To my brothers & sisters. ... study to the toxic effects of aflatoxin on hematopoietic stem cells (as ... immediately after delivery while the placenta was intrauterine. ..... The conidiophores shall be a transparent tapering, thick walls, ranging in.
Republic of Iraq Ministry of Higher Education And Scientific Research University of Anbar College of Education for Pure Sciences Department of Biology
A Molecular Study of Aflatoxin and Toxic Effect on Hematopoietic Stem Cells A thesis Submitted to the Council of the College of Education for Pure Sciences – University of Anbar in Partial Fulfillment of the Requirements for the Degree of Master of Science in Biology By Mohammed Hamada Musleh AL-Fahdawi B.Sc. in Biology - College of Education for Pure Sciences University of Anbar 2012
Supervised by Professor Dr. Mushtak T.S. AL – Ouqaili Assistant Professor Dr. Salah M. A. AL – Kubaisi
Oct, 2017 A.D.
Safar 1439 A. H.
آ سورة طـه الية ()114
Dedication To the prophet of Allah, Mohammed (Peace and blessing be upon him) To my leader, my father To light of my eyes, my lovely mother To my brothers & sisters. To everyone who gets benefit of this work .
Mohammed
Acknowledgments My profound gratitude is expressed, first of all, and for most to Allah the Lord of the universe and creation, who gave me health, strength and facilitate the ways for me to accomplish my thesis. Most profound thanks and gratitude are presented to my supervisor, Professor Dr. Mushtak T.S. AL-Ouqaili (Dean of College of Pharmacy) for his supervision and for his scientific guidance, providing the laboratory requirements and for his enthusiastic support throughout this study. It is my pleasant duty to express gratitude to my supervisor, Assistant Professor Dr. Salah M. A. AL-Kubaisi for his guidance and fruitful scientific instructions and constant cooperation throughout my study. My sincere thanks and gratitude to the deanery and are extended to all members of the College of Pharmacy-University of Anbar, and the staff of the College of Veterinary Medicine-University of Falluja each of the presidency and employees of laboratories. I would like to thank the dean of College of Education for Pure Sciences Assistant professor Dr. Azmi T.H. Al-Rawi. I'm so thankful and grateful to the laboratories of the Department of Environment and Water, Ministry of Science and Technology; specifically Dr. Abdul-Jabbar Abbas, Mr. Adel S. Salman and Mrs. Eman Abbas. All my thanks and gratitude go to Dr. Shurooq N. AL-Nuaimy of AlJamiea private hospital of Baghdad for her kindness and support. I also would like to thank Dr. Mohammed M. Al-Halbosiy and Mr. Baraa Abdulhadi in AlNahrain University/ Biotechnology Research Center for their Valuable help. Special thanks go to everyone help (presented to) me directly or indirectly in performing this research.
Mohammed
I
SUMMARY The current study aimed to determine the efficacy of the polymerase chain reaction (PCR) and High-performance liquid chromatography (HPLC) techniques in the discrimination between aflatoxigenic and non-aflatoxigenic isolates of Aspergillus flavus isolated from clinical and environmental sources. In addition to study to the toxic effects of aflatoxin on hematopoietic stem cells (as precursors of mononuclear cells) which were isolated from human umbilical cord blood. The fifteen isolates of A. flavus were isolated from clinical and environmental sources. The clinical isolates were isolated from cows, poultry and fish, while the environmental isolates were isolated from the dry grains of wheat, barley, corn and peanuts. These fungi were cultured on Potato dextrose agar (PDA) and then sub cultured on Sabouraud dextrose agar (SDA). The isolates were identified depending on their morphological characteristics (cultural and microscopical). As concerns the molecular part of the study, genomic DNA was extracted from all A. flavus isolates. These genomic DNA samples were found to have suitable concentration and purity for PCR technique. The genes sites were amplified (aflR, nor 1 and ver 1) in the targeted DNA by used PCR. Isolates of each fungus were cultured on an SDA slant medium. The spores were harvested and counted by using the counted chamber of hemocytometer. One million spore of each isolate were placed in a flask contained 50 g of sterilized rice for 21 days. Aflatoxin was extracted from rice using chemical compounds; hence, the extracted aflatoxin was tested qualitatively and quantitatively using HPLC. The study was also included the collection of umbilical cords blood samples immediately after delivery while the placenta was intrauterine. Hematopoietic stem cells were isolated from the umbilical cord blood by the gradient density method. The Hematopoietic stem cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) with 10 % of fetal calf serum, then subjected to in vitro study to confirm the toxic effects of aflatoxin extracts with the following concentrations (0.0078, 0.0156, 0.031, 0.062, 0.13, 0.25, and 1) μg/ ml and to detect the inhibition rate of
II hematopoietic
stem
cells
by
using
3-(4,
5-Dimethylthiazol-2-yl)-2,
5-
diphenyltetrazolium bromide (MTT) assay. The results of macroscopic and microscopic examination of tissue or organs showed that colonies had a cottony appearance at the beginning of growth and then gradually turned into irradiated yellowish green and had the ability to form abundant conidial structures with a spherical shape. On the other hand, the average yield of DNA were in the range of (81-795) ng/µl, with a purity ranging between (1.6 -2.0). As two structural genes had been observed in current study; nor1 and ver 1, which appeared at the location of 400 and 600 base pair respectively. These genes were involved in the biosynthesis of aflatoxin, while the gene aflR was located at 1000 base pair and considered to be the regulating gene that plays a major role in the production of aflatoxin. The results showed that the genes (aflR and nor1) were found in 11 (73%) isolates, while ver 1 was found in 10 (67%) isolates. Moreover, 10 (67%) isolates were capable of producing aflatoxin efficiently. The result of HPLC showed that there was a variation in the activity of A.flavus isolates, where ten isolates produced aflatoxin B1 with rates ranging from 0.78 to 45.03 ppm. These isolates were produced positive result when subjected to PCR technique. The cytotoxicity assay (in vitro study), revealed that the inhibition rate increases seriously with the increase of aflatoxin concentration. Hence the concentration 1 μg /ml has given inhibition rate which reached 100%, while the concentration 0.0078 μg /ml did not eliminates any type of cells. The study suggested that aflatoxin production was directly associated with the appearance and expression of genes (nor 1, ver 1 and aflR). Also, aflatoxin has a highly toxic effect on human hematopoietic stem cells, and its concentration is high and positively associated with the rate of cell death increases. Furthermore, the concentration 1 μg /ml of aflatoxin extracted from the aflatoxigenic isolates can kill 100% of hematopoietic stem cells.
III
List contents Item No. Subitems No.
