletion of their encoding genes, was shown to ameliorate the disease progression in different mouse models of *Department of Internal Medicine 3 and Institute for Clinical Immunology, University of Erlangen-Nuremberg, Erlangen, Germany; †Department for Vascular Biology, Center for Biomolecular Medicine and Pharmacology, Medical University Vienna, Vienna, Austria; ‡Department of Anesthesiology and Intensive Care Medicine, University of Mu¨nster, Mu¨nster, Germany; §Department of Rheumatology and ¶Department of Medicine, Radboud University Nijmegen Medical Centre, Nijmegen, The Netherlands; and 储Institute of Biochemistry, Humboldt University, Berlin, Germany Received for publication February 2, 2009. Accepted for publication June 16, 2009. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1
G.K. and J.K. contributed equally to the manuscript.
2
Address correspondence and reprint requests to Dr. Georg Schett, Department of Internal Medicine 3 and Institute for Clinical Immunology, University of Erlangen, Krankenhausstrasse 12, Erlangen, Germany. E-mail address:
[email protected]
3
Abbreviations used in this paper: COX, cyclooxygenase; HETE, hydroxyeicosatetraenoic acid; LO, lipoxygenase; LXA4, lipoxin A4; RA, rheumatoid arthritis; tg, transgenic; WT, wild type; KC, keratinocyte chemoattractant. Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.0900327
rheumatoid arthritis (RA) and atherosclerosis (4 – 8). Other arachidonic acid-metabolising enzymes, including human 15LO-1 and its murine ortholog the 12/15-LO, have been implicated in the generation of anti-inflammatory lipid mediators such as lipoxin A4 (LXA4; Ref. 9). Though lipoxins were shown to exert multiple biologic effects in vitro and in vivo, the potential role of 12/15-LO during the resolution of inflammation is incompletely understood. Importantly, this enzyme displays additional properties, including the oxidation of low-density lipoproteins (10), allowing it to contribute to vascular inflammation and development of atherosclerosis (11–14). Hence, and despite the potential anti-inflammatory action of 12/15-LO, animal models studying the role of 12/15-LO in the pathogenesis of atherosclerosis delivered conflicting results (15–19). The involvement of 12/15-LO in the pathogenesis of arthritis as a prototype of an inflammatory disease has not yet been investigated. In the present study, we determined the impact of 12/15LO-deficiency in two mouse models of inflammatory arthritis. Interestingly and consistent with an anti-inflammatory role of this enzyme, we observed a dramatic exacerbation of arthritis and inflammatory joint destruction in 12/15-LO⫺/⫺ mice. This correlated with reduced levels of anti-inflammatory 12/15-LO-derived LXA4 in synovial extracts from 12/15-LO-deficient mice. In vitro studies showed that LXA4 was able to inhibit TNF-␣-induced phosphorylation of p38MAPK and expression of a subset of inflammatory genes in macrophages. Conversely, the reduction of endogenous LXA4-levels in 12/15-LO⫺/⫺ macrophages correlated with an enhanced activation of p38MAPK and an increased inflammatory gene expression. These data demonstrate a prominent antiinflammatory role of 12/15-LO and 12/15-LO-derived lipid mediators during chronic inflammation and highlights the 12/15-LOLXA4 axis as an important endogenous feedback loop during inflammatory diseases such as arthritis.
3384
12/15-LO DEFICIENCY EXACERBATES EXPERIMENTAL ARTHRITIS
Materials and Methods Materials Murine 12/15-LO Ab, 12-hydroxyeicosatetraenoic acid (HETE), and 15HETE were obtained from Cayman Chemicals. LXA4 was bought at Sigma-Aldrich, while the Abs against p-p38MAPK, p-AKT and p-IB were purchased from Cell Signaling Technology. 12/15-LO-deficient mice were purchased from The Jackson Laboratory. Mice suffered from no apparent health defects or morphologic alterations such as hepatosplenomegaly (maximum age of used mice was 10 wk).
Lipid quantification Competitive ELISA techniques were used to determine levels of LXA4 (Oxford Biomedical Research), 13-S-hydroxyoctadecadienoic acid (HODE), and PGE2 (both kits from Assay Designs). For each sample, synovial tissue from knee joints (three mice per group) was homogenized and the respective eicosanoids were isolated following the protocol provided by the manufacturer using solid phase columns. TNF transgenic (tg) mice and K/BxN serum transfer. Scoring of clinical signs of arthritis in TNF tg mice and measurement of body weight was done in all mice once weekly starting from 6- to 10-wk of age. Arthritis was evaluated in a blinded manner as described previously (20). K/BxN serum transfer and quantification of arthritis was performed as previously described (21) using 10-wk-old male C57/B6 mice. After i.p. application of 200 l of K/BxN serum, mice were killed at day 11 and tissue was prepared for gene expression and histology. Histology and histomorphometric analyses were performed as previously described (20). For the experiments presented, male mice were used. Similar results were obtained with female mice (data not shown).