Subject Summary List of contents List of tables List of figures List of abbreviations
Page No. I III VII VIII X
Chapter One: INTRODUCTION 1.1
Introduction
Chapter Two: LITERATURE REVIEW
2. 2.1 2.2 2.3 2.4 2.4.1 2.1.2 2.4.3 2.4.4 2.5 2.6 2.6.1 2.6.2 2.6.3 2.7 2.7.1 2.7.2 2.7.3 2.8 2.8.1 0.8.4.4
0.8.4.0 0.8.4.3 0.8.4.4 0.8.0 2.9
Mycotoxin Aflatoxin History of Aflatoxin Aspergillus genera and species Taxonomic characteristics Diagnostic characteristics of the species A.flavus Identification and characterization of A. flavus Diseases caused by Aspergillus spp Aflatoxin producing – Aspergillus Aflatoxins Chemical structure of Aflatoxins Properties of aflatoxins Biosynthesis of Aflatoxin Factors favoring aflatoxigenic fungal growth and aflatoxin production Physical factors affecting aflatoxin production Chemical factors affecting aflatoxin production Biological factors affecting aflatoxin production Analytical methods for the detection of aflatoxins Molecular Analysis Using Polymerase Chain Reaction (PCR) Aflatoxin genes used for PCR amplification Aflatoxin biosynthetic pathway and genes involved Norsolorinic acid (NOR) to averantin (AVN) Aflatoxin regulatory gene aflR High Performance Liquid Chromatography (HPLC) Health consequences of Aflatoxin Stem Cells
1 4 4 4 5 6 6 8 8 10 14 12 11 14 15 41 17 18 18 19 49 02 02 24 20 23 25 21
IV 0.9.4 0.9.0 1 2 0.9.3 0.9.3.4 0.9.3.0 0.9.3.3 4 2 3 3
Definitions of stem cells Types of stem cells Embryonic stem cells (ESCs) Adult stem cells (ASCs) Hematopoietic Stem Cells Morphological characteristics Classification of HSC Major Sources of HSC Bone Marrow Peripheral Blood Umbilical Cord Blood (UCB)
Chapter three: MATERIALS AND METHODS
3.1 3.1.1 3.1.2 3.1.3 3.1.4 3.1.5 A. B. 3.1.6 1 2 3 1 3.2 3.2.1 A 3.2.2. 3.2.3 3.2.4 3.2.5 3.3 3.3.1 3.3.2 3.3.3 3.3.4
21 27 27 28 29 32 32 32 32 33 34 37
Materials Equipment Tools Chemicals and culture requirements Culture Condition Culture Media Preparation of mycological media Preparation of the tissue culture medium Preparation of solutions, buffers, stains and reagents Phosphate buffer saline (PBS) Trypan blue stain (0.04%) Preparation of MTT (3-(4,5 -Dimethylthiazol-2-yl)-2,5diphenyl-tetrazolium bromide) stain Preparation of DAB
37 37 38 39 12 12 12 12 14 14 14
Methodology Isolation of A. flavus Environmental Samples Clinical samples Cultivation of isolates Identification of isolates Scotch tape preparation Preservation of isolates Counting spores using a hemocytometer Rice grain cultures Aflatoxin extraction method Detection of AFB1 using high performance liquid chromatography AFB1 Standard Curve
43 43 43 44 45 45 45 45 45 47 48
14 14
48 48
V 3.4 3.4.1 3.4.2 3.4.3 3.4.4 3.4.5 3.5 3.5.1 3.5.2 3.5.3 1 2 3 4 3.5.4 3.5.5 3.5.6 3.5.7 3.5.7.1 3.6 A B 3.6.1 3.6.2 3.6.3 3.6.4 3.6.5 3.6.6 3.6.7
Molecular part DNA extraction Lysate of prepare A. flavus DNA extraction kit Estimation of DNA concentration and purity Preparation 1% of agarose gel Electrophoresis Polymerase chain reaction Primers Preparation of PCR mix reaction PCR program Initial Denaturation of (nor1, aflR, ver 1) genes Denaturation Annealing Extension Optimization of polymerase chain reaction Reagents for electrophoresis Agarose gel electrophoresis Casting of the horizontal agarose gel Loading DNA sample Cord blood collection Closed System Method Open System Method Cord blood cells separation Determination of cell number and viability Isolation and cultivation of the hematopoietic stem cells from the human umbilical cord blood CD34 staining method Measurement of the Viable Hematopoietic stem cells by MTT Assay Photography Statistical Analysis
Chapter four: Results and Discussions
4 4.1
Isolation and identification of A. flavus from different sources
4.2
Aspergillus flavus cultural features and microscopic examination Molecular analysis
4.3 4.3.1
Concentration and purity of DNA extracted from A. flavus isolates.
50 50 50 50 51 52 52 52 52 53 51 54 55 55 55 56 56 57 57 57 58 59 59 60 62 63 63 65 66 66 67 67 69 71 71
VI 4.3.2
PCR analysis
73
4.3.2.1
The role of nor1 (aflD) in synthesis of aflatoxin
75
4.3.2.2
The ver 1 (aflM) gene involved in aflatoxin synthesis
77
4.3.2.3
aflR (regulatory gene)
78
4.4
The ability of A. flavus isolates to produce of spores
81
4.5
Culturing of fungal spores on rice to produce AFB1
86
4.6
87
4.7
The HPLC technique for detection the potentiality of A. flavus to produce AFB1. Collection of umbilical cord blood
4.8
Isolation of hematopoietic stem cells by using Ficoll
94
4.9
Cytotoxic effects of Aflatoxin
96
5
Chapter Five: conclusion and Recommendations
5.1
Conclusion
5.2
Recommendations
Reference Appendices انخالصت
92
VII
List of tables Table No.
Table
Page No.
2.1
Classification of Aspergillus flavus
8
2.2
Taxonomy of some Aspergillus species with the type of aflatoxin
12
0.3
Properties of aflatoxins
14
3.4
Equipment used in this study and their company and origin
37
3.0 3.3
The tools used in this study illustrated in table (3.2) and their company and origin Chemical and biological materials used in this study and their company and origin
38 39
3.4
A. flavus isolates from different source and origin
44
3.5
The names and sequences of the primers used in this study
53
3.6 3.7 4.1 4.2 4.3
The original PCR reagents and final concentrations which were used in study procedure. The PCR program which was used in the amplification of the targets DNA for: aflR, nor1 and ver 1 A. flavus isolates from a different source DNA concentration and purity of each sample after estimation by nanodrop technique Frequency of single genes in A. flavus, isolates collected from clinical and environmental source.
54 54 67 72 80
1.1
Origin of isolates and numbers of the products spores
82
4.5
Comparison between different isolates (isolate origin) in Co. AFB1 in HPLC
89
VIII
List of figures Figure No. 2.1
Figures Chemical structures of aflatoxin B1, B2, G1, G2, M1 and M2.
Page No. 14
3.1
Aflatoxin cluster in A. flavus. The aflatoxin cluster is composed of approximately 30 different genes and is located near the telomere of chromosome 3. Showing the development of different blood cells from haematopoietic stem cell to mature cells. Cord blood contains HSC as well as multipotent stem cells, such as mesenchymal stem cells, which have the ability to regenerate numerous tissue types. RBC, red blood cell; WBC, white blood cell. Experimental Design
3.2
The standard curve of AFB1 concentrations using HPLC technique.
49
3.3
55
4.1
PCR temperature condition for nor1 (58C), ver 1 (58C) aflR (60C). Collection of umbilical cord blood during cesarean section. (A): the umbilical cord is a conduit between the fetus and the placenta (B): Vein of umbilical cord from it collect blood whiles the placenta in utero (closed system). (C): The placenta out of uterus. (D): Vein of umbilical cord from it collect blood whiles the placenta exutero (open system) Diluted blood overlaid on Ficoll-Paque before gradient centrifugation. Separation tube of blood four layers after gradient centrifugation, the upper one (A) represent the supernatant plasma, (B) represents the medium cloudy layer (Buffy coat) represent the MNCs, (C) represent the layer of the Ficoll-Paque and (D) represent the remainder cells which settled in the lower layer. A. flavus has grown on PDA at 28 C after 5 days
4.2
A. flavus grown on SDA at 28°C after 5 days
70
2.2
2.3
2.4
3.4
3.5
3.6
4.3
4.4
4.5
Microscopic features of A. flavus stained with lactophenol cotton blue (40x) Agarose gel electrophoresis of total genomic DNA isolate that were extracted by commercial kit (Wizard Genomic DNA Purification). Fragments were fractionated by electrophoresis on 1% agarose gel (1hr, 5v/cm, 1xTris borate buffer) and visualized under U.V light after staining with ethidium bromide. PCR product with nor1 primer on 1 % agarose gel electrophoresis with ethidium bromide, M: 100 bp DNA ladder. Lanes: AFl1, AFl2, AFl3, AFl4, AFl5, AFl6, AFl7, AFl8, AFl9, AFl10, AFl11, AFl12, AFl13, AFl14, AFl15
23
30
35 42
60
61
62
69
71
73
75
IX
4.6
4.7
4.8 4.9 4.10
4.11
4.14
PCR product with ver 1 primer on 1.5% agarose gel electrophoresis with ethidium bromide, M: 100 bp DNA ladder. Lanes: AFl1, AFl2, AFl3, AFl4, AFl5, AFl6, AFl7, AFl8, AFl9, AFl10, AFl11, AFl12, AFl13, AFl14, AFl15 PCR product with aflR primer on 1 % agarose gel electrophoresis with ethidium bromide, M: 100 bp DNA ladder. Lanes: AFl1, AFl2, AFl3, AFl4, AFl5, AFl6, AFl7, AFl8, AFl9, AFl10, AFl11, AFl12, AFl13, AFl14, AFl15. Numbers of the produced spores by different isolates. Inoculated rice (left); flask of fermented rice (right): allowed to stand for 6 days with shaking by hand once a day Comparison between different isolates (isolate origin) in concentration AFB1 in HPLC. Morphology of MNC isolated by the gradient centrifugation, which cultured in DMEM revealed by inverted microscope. (A) Maximized appearance of the cells 24 hours after cultivation. (B) Appearance of the cells one week after the cultivation, where several cells began to attach together and forming many clusters (arrows). (C) Maximized appearance of cluster of cells, which revealed attachment of round cells. (D) Maximized appearance of the cells 2 weeks after cultivation. Inhibition rate of MNC exposed to AF, which measured via cytotoxicity assay.
77
79
82 87 89
95
98
X
List of abbreviations Abbreviate
Complete Item
AFB1
Aflatoxin B1
AFB2
Aflatoxin B2
AFG1
Aflatoxin G1
AFG2
Aflatoxin G2
aflD
A structural gene in aflatoxin B1 biosynthesis genes cluster
aflM
A structural gene in aflatoxin B1 biosynthesis genes cluster
AFLP
Amplified Fragment Length Polymorphisms
aflR
Aflatoxin Regulatory Gene
AFM1
Aflatoxin M1
AFM2
Aflatoxin M2
AFs
Aflatoxins
AOAC
Association Official Analytical Chemists
ASCs
Adult stem cells
Bp
Base pair
C18
Chromatography Colum
CFU
Colony Forming Unite
DAD
diode array detector
DMEM
Dulbecco’s Modified Eagle’s Medium
DMSO
Dimethyl sulphoxide
dNTPs
2.-Deoxynucleoside-5´-triphosphate
ELISA
Enzyme Linked Immune Sorbent Assay
ESCs
Embryonic stem cells
ESCs
Embryonic stem cells
FCS
fetal calf serum
FLD
Fluorescent detector
FLD
fluorescent detector
II GVHD
graft-versus-host disease
HCC
Hepatocellular Carcinoma
HLA
Human leukocyte antigen
HPLC
High Performance Liquid Chromatography
HSCs
Hematopoietic stem cells
IL-10
Interleukin-10
Kb
Kilo base = 10³ bp
MNCs
mononuclear cells
MTT
[3-(4,5-Dimethylthiazol-2-yl)-2,5 diphenyl
Ng
Nanogram
OD
Optical Density
PBS
Phosphate buffer saline
PBSCs Rf RNA RNase
Peripheral blood stem cells Retention Factor Ribose Nucleic Acid Ribonuclease
RP-HPLC
Reversed phase (HPLC)
RT iq-PCR
Real-time immunoquantitative PCR
SDA
Sabouraud Dextrose Agar
SDA
Sabouraud Dextrose Agar
TBE
Tris-borate-EDTA
TGF
Transforming the growth factor
UV UCB
Ultraviolet Umblical cord blood
Introduction
4
1. Introduction Mycotoxins are secondary metabolites produced by a number of fungal species, which are toxic to humans, animals, and plants. If they are ingested, inhaled or absorbed by the skin, they may cause different serious diseases and even death (Ismaiel and Papenbrock, 2015). It is thought that the reason for toxin production is a response to the stress factors that are faced by the fungus, thus it is considered stable chemical material (Whitlow and Hagler, 2016). When the grains that infected with toxic fungi were exposed to grinding and a high temperature and dehydration, the fungi that carried out by the grains will be eliminated without disrupting the toxins (Doolotkeldieva, 2010). The big rates of mycotoxins in grains and the resistance character that exist in these compounds make them significant health problems in the human's life (Góral et al., 2015). Aflatoxins (AFs) are a group of mycotoxins causing dangerous health problems to humans and animals when exposed to AFs directly by ingestion of contaminated foods or indirectly by consumption of foods derived from animals previously exposed to AFs through their food (Hammami et al., 2014), AFs are highly toxic secondary metabolites that are produced by Aspergillus flavus and A. parasiticus species of fungi, which have toxic effects on nuts and grain crops (Eshetu et al., 2016). The biosynthetic pathway of aflatoxin in A. flavus and A. parasiticus are similar and well characterized (Moubasher et al., 2016). The AFs have a high acute toxicity as well as congenital malformation, immunosuppression, as mutants, and teratogenicity (Monson et al., 2015). These compounds consider as substances that cause of cancers and this group is classified by the international agency for research on cancer (IARC) as a carcinogenic group and undoubtedly the best known and most intensively researched mycotoxins in the world (Jardon- Xicotencatl et al., 2015). The most common aflatoxins are B1, B2, G1 and G2 that are naturally present in many food products, and M1 and M2 are found in milk, dairy products, eggs, meat, and urine (Nisa et al., 2016). Aflatoxin B1 (AFB1) was the
Introduction
0
most potent toxin (carcinogenic compound) among different types of AFs (Montaseri et al., 2014). There is a great need to study the different isolates of A. flavus which produce mycotoxins such as aflatoxin in foods. Although knowledge about the level of aflatoxin in foods is important, identifying the fungal isolates responsible for the toxin is a better approach in solving aflatoxin-related food poisoning. Many technologies are used to detect the presence of AFs; some of these techniques include High-Performance Liquid Chromatography (HPLC), coupled with ultraviolet (UV) and liquid chromatography-mass spectrometry (LC-MS) (Shephard et al., 2012). Detection of genes responsible for AF production is an important issue in food safety fields (Mo et al., 2013) because most times the pathogenic fungi showed a marked contrast even among the isolates that belong to the same type (Champer et al., 2016). That is why it has been resourced to the utilization of the molecular techniques that depend on studying the DNA basis sequences which can't be identified by following the traditional methods of examination or isolation (Levin, 2012). Aflatoxin is of major concern especially countries where agricultural practices were not strictly controlled, human and animal exposure to mycotoxins is very high (Pugazhendhi et al., 2015). Attention is only paid to meet export criteria while the effects of aflatoxin on the health of the local consumers are not prioritized. The contamination of foods with aflatoxin has in recent times created a great alarm on food security especially in developing countries including Iraq (Cotty and Mellon, 2006; Saadullah and Abdullah, 2014). In spite of the limited use of the modern molecular techniques in the third world countries, the best diagnostic technique is polymerase chain reaction (PCR) which has efficient high speed in the detection of Aspergillus spp genes in the contaminated grain samples (Yu et al., 2004; Amare and Keller, 2014). In Iraq, ground nut, maize, other cereals and legumes are sold in the open market with less or no regulation of quality. Most of the contaminated foods find
Introduction
3
their way into households and restaurants and patronized by unsuspecting consumers. The assessment of the levels of aflatoxin in food crops and the identification of fungi responsible for their contamination will inform policymakers to improve upon proper handling to reduce the toxin in foods. Moreover, that all previous studies on effects of AF on mononuclear cells (especially the lymphocytes) are interested in their effects on the mature cells (in vivo), while there is no study of their toxic effects on precursors of lymphocytes (stem cells) which were isolated from umbilical cord blood (in vitro), as well as on the genes responsible for the production of AFs. According to our knowledge, there are rare or no studies in this field so this study aimed to used PCR as a cut-off diagnostic tool for differentiation of AF-producing isolates in addition to molecular screening and expression for AF encoding genes (ver 1, nor1 and aflR), through following steps:1. Isolate and identify of A.flavus in contaminated food and characterization of these isolates using traditional phenotypic methods involving culture. 2. Differentiate between aflatoxigenic and non-aflatoxigenic isolates of the above fungus in addition to molecular expression for aflatoxin encoding genes (aflM ver-1, aflD and aflR). 3. Detect of AFB1 level production by A. flavus by using HPLC technique. 4. Determine the capability of different isolates of A. flavus for the production of AFB1. 5. Study the toxic effect of AF on the Hematopoietic Stem Cells and detection of its toxic dose.