Quantitative real-time PCR Real-time PCR was performed as previously described (22). RNA was isolated using TRIzol reagent (Invitrogen). Nine hundred nanograms of total RNA were reverse transcribed with human leukemia virus reverse transcriptase using the Gene Amp RNA PCR kit (Applied Biosystems) and oligo(dT) primers. mRNA levels were normalized to -actin expression. The following primer-sequences were used: 12/15-LO: CTCTCAAG GCCTGTTCAGGA (sense), GTCCATTGTCCCCAGAACCT (antisense); FPRL1:CCTTGGACCGCTGTATTTGT(sense),CCCCAGGATACAAAGC TCAA (antisense); FPR-RS2: GAGGGTGGTGTCTCAGTGGT (sense), CCTGTCAATTTTTGGCCCTA (antisense).
Western blot analysis Cells and tissue were homogenized and lysed in Laemmli buffer. Protein concentration was determined using a RC/DC protein quantification kit (Bio-Rad). Proteins were separated by electrophoresis in 12% SDS-polyacrylamide gels. Proteins were blotted onto polyvinylidene difluoride membranes and, after blocking with 5% dry milk/0.1% Tween 20, incubated with primary and secondary peroxidase-conjugated Abs and consequent chemiluminescent detection.
Statistical analysis Data are shown as means ⫾ SD. Group mean values were compared by two-tailed Student’s t test.
Results 12/15-LO is expressed in experimental murine arthritis To address the role of 12/15-LO in arthritis, we performed the K/BxN serum-transfer model (21) in wild-type (WT) and 12/ 15-LO-deficient mice. Immunohistochemical analysis of joints of arthritic WT mice revealed strong expression of 12/15-LO in inflammatory synovial tissue (Fig. 1A). Likewise, the quantitative real-time PCR showed a prominent expression of 12/25-LO mRNA in synovial tissue after induction of the serum-transfer arthritis (Fig. 1B). Arthritis exacerbates in 12/15-LO-deficient animals 12/15-LO deficiency significantly aggravates the clinical course of arthritis and causes accelerated and pronounced joint swelling (Fig. 2A), which indicates an anti-inflammatory role of 12/15-LO in arthritis. Clinical arthritis scores reached a plateau at day 11 after serum stimulation. Histological analysis of the hind paws of
FIGURE 1. 12/15 is expressed in murine experimental arthritis. A, Hind paws of WT and 12/15-LO⫺/⫺ mice were immunohistochemically stained for 12/15-LO expression at day 11 after stimulation with K/BxN serum. B, Quantification of 12/15-LO mRNA expression levels in synovial tissue from knee joints of the indicated group of animals (n ⫽ 3 per group). KO, Knock out; rel., relative; N.D., non-detectable.
arthritic mice at day 11 revealed increased destruction of the joint architecture in 12/15-LO⫺/⫺ animals (Fig. 2B). Thus, histomorphometric analysis showed a significant increase in bone erosions and in the number of bone-resorbing osteoclasts in 12/15-LO-deficient mice (Fig. 2C). Furthermore, real-time PCR-based analysis of the gene expression pattern revealed a significant increase in the mRNA levels of a subset of proinflammatory genes, including IL-6 and IL-1 in the synovial tissue of 12/15-LO⫺/⫺ mice (Fig. 2D). Absence of 12/15-LO aggravates arthritis of TNF tg mice Based on the conflicting data on the pro- vs anti-inflammatory role of 12/15-LO in the pathogenesis of atherosclerosis, we sought to confirm our data using a second model of arthritis. Therefore, we interbred 12/15-LO-deficient animals with TNF tg mice, which are characterized by a severely destructive form of arthritis. Strikingly, TNF tg animals lacking 12/15-LO displayed a reduced survival rate and did not achieve appropriate weight gain (Fig. 3A). Moreover, and in accordance with the data obtained from the K/BxN serum-transfer model, 12/15-LO-deficiency caused a much severer form of arthritis in the TNF tg model (Fig. 3A). Histological analysis showed increased destruction of the hind paws in 12/15LO⫺/⫺ TNF tg mice in comparison with 12/15-LO⫹/⫹ TNF tg mice (Fig. 3B). This was evident by significantly enlarged inflammatory infiltrates, increased size of bone erosions, and an increased number of osteoclasts (Fig. 3C). Similarly, real-time PCR analysis showed a significantly enhanced gene expression of IL-1 and IL-6 in joints of 12/15⫺/⫺ TNF tg as compared with 12/15LO⫹/⫹ TNF tg mice (Fig. 3D). Importantly, the deregulated inflammatory gene expression in 12/15-LO⫺/⫺ TNF tg mice was not confined to the inflamed joints. Systemically we observed profound alterations in the expression of inflammatory marker genes in various tissues (Fig. 3E). This pronounced systemic inflammation might additionally explain the
The Journal of Immunology
3385
FIGURE 2. 12/15-LO deficiency exacerbates experimental arthritis. Clinical scoring (n ⫽ 5 per group; A), histologic (tartrate-resistant acid phosphatase staining; B), and histomorphometric analysis (C) of arthritis in the hind paws of 12/15-LO⫺/⫺ mice after induction of the K/BxN serum transfer five animals per group were analyzed). (D) Quantification of mRNA expression by realtime PCR in synovial tissue from knee joints of the indicated group of animals. rel., Relative.