Literature Review
1
2. Literature Review 2.1 Mycotoxin Mycotoxin is a term derived from the Greek word "Mykes" which means fungus, while the second part is derived from the Greek word "Toxicum" which means toxin (Sm et al., 2016). Mycotoxin feature is regarded as natural product with low molecular weight and product as well as secondary metabolic by some filamentous fungi (Garda and Badiale, 2010). It is estimated 300 to 400 compounds and recognized as mycotoxins which are placed within regular groups including AFs, Ochratoxins, T-2 toxin, Citrinin, Trichothecenes and Zearalenone ( Hedayati et al., 2010). Mycotoxins were classified according to the organ affected as Hepatotoxins (toxins affect the liver), Nephrotoxins (toxins affect the kidneys) and Neurotoxins (toxins affect the nervous system) and so on, while according to the resultant cellular damage, the toxins are classified as mutagens factors and carcinogens (Bbosa et al., 2013). The chemists have classified them on the basis of chemical composition, and the mycologist classified toxins on the fungi which produced them, such as Aspergillus toxins and Penicillium toxins (Zain, 2011). Mycotoxins lead to many toxic disasters during certain periods in countries around the world. In 1934 it recorded the case of the destruction of more than 5,000 horses in the Middle East as a result of the contaminated corn grain consumption (Luis and Botana, 2015).
2.2 Aflatoxins Fadl-Allah and his colleagues (2011) mentioned that all the derived AFs are from the compound difuranocoumarin which consists of two molecules of bis-furan and merged with a molecule of coumarin. All of them have a similar spatial isomerism form which appears as heterocyclic compounds which contain a lot of oxygen atoms (Zhang et al., 2014). The naming of AF goes back to the species A. flavus that contains this toxin. The letter "A" refers to genus name,
5
Literature Review
and the part "fla" refers to the species name (A+fla+toxin) (Zain, 2011; Ramamurthy et al., 2016). The AF is produced as a secondary metabolite by A.flavus, A.parasiticus, A.bombycis, A.ochraceoroseus, A.nomius and A. pseudotamari, but the species A.flavus is one of the most types found in food (Mejía et al., 2011). Safara and his colleagues (2010) stated that there are about 20 different types of AFs, but the most important types are B1, B2, G1, G2, M1, and M2. The first four types are found naturally in food that is badly stored such as wheat, rice, and sesame, peanut and finally black and red pepper.
2.3 History of Aflatoxin Since 1960, the AFs has been recognized as a significant contaminant in agriculture, where in this year they were initially isolated (Kensler et al., 2011). It is known as the causative agent in Turkey X disease, hence more than 100,000 turkeys in England, USA and Brazil died (Bhat et al., 2010). It is recognized as the cause deaths of large numbers of turkey poults and ducklings in British farms from an acute liver necrosis and hyperplasia of the bile duct (Strosnider et al., 2006). Studies carried out in the 1960 concerning the nature of the contaminant of the peanut meal indicated that it might be of fungal origin (Bridge, 2009). A careful survey of the early outbreak reveals that the peanut meal is highly toxic. During analyzing peanut meal, four types of dots appear on the boards, and when illuminated with an ultraviolet light, they emit blue light and green light (Bezabih and Tamir, 2013). Indeed, the toxin-producing fungus was identified as A. flavus in1961 and the toxin was named aflatoxin after its origin (A. favus
Afla) (Craufurd et al.,
2006). Inevitably this discovery led to a growing awareness of the potential risks associated with these substances when present in feed and food. Apparition of AF contaminated foods and food products vary with geographic location, agricultural and agronomic practices (Cotty and Mellon, 2006). The
Literature Review
1
susceptibility of food product to fungal attack increases of during pre-harvest, transportation, storage and processing of the foods. AF contamination of food products is a common problem in tropical and subtropical regions of the world especially in the developing countries such as those in Sub-Saharan Africa, with poor agricultural practices and where the environmental conditions of warm temperatures and humidity favor the growth of fungi (Dhanasekaran, 2011). The various food products contaminated with AFs include cereals such as maize, sorghum, pearl millet, rice and wheat, oilseeds like groundnut, soybean and sunflower, also spices such as chilies, black pepper, coriander, turmeric and zinger; tree nuts such as almonds, pistachio, walnuts and coconut; and milk and milk products (Armson et al., 2015).
2.4 Aspergillus genera and species 2.4.1 Taxonomic characteristics: Raper and Fennell (1965) classified the genus of Aspergillus which lies within the family of Trichocomaceae as part of the Eurotiales order and called also Plectoscales. Most of these fungi reproduce asexually only (Samson, et al., 2014), but there are some species which reproduce sexually as behavior of Ascomycetes, by forming a regular ascospores inside asci bags and the last are embedded within the globules fruit bodies (Cleistothecium) of these fungi (Bridge, 2009). The fungus Aspergillus colonies appear in different colors which vary depending on the color of conidia: white, yellow, gray, green, pink, blue, brown and yellowish or black )Guchi et al., 2014(. The mycelium is characterized by its profuse growth, its branched and divided internally into cells, each cell contains numbers of nuclei surrounded by the cytoplasm and there is a stock of food inside the cell in the form of oiliness granules (Diba et al., 2007). The mycelium is categorized according to its colors to white, green, black or yellow mycelia (Wahyuni et al., 2013).
Literature Review
7
Conidiophore arises vertically from the foot cell in the vegetative mycelium, conidiophore is usually unbranched, often is divided, and colorless in all kinds of pathogenic Aspergillus. It may contain few types of barriers in rare cases )Munster et al., 2013; Krijgsheld et al., 2013(. In most species, the wall of the conidiophore is thicker than the wall of fungal hypha, and it is conidiophore smooth in most types of pathogen, except A.flavus, A.oryzae and A.avenaceus, which produce rough conidiophore (Pitt and Hocking, 2009), and the conidiophores summit widens to be vesicles, which are spherical, semi-spherical, elliptic shape or clavate arises from their surface compositions to form Phialides which are arranged in either one or two rows (Afzal et al., 2013). Phialides compositions ranging from the length of between 20-30 µm and a thickness of 5-10 µm, a single or multiple nuclei, arises when conidia summit basipetal a series which are the oldest in the summit and the latest in the base (Nyongesa et al., 2015). Conidia may be smooth, as in A. terreus or thorns as in A. niger. Most of the genus Aspergillus species conidia is the spherical shape, obtrusive waterproof too, carrying it air easily after maturity, and colors differ from dark to light (Röhrig et al., 2013). A few species of the genus Aspergillus produced in the sexual phase fruit bodies and these fruiting bodies vary in size and color from one species to another, fruit body consists of a thin layer of cells that are usually flat, and this layer is called the fruit body's wall, it has inside a lot of sporocysts, each sac contains eight cystic ascospores (Manuscript and Syndromes, 2010). The hyphae contain Hülle cells that are specialized formations of unknown function that take a terminal or internal location within the hyphae, and they have a spherical shape, nearly spherical to pear, elongated or spiral shape (Bayram et al., 2012).
Literature Review
8
2.4.2 Diagnostic characteristics of the species A.flavus The colonies of the fungus grow rapidly on sabouraud agar and malt extract agar and they would be green yellowish, velvet or smooth girded conidial heads, radial or vertical disjointed relatively vary in specifications from one isolation to another (Kumar, 2016). Some isolates produce white stoned bodies or dark brown to black whose diameter ranges between 400-700 micrometers (Trends and Prospects, 2016). The conidiophores shall be a transparent tapering, thick walls, ranging in length between 1000-2500 µm, and between 10-20 µm in thickness, ending with oval or spherical vesicle with diameter of 10-65 µm, phialide assemblages are covering the entire surface, and in some isolates phialides assemblages are cover only three-quarters the surface of the vesicle. It notes the existence of a single row of phials assemblage in the modern vesicles and they are doubled with the progress of the age of the vesicle, these phialides assemblages bear spiky conidia with a spherical or oval shape (Afzal et al., 2013; Melorose et al., 2015). 2.4.3 Identification and characterization of A. flavus Aspergillus flavus belongs to the same genus Aspergillus in the fungi world differing only at the species level as shown in table 2.1 (Fakruddin et al., 2015) Table 2.1. Classification of Aspergillus flavus Kingdom
Fungi
Phylum
Ascomycota
Subphylum
Pezizomycotina
Class
Eurotiomycetes
Order
Eurotiales
Family
Trichocomaceae
Genus
Aspergillus
Species
Flavus
Aspergillus flavus colonies are commonly powdery masses of yellowgreen spores on the upper surface and reddish-gold on the lower surface
9
Literature Review
(underneath), growth is rapid and colonies appear downy or powdery in texture, hyphal growth usually occurs by thread-like branching and produces mycelium. Hyphae are septate and hyaline, once established, the mycelium secretes degradative enzymes or proteins which can break down complex nutrients (food) (Quinn et al., 2013; Guchi, 2015). Individual hyphae strands are not typically seen by the unaided eye. However, conidia producing thick mycelial mats are often seen, the conidiospores are asexual spores produced by A.flavus during reproduction the conidiophores of A. flavus which are rough and colorless. Phialides are both uniseriate (arranged in one row) and biseriate (Bridge, 2009). Aspergillus flavus is the most notorious species which lead to the contamination of food crops and feeds, A. flavus produces AFB1 and B2, in addition to many other metabolites such as indole-diterpenes, aflatrem, paxillenes, paspalicines, and aflavinines (Jiujiang et al.,
2012).
Studies
indicated that these secondary metabolites could have neurotoxic and nephrotoxic effects on animals and humans as well as growth retardation, immune suppression, and liver damage (Ehrlich, 2014). Although A. flavus has been considered to be strictly asexual and lacks the ability to undergo meiosis (Olarte et al., 2012), a recent study by Horn et al (2009) revealed that sexual reproduction of A. flavus occurs between compatible sex strains that belong to different Vegetative compatibility Group (VCG). They can be easily differentiated phenotypically and genotypically by expert scrutiny aside from being separated by their morphology, mycotoxins profile and molecular characters (Huang et al., 2011). They cause the same disease known as aspergillosis and produce AFs (Patterson, 2009).
Literature Review
42
The knowledge of vegetative compatibility groups between different lineages is of particular interest in asexual fungi. Since the VCGs subdivide the population into groups that can exchange genetic information via heterokaryosis and the parasexual cycle (Walsh et al., 2008). Fungi lineages that are capable of anastomosis (fusing) and forming stable and functional heterokaryons (multinucleate cell that contains genetically different nuclei) are known as sexually or vegetative compatibility group – VCG (Yan et al., 2012). Aspergillus flavus is a major producer of AF and an opportunistic pathogen for a wide range of hosts. Understanding genotypic and phenotypic variation within strains of A.flavus is important for controlling disease and reducing AF contamination (Brou et al., 2015). Moreover, the aflatoxin biosynthetic pathway is well delineated by Levin, (2012) through of several genes involved in the synthesis of aflatoxin. Two of genes are the aflR and aflD from A. flavus which are involved in regulation of transcription pathway for aflatoxin genes.
2.4.4 Diseases caused by the Aspergillus sp. Aspergillus spp. has an importance in three different clinical caseses in human that include opportunistic infections, allergy and toxicity cases (Arvanitis et al., 2014). The infections appear as opportunistic skin infections such as cutaneous aspergillosis, ear infection (otomycosis), fungal pneumonia such as pulmonary aspergillosis, meningitis and other infections (Manisha and Panwar, 2012). Some species of the genus Aspergillus spp. produce different mycotoxins that have carcinogenic effects in several organs of animals (Hymery et al., 2014). AFs cause liver cell cancer and this toxin were produced by the fungus A.flavus in lots of crops such as peanuts (Wu, 2015). Aspergillus expose immense ecological and metabolic differences (Perrone et al., 2014). Aspergillus is a filamentous, cosmopolitan and ubiquitous fungus found in nature. It is commonly isolated from soil, plant or animal debris and
Literature Review
44
indoor air environment (Geiser, 2009). While a teleomorphic state has been described only for some of the Aspergillus species, others are accepted to be mitosporic, without any known sexual spore production (Iheanacho, 2012). The genus Aspergillus includes over 185 species. Around 20 species have so far been reported as causative agents of opportunistic infections in human (Dagenais and Keller, 2009). Among these, A. fumigatus is the most commonly isolated species, followed by A. flavus, A. paraciticus, A. niger, A. clavatus and A. glaucus group are among the other species less commonly isolated as opportunistic pathogens (Quinn et al., 2013)
2.5 Aflatoxin producing – Aspergillus Mycotoxins are a large group of toxic chemicals produced in a process of secondary metabolism of various species of Aspergillus. These compounds contaminate commodities and products on which the molds grow, such as raw materials and food intended for human consumption, as well as animal feed and environmental samples (Arasimowicz et al., 2016). Aspergillus is a large genus composed of more than 185 accepted anamorphic species, with teleomorphs described in 9 different genera. The genus is subdivided into 7 subgenera, which in turn are further divided into sections (Devi et al., 2013). AFs are mainly produced by Aspergillus genus as represented in table 2.2. This genus can grow as soon as enough water and nutrients are available in its environment (Lakshmi and Gupta, 2008). The non-aflatoxigenic species such as A. oryzae which is genetically indistinct from A. flavus. A. oryzae is used as a starter culture for the preparation of fermented foods and alcoholic beverages and is an important source of many enzymes, such as glucoamylase, alphaamylases and proteases which are used for starch processing, baking and brewing worldwide (Machida et al., 2008). A. sojae and A. tamarii are traditionally used for production of fermented foods in Asia (Hong et al., 2015). Aspergillus flavus was known to be producing only AFB1 and AFB2, while A. paraciticus produced AFB1, AFB2, AFG1 and AFG2, with some