progressive symptoms of wasting observed in 12/15-LO⫺/⫺ TNF tg mice and suggests a role of 12/15-LO in the inhibition of local as well as of systemic inflammatory responses. Furthermore, 12/ 15-LO appears to be essential to limit inflammation-associated tissue damage during chronic inflammatory arthritis. 12/15-LO-deficient mice display reduced levels of anti-inflammatory LXA4 in their synovial tissue 12/15-LO activity has the potential to oxygenate different fatty acids, including linoleic and arachidonic acid, thereby participating in the generation of different lipid mediators, including LXA4. Because this eicosanoid has been implicated in antiinflammatory feedback loops promoting the resolution of inflammation, we sought to quantify levels of different lipid-mediators in the inflamed synovium of arthritic mice. Consistent with the proposed actions of 12/15-LO, this analysis revealed strong alterations in the eicosanoid profile in synovial extracts in 12/15-LO⫺/⫺ animals. The levels of the abundant linoleic acid-derived 12/15-LO product 13-hydroxyoctadecadienoic acid were drastically reduced within the synovia of 12/15LO⫺/⫺ animals (Fig. 4, top left). Moreover, and in line with a prominent role of 12/15-LO during lipoxin biosynthesis (9, 18), these mice displayed decreased levels of LXA4 (Fig. 4, top right). In contrast, the levels of COX-derived PGE2 were not different among WT and 12/15-LO⫺/⫺ mice in the K/BxN serum-transfer arthritis model (Fig. 4, bottom left), while PGE2 levels were increased rather than decreased in 12/15-LO⫺/⫺ TNF tg mice as compared with their 12/15-LO⫹/⫹ TNF tg lit-
termates. This observation might additionally reflect the overwhelming inflammatory response in these animals (Fig. 4C). 12/15-LO-derived eicosanoids differentially modulate the inflammatory response To further elucidate mechanisms involved in the anti-inflammatory effects of 12/15-LO and 12/15-LO-derived lipid mediators, we evaluated the effects of single 12/15-LO-derived lipid oxidation products on the inflammatory response in isolated macrophages. Gene expression analyses revealed expression of both FPRL1 and FPR-RS2 as potential receptors for LXA4 (23) in murine peritoneal macrophages (Fig. 5A). ELISA-based measurement of the cytokine production in TNF-␣-stimulated cells showed that the 12/ 15-LO-derived eicosanoids LXA4, 12-HETE, and 15-HETE differentially inhibited the inflammatory response (Fig. 5B). Although IL-6 secretion was almost completely blocked by these lipid-mediators, only LXA4 significantly inhibited keratinocyte chemoattractant (KC) expression. In contrast, none of these eicosanoids altered secretion of IFN␥. Quantification of mRNA transcripts by real-time PCR confirmed these observations on mRNA expression level (Fig. 5C). 12/15-LO-derived mediators such as LXA4 were shown to negatively regulate different proinflammatory signaling pathways, including the p38MAPK and NFB pathways, in several cell-types (24 –27). The analysis of TNF-␣-induced signaling events in macrophages showed that the addition of the different 12/ 15-LO-derived eicosanoids did not influence TNF-␣-induced activation of the proximal NFB or PI3K pathway, although they potently blocked TNF-induced phosphorylation of p38MAPK (Fig. 5D).
3386
12/15-LO DEFICIENCY EXACERBATES EXPERIMENTAL ARTHRITIS
FIGURE 3. 12/15-LO deficiency exacerbates arthritis in TNF tg mice. Clinical scoring (n ⫽ 9 animals per group; A), histologic (tartrate-resistant acid phosphatase staining; B), and histomorphometric analysis (C) of arthritis in the hind paws of 12/ 15-LO⫹/⫹ TNF tg and 12/15-LO⫺/⫺ TNF tg mice (four animals per group were analyzed). Quantification of mRNA expression by real-time PCR in synovial extracts from knee joints (D) and mRNA expression analysis in different tissues of the indicated group of animals (E). Histological and gene expression analysis was performed at the age of 10 wk. rel., Relative.
12/15-LO-deficient macrophages display an increased inflammatory response We studied the effects of TNF-␣ on macrophages from WT and 12/15-LO⫺/⫺ mice to delineate the role of endogenous 12/15-LO activity on the inflammatory response. In accordance with our in vivo findings and in line with previous data from other groups (18), the quantification of eicosanoids in cellular extracts of 12/15LO⫺/⫺ macrophages revealed significantly reduced levels of LXA4 (Fig. 6A). In parallel with the reduction in the content of this major anti-inflammatory lipid mediator, these cells exhibited an increased inflammatory response. ELISA-based measurement of different inflammatory cytokines showed that 12/15-LO⫺/⫺ macrophages released significantly more IL-6 and KC after stimulation with TNF (Fig. 6B). Again, this effect was restricted to a subset of TNF␣-induced genes, as we did not observe an increase in the TNF-␣induced release of IFN␥. This enhanced production of proinflammatory cytokines was also evident on the mRNA expression level, which reflected the differential effect of 12/15-LO activity on inflammatory gene expression (Fig. 6C) and revealed a prolonged inflammatory response in 12/15-LO⫺/⫺ macrophages (Fig. 6D). Based on the observed effects of 12/15-LO-derived eicosanoids on TNF-␣-induced signaling events, we analyzed activation of various signaling pathways in WT and 12/15-LO-deficient macro-
phages. Again, immunoblot analysis revealed no difference in the phosphorylation state of IB after stimulation with TNF-␣ (Fig. 6E). Although the basal phosphorylation of AKT was clearly reduced in 12/15-LO-deficient macrophages, we did not observe alterations in the TNF-␣-induced levels of phospho-AKT among WT and 12/15-LO⫺/⫺ macrophages (Fig. 6E). In line with the effects of the 12/15-LO-derived products on p38MAPK activity, the determination of the p38MAPK phosphorylation state revealed a striking increase in basal and TNF-␣-induced activation of p38MAPK in macrophages from 12/15-LO⫺/⫺ mice (Fig. 6E). To further confirm this 12/15-LO-mediated regulation of p38MAPK activation in vivo, we determined the phosphorylation of p38MAPK in synovial tissue extracts after induction of KxB/N serum-transfer arthritis. In accordance with our in vitro observations, we found increased levels of phosphorylated p38MAPK in 12/15-LO⫺/⫺ mice (Fig. 6F), suggesting a major role of 12/15-LO and its products in the regulation of p38MAPK activity under chronic inflammatory conditions.
Discussion Inflammatory arthritides such as RA constitute a major disease burden worldwide. This group of chronic inflammatory diseases leads to progressive destruction of cartilage and bone. Although
The Journal of Immunology
3387
FIGURE 4. 12/15-LO⫺/⫺ animals display an altered eicosanoid profile. Competitive ELISA-based quantification of the levels of indicated eicosanoids in pooled synovial-tissue extracts of both mouse knee joints 11 days after serum transfer and TNF tg mice at the age of 10 wk (n ⫽ 3 mice per group). HODE, Hydroxyoctadecadienoic acid.
attention has so far mainly focused on factors contributing to the progression of the disease, it is equally important to understand counterregulatory mechanisms involved in the termination of the inflammatory response and limitation of associated tissue injury. Resolution of inflammation can be regarded as an active process governed by multiple factors including arachidonic acid-derived metabolites such as lipoxins, which are considered key anti-inflammatory players. LXA4 blocks proinflammatory signals and initiates resolving mechanisms, including apoptosis and phagocytosis of neutrophils (9). Application of lipoxins and their stable analogues was shown to ameliorate the course of inflammatory diseases, including inflammatory bowel disease, arthritis, and asthma (28 –30). Studies using a mouse transgenic for the human lipoxin receptor (ALX) have additionally provided genetic evidence for a role of the lipoxin receptor FPRL-1 (ALX) in the resolution of inflammation (31). Nevertheless, little is known about the role of endogenously produced lipoxins during the pathogenesis of chronic inflammatory disorders such as RA. This group of eicosanoids is generated via a biosynthetic process involving both 12/ 15-LO and 5-LO activity (9). Although 5-LO itself mainly contributes to the propagation of inflammation by an abundant generation of proinflammatory leukotrienes, the expression of human 15-LO and its murine homologue 12/15-LO follows the expression of 5-LO and COX-2 and shows a peak expression during the resolution phase of inflammation (32). Nevertheless, the exact role of this enzyme during chronic inflammatory disease has remained elusive. 12/15-LO activity has been initially implicated in the oxidation of low density lipoprotein particles, thereby generating proinflammatory oxidized low density lipoprotein. Deletion of 12/15-LO was shown to reduce lipid peroxidation in vivo as well as to ameliorate the formation of atherosclerotic lesions in murine models of atherosclerosis (33). A recent study, however, which included data from animals deficient for 12/15-LO and from animals overexpressing a 12/15-LO transgene, indicated a more complex role of this enzyme during vascular inflammation and pointed toward additional anti-inflammatory properties, which mainly seem to involve the generation of lipoxins (18). This study supports previous findings showing that 15-LO tg rabbits display reduced atherosclerotic lesions (17), which probably indicates a context-dependent role of 12/15-LO in the modulation of the inflammatory response.