40
Literature Review
recent studies (Midorikawa et al., 2008; Pratiwi et al., 2015). Other fungi belonging to the Aspergillus genera have been found to produce AFs (Pitt and Hocking, 2009) but they both have different aflatoxigenic profile (El Khoury et al., 2011) based on DNA (nor1) sequence and AFLP fingerprint analyses (Rodrigue et al., 2012) Table 2.2. Taxonomy of some Aspergillus species with the type of aflatoxin Fungi
AFs produced
References
A .flavus
B and G
(Schmid et al., 2010)
A. parasiticus
B and G
(Levin, 2012)
A. nomius
B and G
(Yan et al., 2012)
A. bombycis
B and G
(Probst et al., 2014)
A. Ochraceoroseus
B and G
(Guchi et al., 2014)
A. australis
B and G
(Cary et al., 2012)
A. pseudotamarii
B
(Baranyi et al., 2013a)
2.6 Aflatoxin AFs produced, at most, by the genus Aspergillus. They are a group of chemically diverse fungal metabolites which grow and feed naturally in foodstuffs and they are considered secondary metabolites that are closely related heterocyclic compounds (Fakruddin et al.,2015). Aflatoxins may contaminate a wide range of agricultural commodities and foodstuffs in most different phases of production and processing, from cultivation to transport and storage ( Mohd-Redzwan et al., 2013) as the fungus grows in the over a thermal broad range between 10 – 50 ºC (Dagenais and Keller, 2009). The rise of the moisture in grain, principally at the beginning of the storage to be encourages for their growth, as it is found that the fungus produces AFs in two days at temperature 25 ºC and the moisture content in the grain 30% and in ten days when the temperature of 21 ºC and humidity of grains 20% (Zain, 2011). AFs may persist in the foodstuff even after fungi were removed by common industrialization and packaging processes because of high chemical stability (Mohd-Redzwan et al., 2013). There are six major and
Literature Review
43
common compounds of AF such as AFB1 (C17H12O6), AFB2 (C17H14O6), AFG1, AFG2, AFM1and AFM2 )Gong et al., 2016(. Aflatoxins which are produced by A.flavus metabolism is one of the compounds that are found in the mycotoxin group, the major types of AFs are AFB1, AFB2, AFG1 and AFG2. Many dangerous biological effects can be caused by AF when it is consumed regularly at high levels. Some of these effects are protein synthesis inhibition, enzyme induction inhibition, inhibition of lipid synthesis and transport, immunosuppression, fatty degeneration and liver cancer (Britzi et al., 2013). The B and G refer to the blue and green fluorescent colors, respectively produced under ultraviolet light on thin layer chromatography (TLC) plates, while the subscript numbers 1 and 2 indicate major and minor compounds, respectively according to the migration distances on the plates (Hruska et al., 2014). In 1966, it was observed that the metabolic products from AFM1 and AFM2 have been isolated first from animal milk that fed on rotting grains contaminated with AFs, AFM1 and AFM2 which are the products that are transformed biologically in mammals from AFB1 and AFB2, respectively. They are originally isolated and identified from bovine milk after entering the mammalian body (human or animal). Dietary exposure to AF is among the major Hepatocellular Carcinoma (HCC) risk factors (Shakerardekani et al., 2012). AFB1, which is a genotoxic hepatocarcinogen, which presumptively causes cancer by inducing DNA, adducts leading to genetic changes in target liver cells (Wu and Santella, 2012). AFB1 is metabolized by cytochrome-P450 enzymes to the reactive intermediate AFB1-8, 9 epoxide (AFBO) which binds to liver cell DNA, resulting in DNA adducts (Kew, 2003). DNA adducts interact with the guanine bases of liver cell DNA and cause a mutational effect in the P53 tumor suppressor gene at the codon 249 hotspot in exon 7, which may lead to HCC. Approximately 4.5
Literature Review
41
billion of the world's population is exposed to aflatoxin-contaminated food, particularly in low-income countries (Hamid et al., 2013; Hernandez et al., 2015). 2.6.1 Chemical Structure of Aflatoxins The skeleton of AFB1 is the structural analogue of all the other types of AFs. AFB1, AFG1 and AFM1 differ from AFB2, AFG2 and AFM2 respectively by the double bond at the phenol on the far left (Figure 2.1) (Jallow, 2015).
Figure 2.1. Chemical structures of aflatoxin B1, B2, G1, G2, M1 and M2. (Jallow, 2015)
2.6.2 Properties of Aflatoxins Aflatoxin is colorless, odorless and tasteless and thus very difficult to detect since very minute quantities are toxic and cannot be seen by the naked eye, hence laboratory testing is the only required method for assurance (Jallow, 2015). However, certain indicators for mold growth, on crops or grains like severe rotten, discolored, unusual or offensive smell or taste can give a high suspicion of contamination (Ramesh et al., 2013) (Table 2.3).
45
Literature Review Table 2.3. Properties of aflatoxins PROPERTY
AFBI
AFB2
AFG1
Molecular formula
C17H12O6
C17H14O6
C17H12O7
C17H14O7
Molecular weight
312
314
328
330
Crystals
Pale yellow
Pale yellow
Colorless
Colorless
Melting point (°C )
268-269 (D)
287-289 (D)
Fluorescence under UV light
Blue
Blue
Solubility
Soluble in water and polar organic solvent. Normal solvent Methanol, water: acetonitrile (9:1), trifluoroacetic acid, Methanol: 0.1 N HCl (4:1), DMSO and acetone
244-249 (D) Green
AFG2
237.40 230 SA Green
D = Decomposition (Jallow, 2015).
2.6.3 Biosynthesis of Aflatoxin Aflatoxins
are bisfurans
that
are polyketide-derived, toxic, and
carcinogenic secondary metabolites produced by some fungi growing on corn, peanuts, cotton seed, and tree nuts (Roze et al., 2015). While biosynthesis of these toxins has been extensively studied in vitro, much less is known about what causes the fungi to produce AFs under certain environmental conditions and only on certain plants. It is not yet known why wheat, soybean, and sorghum are resistant to AF contamination in the field whereas, under laboratory conditions A. flavus is able to colonize these plant tissues and produce AFs (Reverberi et al., 2012). AF and most secondary metabolites are hydrophobic organic compounds. Therefore compartmentalization of hydrophobic substrates has been seen as a common feature of secondary metabolite production (Jallow, 2015). Evidence has been obtained that the enzymes involved in AF biosynthesis are organized into a specialized peroxisomal vesicle where different oxidative steps occur after formation of the polyketide. In general, the metabolism or biotransformation of xenobiotics (chemicals foreign to the organism) is a process aimed at converting the original molecules into more
Literature Review
41
hydrophilic compounds readily excretable in the urine (by the kidney) or in the bile (by the liver) (Murcia, 2011). Santiago (2012) mentioned that in the last two decades there were major biochemical steps and genetic components for biosynthesis of AF and have been describing the biochemistry and genetics pathway of AF formation as a complicated process involving many levels of transcriptional and posttranscriptional control. The current acceptable AFB1 biosynthetic pathway is as follows:Acetate → polyketide → norsolorinic acid (NOR) →averantin (AVN) → Hydroxyaverantin (HAVN) → averufin → hyroxyversiocolorone → versiconal hemiacetal acetate → versiconal → versicolorin B → versicolorin A → dimethyl- sterigmatocystin → sterigmatocystin → Omethylsterigmatocystin → AFB1 (Probst et al., 2014).