FIGURE 5. 12/15-LO-derived eicosanoids block the inflammatory response in macrophages. A, mRNA isolated from peritoneal macrophages was reversed transcribed as described in Materials and Methods and consequently analyzed for the expression of the two putative LXA4 receptors, FPRL1 (ALX) and FPR-RS2, by semiquantitative PCR. (B) ELISA-based measurement of IL-6, KC, and IFN␥ protein levels in supernatants and (C) quantification of mRNA levels by real-time PCR after stimulation of peritoneal macrophages, preincubated for 4 h with LXA4 (1 M), 12-HETE (1 M), or 15-HETE (1 M) and stimulated with TNF (10 ng/ml for additional 6 h). D, Western blot analysis of indicated signaling pathways after preincubation of macrophages with LXA4 (1 M), 12-HETE (1 M), or 15-HETE (1 M) and stimulation with TNF (10 ng/ml for 15 min). Data shown is representative for at least three independent experiments.
Using two models of inflammatory arthritis, we now present clear evidence that 12/15-LO is a major anti-inflammatory enzyme during the course of inflammatory joint disease. In both models, the reduced levels of LXA4 correlated with an increased expression of proinflammatory cytokines and increased tissue damage. Additional support for a protective role of LXA4 during arthritis comes from a recent study demonstrating beneficial effects of an LXA4 agonist on murine collagen-induced arthritis (29). Moreover, overexpression of 15-LO in rabbits was shown to ameliorate inflammation, tissue damage, and bone loss in a model of acute periodontitis (34). Expression of 15-LO as well as the level of LXA4 is increased in the inflamed synovium of RA patients (35), which strongly indicates an important role of this enzyme in human RA as well. Despite the absence of 12/15-LO, we still detected LXA4 in synovial tissue of 12/15-LO⫺/⫺ mice. Alternative
3388
12/15-LO DEFICIENCY EXACERBATES EXPERIMENTAL ARTHRITIS
FIGURE 6. 12/15-LO-deficient macrophages exhibit an increased inflammatory response. A, Quantification of LXA4 levels in extracts from isolated peritoneal macrophages by competitive ELISA technique. (B) ELISA-based measurement of IL-6, KC, and IFN␥ protein levels in supernatants and (C and D) quantification of mRNA levels by real-time PCR after stimulation of peritoneal macrophages with TNF (10 ng/ml for 6 h). Western blot analysis of the indicated signaling pathways in (E) extracts of peritoneal macrophages isolated from WT and 12/15-LO⫺/⫺ mice after stimulation with TNF (10 ng/ml) or (F) extracts of knee joints of the indicated group of mice. Data shown in A–E is representative for at least three independent experiments.
pathways involving platelet 12-LO, which can additionally contribute to lipoxin generation in vivo, might explain this fact. 12/ 15-LO⫺/⫺ TNF tg mice displayed increased levels of COX-derived PGE2 in their synovial tissue. Interestingly, the PGE2producing enzyme PGE2 synthase was shown to be regulated by proinflammatory cytokines in rheumatoid synoviocytes (36). Consistent with previous studies, we observed strong antiinflammatory effects of LXA4 in vitro (24, 25). Although LXA4 was the most potent 12/15-LO-derived eicosanoid tested, 12HETE and 15-HETE also displayed anti-inflammatory activity, which might involve conversion of these compounds to lipoxins by endogenous macrophage-derived 5-LO activity. LXA4 was shown to act in a SOCS-2-dependant manner (37). In splenocytes, the anti-inflammatory effects of LXA4 seem to involve the induction of TRAF6-degradation leading to a blockade of both p38MAPK and the NFB-pathway (38). Moreover, LXA4 was shown to induce expression of the transcriptional corepressor NAB1 in human neutrophils, indicating that inhibitory effects of lipoxins might be mediated by de novo synthesized proteins (39). Although we observed a clear inhibition of the phosphorylation of p38MAPK by 12/15-LO-derived eicosanoids in peritoneal macrophages, activation of the NFB and PI3K pathways was not affected. Similarly, expression of the corepressor NAB1 was not changed after LXA4 treatment (data not shown). In line with these effects exerted by the addition of 12/15-LO-derived eicosanoids, 12/15-LO⫺/⫺ macro-
phages exhibited an increased activation of p38MAPK with no alteration in the activation level of NFB. Previously it was shown that with an increase in age, 12/15LO-deficient animals can develop a myeloproliferative disorder involving deregulation of the PI3K pathway (40). Interestingly, we observed that the basal phosphorylation of AKT was diminished in 12/15-LO⫺/⫺ macrophages. This might indicate pathway-specific differences in the effects of LXA4 in certain cell types. In parallel with the modulation of the p38MAPK pathway, we observed LXA4-mediated inhibition of IL-6 and KC expression. Again, TNF-␣-induced expression of these cytokines was increased in 12/15⫺/⫺ macrophages. This data is supported by a recent study demonstrating increased expression levels of IL-1 in 12/15⫺/⫺ macrophages after challenge with bacterial products (41). Interestingly, the TNF-␣-induced expression of IFN␥ was altered neither by addition of LXA4 nor by the absence of 12/15-LO, which indicates a differential regulation of inflammatory cytokines by the 12/15-LOX-LXA4-axis. This observation is in accordance with a necessity for p38MAK activity in the transcriptional induction of KC and IL-6 expression by NFB, which involves p38-mediated histone H3 phosphorylation (42). Taken together, our present study presents evidence supporting a prominent role of 12/15-LO and 12/15-LO-derived mediators in a regulatory feedback loop, which counteracts the exacerbation of inflammation and associated tissue damage. These insights in
The Journal of Immunology mechanisms underlying the resolution of inflammation are useful to develop novel tools to control inflammation and to efficiently treat chronic inflammatory diseases such as arthritis.
Acknowledgments We thank Cornelia Stoll, Wolfgang Baum, Martin Steffen, Barbara Roy, and Isabelle Schmidt for their excellent technical support and George Kollias (Alexander Fleming Biomedical Research Centre, Vari, Greece) for providing TNF tg mice. This study was funded by the ELAN-fonds (07.05.15.1) of the University Erlangen-Nuremberg (G.K. and G.S.) and the German Research Society Grants SCHE 1583/5-1 (G.S. and G.K.) and SFB 643 (G.K. and R.E.V.) and the European Union projects Masterswitch, Adipoa, and Vinacept.
Disclosures The authors have no financial conflict of interest.
References 1. Serhan, C. N., and J. Savill. 2005. Resolution of inflammation: the beginning programs the end. Nat. Immunol. 6: 1191–1197. 2. Funk, C. D. 2001. Prostaglandins and leukotrienes: advances in eicosanoid biology. Science 294: 1871–1875. 3. Yacoubian, S., and C. N. Serhan. 2007. New endogenous anti-inflammatory and proresolving lipid mediators: implications for rheumatic diseases. Nat. Clin. Pract. Rheumatol. 3: 570 –579. 4. Mehrabian, M., H. Allayee, J. Wong, W. Shi, X. P. Wang, Z. Shaposhnik, C. D. Funk, and A. J. Lusis. 2002. Identification of 5-lipoxygenase as a major gene contributing to atherosclerosis susceptibility in mice. Circ. Res. 91: 120 –126. 5. Griffiths, R. J., E. R. Pettipher, K. Koch, C. A. Farrell, R. Breslow, M. J. Conklyn, M. A. Smith, B. C. Hackman, D. J. Wimberly, A. J. Milici, et al. 1995. Leukotriene B4 plays a critical role in the progression of collagen-induced arthritis. Proc. Natl. Acad. Sci. USA 92: 517–521. 6. Griffiths, R. J., M. A. Smith, M. L. Roach, J. L. Stock, E. J. Stam, A. J. Milici, D. N. Scampoli, J. D. Eskra, R. S. Byrum, B. H. Koller, and J. D. McNeish. 1997. Collagen-induced arthritis is reduced in 5-lipoxygenase-activating protein-deficient mice. J. Exp. Med. 185: 1123–1129. 7. Myers, L. K., A. H. Kang, A. E. Postlethwaite, E. F. Rosloniec, S. G. Morham, B. V. Shlopov, S. Goorha, and L. R. Ballou. 2000. The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis. Arthritis Rheum. 43: 2687–2693. 8. Burleigh, M. E., V. R. Babaev, J. A. Oates, R. C. Harris, S. Gautam, D. Riendeau, L. J. Marnett, J. D. Morrow, S. Fazio, and M. F. Linton. 2002. Cyclooxygenase-2 promotes early atherosclerotic lesion formation in LDL receptor-deficient mice. Circulation 105: 1816 –1823. 9. Serhan, C. N., N. Chiang, and T. E. Van Dyke. 2008. Resolving inflammation: dual anti-inflammatory and pro-resolution lipid mediators. Nat. Rev. Immunol. 8: 349 –361. 10. Sun, D., and C. D. Funk. 1996. Disruption of 12/15-lipoxygenase expression in peritoneal macrophages: enhanced utilization of the 5-lipoxygenase pathway and diminished oxidation of low density lipoprotein. J. Biol. Chem. 271: 24055–24062. 11. Hedrick, C. C., M. D. Kim, R. D. Natarajan, and J. L. Nadler. 1999. 12-Lipoxygenase products increase monocyte: endothelial interactions. Adv. Exp. Med. Biol. 469: 455– 460. 12. Patricia, M. K., J. A. Kim, C. M. Harper, P. T. Shih, J. A. Berliner, R. Natarajan, J. L. Nadler, and C. C. Hedrick. 1999. Lipoxygenase products increase monocyte adhesion to human aortic endothelial cells. Arterioscler. Thromb. Vasc. Biol. 19: 2615–2622. 13. Hatley, M. E., S. Srinivasan, K. B. Reilly, D. T. Bolick, and C. C. Hedrick. 2003. Increased production of 12/15 lipoxygenase eicosanoids accelerates monocyte/endothelial interactions in diabetic db/db mice. J. Biol. Chem. 278: 25369 –25375. 14. Reilly, K. B., S. Srinivasan, M. E. Hatley, M. K. Patricia, J. Lannigan, D. T. Bolick, G. Vandenhoff, H. Pei, R. Natarajan, J. L. Nadler, and C. C. Hedrick. 