2.7 Factors favoring aflatoxigenic fungal growth and aflatoxin production. Fungal growth and aflatoxin contamination are the consequence of interactions among the fungus, the host and the environment (Sun et al., 2016). The appropriate combinations of these factors determine the infestation and colonization of the substrate, and the type and amount of aflatoxin produced. A suitable substrate. However, required for fungal growth and subsequent toxin production, and although the precise factors that initiate toxin formation are not well understood (Grubisha and Cotty, 2010). Aflatoxin is formed as a result of fungal growth in agricultural commodities. Once formed, they are extremely stable and persist long after the fungi have been eliminated and the contaminated commodity remains toxic and injurious to those who consume it (Milani, 2013). The toxins are produced under specific conditions compared to those required for normal fungal growth (Arapcheska et al., 2015). Similarly, specific crop growth stages, poor fertility, high crop densities, and weed competition have been associated with increased
Literature Review
47
mold growth and toxin production (Brown et al., 2013). Strains of fungal communities associated with crops heavily influence the severity of aflatoxin contamination (Atanda et al., 2011). The contamination process is complex and may start in the field where crops first become infected by Aspergilli that reside in the soil and on decaying plant residues. 2.7.1 Physical factors affecting aflatoxin production Insect damage and plant physiological stress create a favorable environment for fungal growth, off-seasonal rains at harvest periods and dense plant population also increase susceptibility of crops to Aspergillus spp infections (Kebede et al., 2012). Chances of contamination may still continue even after crop maturation and harvest and when the crop is exposed to high humidity both in the field and during storage (Ehrlich, 2014). It was also observed that storage of the grain after heavy rains increased the chance of spoilage (Pratiwi et al., 2015) In order for Aspergillus spp to grow, a relative humidity of about 80% is required (Guchi, 2015).In an experiment conducted by Safara et al. (2010) and Lee et al. (2014) to study the growth of fungus A. flavus on rice grain, it has been found that relative humidity at a level of 100% and 80% is the best level for the invasion all grain of rices. In a similar study conducted by Pereyra et al. (2013) about the effect of pH level on the rate of AFB1 production in corn, they found out that the level of pH ranging between 2-3 completely inhibits the production of the toxin, as for the pH level ranging between 3-7 increases the production of the AFB1. This view is also supported by Guan et al. (2008) who stated that A. flavus was more tolerant to alkaline than acidic conditions. While the AF grows at a temperature of more than 27 °C, the change in the temperature range between 24-28°C leads to increase production of AF (Mousa et al., 2013).
Literature Review
48
2.7.2 Chemical factors affecting aflatoxin production There are many studies showing the use of chemicals for AF reduction, which include acids and alkaline, gases and oxidation factors. JardonXicotencatl et al. (2015) had explained this clearly . Mohamed et al. (2016) indicated that has been some alkaline solutions have the ability to reduce AFB1 in rice. It has been found that the ammonia solution has the ability to breaks down the AF to a lesser from sodium hypochlorite NaClO and sodium hydroxide NaOH (Shcherbakova et al., 2015). Although the citric acid ability to reductase AFB1 and AFB2 in citrus fruits. This capability increases the reductase with increasing it concentration (Zhang et al., 2014). The phenolic compounds acetosyringone, syringaldehyde and sinapinic acid inhibited the biosynthesis of AF product by A. flavus. Acetosyringone was the most active among the three compounds, inhibiting aflatoxin level by 96 % at a concentration of 4 mg /ml on the media culture of PDA. The studies suggested that at least one step early in the AFB biosynthetic pathway is inhibited by the phenolics (Alpsoy, 2010). 2.7.3 Biological factors affecting aflatoxin production Matumba et al. (2014) mentioned that numerous microbes have been considered as biological pest agents and can serve as a determinant for fungal attack and colonization of agricultural produces. A large number of the substrate can influence fungal growth (Chang et al., 2004). However, the nutrients required for growth must already be present in the growth medium. This points out that competitive microorganisms and effects on the production of the AF are influenced by lowering the pH of the medium or by producing the inhibitory metabolites (Dohnal et al., 2014). Insects, rodents, water and wind can serve as vectors for aflatoxigenic fungal colonization of feed (Chaudhary and Chaudhary, 2012). Muñoz and associates, (2010) have found that Lactobacillus plantarum bacteria have the ability to reduce 77 % of the AFB1, as well as this type of
Literature Review
49
bacteria surrounds the A. flavus spores, which impede their growth completely (Deepthi et al., 2016).
2.8 Analytical methods for the detection of aflatoxins Because of the low permissible limits for AFs and the associated high toxicity impacting human and animal health, the analytical methods for determination of AFs need to be sensitive, specific and able to quantify trace levels aiming to achieve safety and security of animal feeds and foodstuffs and preventing the associated trade losses, the food and feed industry is in constant pursuit of rapid and reliable methods for detection and quantification of AFs from the methods which are used to distinguish between toxigenic and nontoxigenic isolates of A. flavus (Mylroie et al., 2016). They are as follows: 2.8.1 Molecular Analysis Using Polymerase Chain Reaction (PCR) A biochemical technology in molecular biology is to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence which has been developed in 1983 by Kary Mullis (Joshi, 2010). These techniques include DNA cloning for sequencing, DNA-based phylogeny, or functional analysis of genes, the diagnosis of hereditary diseases and Identification of genetic fingerprints (used in forensic sciences and paternity testing) and the detection and diagnosis of infectious diseases. In 1993, Mullis was awarded the Nobel Prize in Chemistry along with Michael Smith for his work on PCR (Monitor, 2014). The application has been of molecular techniques on a large scale to distinguish aflatoxigenic and non-aflatoxigenic fungus of A. flavus and related species, through the link between the presence / absence of one or several genes which have a role in sucrose AF path and the ability / inability to production AF (Donner et al., 2010). Recently, DNA-based detection systems were introduced as a powerful tool for the detection and identification of aflatoxigenic fungi (Rouhani and Chang, 2014). The PCR is the preferred method for this purpose.
02
Literature Review 2.8.1.1 Aflatoxin genes used for PCR amplification
Norsolorinic acid reductase has been encoded by the nor 1 gene, so the conversion of the norsolorinic acid to averantin is accomplished by the same gene (Gueye et al., 2011). Additionally to that, the ver 1 gene encodes versicolorin a dehydrogenase, and converts versicolorin A to sterigmatocystin. The omt-1 gene has the ability to encode sterigmatocystin omethyltr transferase (Calvo
and
Cary,
2015)
demethylsterigmatocystin
and
and
is
required
dihydrogen
for
the
conversion
methylsterigmatocystin
of to
sterigmatocystin and dihydrosterigmatocystin respectively (Levin, 2012). Regulating AF biosynthesis is performed by controlling the expression of the nor 1 and ver 1 genes (Carter and Magan, 2010). The gene aflR in A.flavus represents apar in A. parasiticus and these two genes appear to be homologous (Šošo et al., 2014). There is evidence for an antisense transcript (aflRas) derived from the opposite strand of aflR, suggesting that the aflR locus involves some form of antisense regulation (Levin, 2012). El-Khoury et al., (2011) studied the role of the regulatory gene aflR and its product aflR, in the biosynthesis of AF in Aspergillus species and revealed Western Blot and Enzyme Linked Immune Sorbent Assay (ELISA) assays analyses revealed that aflatoxin B1 accumulation was directly related to aflR (Besaratinia et al., 2016) and was regulated by various environmental and nutritional conditions, including temperature, nitrogen source, air supply, a source of carbon and the availability of zinc (Yang et al., 2016; Besaratinia et al., 2016). 2.8.1.2 Aflatoxin biosynthetic pathway and genes involved Attempts to decipher the aflatoxin biosynthetic pathway began shortly after the determination of the structure of these toxins (Klejnstrup et al., 2012; Townsend, 2015; Yahyaraeyat et al., 2013). The discovery of a colored mutant in A. flavus that accumulates norsolorinic acid (NOR) (Rashid et al., 2009; Hanano et al., 2015) which paved the road for the establishment of aflatoxin
Literature Review
04
biosynthetic pathway. With the rapid gene cloning and enzyme characterization, the enzymatic steps for biosynthesis of the 15 structurally defined aflatoxin pathway intermediates have been identified (Schmidt-heydt et al., 2010). There are estimated to be 27 enzymatic steps in the aflatoxin biosynthesis (Moubasher et al., 2016). As many as 30 genes are potentially involved in aflatoxin biosynthesis (Figure 2.2). The genes and corresponding enzymes have been extensively studied (Gallo et al., 2012). In A. flavus and A. parasiticus the aflatoxin pathway genes are clustered within a 75-kb region of the fungal genome on chromosome III roughly 80 kb away from telomere (Chang et al., 2009).