2004. 12/15-Lipoxygenase activity mediates inflammatory monocyte/endothelial interactions and atherosclerosis in vivo. J. Biol. Chem. 279: 9440 –9450. 15. Cyrus, T., J. L. Witztum, D. J. Rader, R. Tangirala, S. Fazio, M. F. Linton, and C. D. Funk. 1999. Disruption of the 12/15-lipoxygenase gene diminishes atherosclerosis in apo E-deficient mice. J. Clin. Invest. 103: 1597–1604. 16. George, J., A. Afek, A. Shaish, H. Levkovitz, N. Bloom, T. Cyrus, L. Zhao, C. D. Funk, E. Sigal, and D. Harats. 2001. 12/15-Lipoxygenase gene disruption attenuates atherogenesis in LDL receptor-deficient mice. Circulation 104: 1646 –1650. 17. Shen, J., E. Herderick, J. F. Cornhill, E. Zsigmond, H. S. Kim, H. Kuhn, N. V. Guevara, and L. Chan. 1996. Macrophage-mediated 15-lipoxygenase expression protects against atherosclerosis development. J. Clin. Invest. 98: 2201–2208. 18. Merched, A. J., K. Ko, K. H. Gotlinger, C. N. Serhan, and L. Chan. 2008. Atherosclerosis: evidence for impairment of resolution of vascular inflammation governed by specific lipid mediators. FASEB J. 22: 3595–3606.
3389 19. Huo, Y., L. Zhao, M. C. Hyman, P. Shashkin, B. L. Harry, T. Burcin, S. B. Forlow, M. A. Stark, D. F. Smith, S. Clarke, et al. 2004. Critical role of macrophage 12/15-lipoxygenase for atherosclerosis in apolipoprotein E-deficient mice. Circulation 110: 2024 –2031. 20. Redlich, K., S. Hayer, R. Ricci, J. P. David, M. Tohidast-Akrad, G. Kollias, G. Steiner, J. S. Smolen, E. F. Wagner, and G. Schett. 2002. Osteoclasts are essential for TNF-␣-mediated joint destruction. J. Clin. Invest. 110: 1419 –1427. 21. Monach, P. A., D. Mathis, and C. Benoist. 2008. The K/BxN arthritis model. Curr. Protoc. Immunol. Chapter 15: Unit 15.22. 22. Kronke, G., V. N. Bochkov, J. Huber, F. Gruber, S. Bluml, A. Furnkranz, A. Kadl, B. R. Binder, and N. Leitinger. 2003. Oxidized phospholipids induce expression of human heme oxygenase-1 involving activation of cAMP-responsive element-binding protein. J. Biol. Chem. 278: 51006 –51014. 23. Chiang, N., C. N. Serhan, S. E. Dahlen, J. M. Drazen, D. W. Hay, G. E. Rovati, T. Shimizu, T. Yokomizo, and C. Brink. 2006. The lipoxin receptor ALX: potent ligand-specific and stereoselective actions in vivo. Pharmacol. Rev. 58: 463– 487. 24. Jozsef, L., C. Zouki, N. A. Petasis, C. N. Serhan, and J. G. Filep. 2002. Lipoxin A4 and aspirin-triggered 15-epi-lipoxin A4 inhibit peroxynitrite formation, NF-B and AP-1 activation, and IL-8 gene expression in human leukocytes. Proc. Natl. Acad. Sci. USA 99: 13266 –13271. 25. Wu, S. H., C. Lu, L. Dong, G. P. Zhou, Z. G. He, and Z. Q. Chen. 2005. Lipoxin A4 inhibits TNF-␣-induced production of interleukins and proliferation of rat mesangial cells. Kidney Int. 68: 35– 46. 26. Ohira, T., G. Bannenberg, M. Arita, M. Takahashi, Q. Ge, T. E. Van Dyke, G. L. Stahl, C. N. Serhan, and J. A. Badwey. 2004. A stable aspirin-triggered lipoxin A4 analog blocks phosphorylation of leukocyte-specific protein 1 in human neutrophils. J. Immunol. 173: 2091–2098. 27. Cezar-de-Mello, P. F., V. Nascimento-Silva, C. G. Villela, and I. M. Fierro. 2006. Aspirin-triggered Lipoxin A4 inhibition of VEGF-induced endothelial cell migration involves actin polymerization and focal adhesion assembly. Oncogene 25: 122–129. 28. Gewirtz, A. T., L. S. Collier-Hyams, A. N. Young, T. Kucharzik, W. J. Guilford, J. F. Parkinson, I. R. Williams, A. S. Neish, and J. L. Madara. 2002. Lipoxin a4 analogs attenuate induction of intestinal epithelial proinflammatory gene expression and reduce the severity of dextran sodium sulfate-induced colitis. J. Immunol. 168: 5260 –5267. 29. Zhang, L., X. Zhang, P. Wu, H. Li, S. Jin, X. Zhou, Y. Li, D. Ye, B. Chen, and J. Wan. 2008. BML-111, a lipoxin receptor agonist, modulates the immune response and reduces the severity of collagen-induced arthritis. Inflamm. Res. 57: 157–162. 30. Levy, B. D., N. W. Lukacs, A. A. Berlin, B. Schmidt, W. J. Guilford, C. N. Serhan, and J. F. Parkinson. 2007. Lipoxin A4 stable analogs reduce allergic airway responses via mechanisms distinct from CysLT1 receptor antagonism. FASEB J. 21: 3877–3884. 31. Devchand, P. R., M. Arita, S. Hong, G. Bannenberg, R. L. Moussignac, K. Gronert, and C. N. Serhan. 2003. Human ALX receptor regulates neutrophil recruitment in transgenic mice: roles in inflammation and host defense. FASEB J. 17: 652– 659. 32. Levy, B. D., C. B. Clish, B. Schmidt, K. Gronert, and C. N. Serhan. 2001. Lipid mediator class switching during acute inflammation: signals in resolution. Nat. Immunol. 2: 612– 619. 33. Cyrus, T., D. Pratico, L. Zhao, J. L. Witztum, D. J. Rader, J. Rokach, G. A. FitzGerald, and C. D. Funk. 2001. Absence of 12/15-lipoxygenase expression decreases lipid peroxidation and atherogenesis in apolipoprotein e-deficient mice. Circulation 103: 2277–2282. 34. Serhan, C. N., A. Jain, S. Marleau, C. Clish, A. Kantarci, B. Behbehani, S. P. Colgan, G. L. Stahl, A. Merched, N. A. Petasis, L. Chan, and T. E. Van Dyke. 2003. Reduced inflammation and tissue damage in transgenic rabbits overexpressing 15-lipoxygenase and endogenous anti-inflammatory lipid mediators. J. Immunol. 171: 6856 – 6865. 35. Hashimoto, A., I. Hayashi, Y. Murakami, Y. Sato, H. Kitasato, R. Matsushita, N. Iizuka, K. Urabe, M. Itoman, S. Hirohata, and H. Endo. 2007. Antiinflammatory mediator lipoxin A4 and its receptor in synovitis of patients with rheumatoid arthritis. J. Rheumatol. 34: 2144 –2153. 36. Stichtenoth, D. O., S. Thoren, H. Bian, M. Peters-Golden, P. J. Jakobsson, and L. J. Crofford. 2001. Microsomal prostaglandin E synthase is regulated by proinflammatory cytokines and glucocorticoids in primary rheumatoid synovial cells. J. Immunol. 167: 469 – 474. 37. Machado, F. S., J. E. Johndrow, L. Esper, A. Dias, A. Bafica, C. N. Serhan, and J. Aliberti. 2006. Anti-inflammatory actions of lipoxin A4 and aspirin-triggered lipoxin are SOCS-2 dependent. Nat. Med. 12: 330 –334. 38. Machado, F. S., L. Esper, A. Dias, R. Madan, Y. Gu, D. Hildeman, C. N. Serhan, C. L. Karp, and J. Aliberti. 2008. Native and aspirin-triggered lipoxins control innate immunity by inducing proteasomal degradation of TRAF6. J. Exp. Med. 205: 1077–1086. 39. Qiu, F. H., P. R. Devchand, K. Wada, and C. N. Serhan. 2001. Aspirin-triggered lipoxin A4 and lipoxin A4 up-regulate transcriptional corepressor NAB1 in human neutrophils. FASEB J. 15: 2736 –2738. 40. Middleton, M. K., A. M. Zukas, T. Rubinstein, M. Jacob, P. Zhu, L. Zhao, I. Blair, and E. Pure. 2006. Identification of 12/15-lipoxygenase as a suppressor of myeloproliferative disease. J. Exp. Med. 203: 2529 –2540. 41. Dioszeghy, V., M. Rosas, B. H. Maskrey, C. Colmont, N. Topley, P. Chaitidis, H. Kuhn, S. A. Jones, P. R. Taylor, and V. B. O’Donnell. 2008. 12/15-Lipoxygenase regulates the inflammatory response to bacterial products in vivo. J. Immunol. 181: 6514 – 6524. 42. Saccani, S., S. Pantano, and G. Natoli. 2002. p38-Dependent marking of inflammatory genes for increased NF-B recruitment. Nat. Immunol. 3: 69 –75.