2.8.1.3 Norsolorinic acid (NOR) to averantin (AVN) Nor1 (aflD) are involved in the conversion of NOR to AVN by use of NOR-accumulating mutants, it was demonstrated by Abdel-Hadi et al., (2011b) in A. flavus, that NOR is an intermediate in the aflatoxin biosynthetic pathway. It was found that the NOR-accumulating mutants are always leaky and that aflatoxin biosynthesis is not completely blocked. NOR is converted to AVN by a reductase /dehydrogenase enzyme, this reaction is reversible depending on NADP (H) or NAD (H) (Baranyi et al., 2013b). The cloning of the nor 1 gene complemented the NOR accumulating mutant of A. flavus, It was demonstrated that this gene encodes a ketoreductase that was capable of converting NOR to AVN (Yu, 2012). Cloned another possible allele of the NOR reductase gene, norA, which had about 70% homology to aryl-alcohol dehydrogenases. The norA gene may be involved in the conversion of NOR to AVN (Yu et al., 2004). However, the deletion of allele norA does not weaken the ability to turn NOR to AVN. This might be due to the presence of aflD (nor 1), aflE2 (norA2), and other NOR reductase genes in the genome (Chang and Ehrlich, 2010). The norA gene had no significant homology to the nor 1 gene at either the DNA or amino acid level (Ehrlich et al., 2008). An additional gene, norB, was
Literature Review
00
identified in the aflatoxin gene cluster and was found to have no significant homology at the DNA level to either nor 1 or norA (Adhikari et al., 2016). However, the homology with norA protein at the amino acids level was high and it reached about 68%. Attempts to delete the norA gene have failed to generate mutants that lack the production of AF (Mauro et al., 2013).
2.8.1.4 Aflatoxin regulatory gene aflR The aflR a group of genes responsible for the biosynthesis of AF has been discovered in 2005 and the factors affecting its production have been studied (Yu et al., 2004). The aflR genes play a significant role in the biosynthesis pathway of AF by regulating the activity of other structural genes (Al-saad et al., 2016). The genes responsible for producing the secondary metabolites are usually clustering in one place in fungus and the production of AFs requires two types of proteins, aflR is one of them which is encoded by AF genes group (Chettri et al., 2015). The biosynthesis pathway of AF in Aspergillus fungi has been identified and genes responsible for this pathway have been recognized as in Figure 2.2 (Ren et al., 2016). The sequence variability of a region of the aflR gene has been studied in few strains of A.flavus, A.paraciticus, A.oryzae and A.sojae. However, these studies haven't achieved a high degree of differentiation for Aspergillus section of flavi strains (Godet, 2010). And that aflR is the main regulatory gene for the process of AF production (Gallo et al., 2012). Studies have proved that the aflR2 gene is the regulator for AFs biosynthesis process. Previous studies have shown that aflR protein can be linked to the encoding start region for AF's gene (Hamed et al., 2016). This is how to activate the expression of the aflR gene. The inability of some isolates to produce AF is back to the gene expression failure of the gene aflR and this is associated with the absence or disruption of aflR protein (Obrian et al., 2007). The aflR gene possesses the function of self-regulation and the absence of this gene or the presence of the abnormal gene is an indicator of
Literature Review
03
the lack of AF production by some of these isolates (Gummadidala et al., 2016), as shown in Figure (2.2.). .
Figure 2.2. Aflatoxin cluster in A. flavus. The aflatoxin cluster is composed of approximately 30 different genes and is located near the telomere of chromosome 3.
2.8.2 High Performance Liquid Chromatography (HPLC) High performance liquid chromatography is one of the most common methods which are used in the quantification of AF and it is used for the separation and identification of organic compounds, approximately 80% can be identified using HPLC (Li et al., 2011). Recently becomes the most commonly used chromatographic technique for detection of various metabolites of mycotoxins, particularly for AF and their derivatives (De-Rijk et al., 2011). This device consists of stationary phase and mobile phase. The stationary phase is confined to either a glass or a plastic tube, while the mobile phase consists of aqueous/organic solvents (Taheri et al., 2012). As soon as the samples analyzed load on top of the column, the mobile phase pours through the solid adsorbent, so the sample is distributed between the two phases (Yazdanpanah et al., 2013). The components of this sample which can be separated by this technique depended on the different affinities for the two phases and thus move through the column at different rates, the mobile phase emerging from the column yields
Literature Review
01
separate fractions containing individual components in the sample (Herzallah, 2009(. HPLC system includes the stationary phase such as C-18 chromatography column, a pump that moves the mobile phase and sample components through the column and a detector capable of providing characteristic retention times for the sample components and area counts reflecting the amount of each analyte passing through the detector. The detector may also provide additional information related to the analytic (such as UV/Vis spectroscopic data, if so equipped). The analyzed sample is usually injected right to the stationary phase and it is delivered using high pressure by a pump through mobile phase along the stationary phase. The samples are distributed through the stationary phase (Malviya et al., 2010). The samples can be distributed within the stationary phase depending on chemical and physical interactions between the two phases (Rahmani et al., 2009; Malviya et al., 2010). All of these processes happen within a specific time which is recorded by the detector as its retention time that can be determined depending on the nature of the analyte sample and composition of the two samples (Mousa et al., 2013). The system includes a fluorescent detector (FLD) or the ultraviolet detector (UV) or the diode array detector (DAD) which may be used for the detection and identification of AFs (Brera et al., 2007). The Fluorescence detection use emission of light (435 nm), that have been higher energy levels by absorption of electromagnetic radiation (365 nm) for aflatoxins. These detectors have superior sensitivity than other detector systems; also some samples may have certain components that need to be detected with such sensitivity detector. The best choice for the appropriate detector is highly dependent on the nature of the components of the substance to be tested, Reverse phase HPLC is commonly performed for determination of AFs in foods. The level of aflatoxin is possible to be detected using these techniques at microgram / kg (Wacoo et al., 2014).
Literature Review
05
2.9 Health consequences of Aflatoxin Acute exposure to high levels of AF leads to aflatoxicosis, any diseases caused by AF consumption, which can result in rapid death from liver failure. Evidence of acute aflatoxicosis in humans has been reported worldwide especially in some third world countries such as Taiwan, Uganda, India, Kenya and many others. Chronic primary aflatoxicosis is a result from ingestion of low to moderate levels of AF. The effects are usually subclinical and difficult to recognize. Some of the common symptoms are impaired food conversion and slower rates of growth with or without the production of an overt AF syndrome, (WHO and CDC 2005). The chronic forms of aflatoxicosis include: (1) Teratogenic effects associated with congenital malformations. (2) Mutagenic effects where AFs cause changes (mutations) in the genetic code, altering DNA and leading to chromosomal breaks, rearrangement of chromosome pieces, gain or loss of entire chromosomes, or changes within a gene. (Ezekiel et al., 2011). (3) The carcinogenic effect in which the carcinogenic mechanisms have been identified such as the genotoxic effect where the electrophilic carcinogens alter genes through interaction with DNA and thus becoming a potential for DNA damage. AFs appear to be much more prevalent than previously anticipated, with a large proportion of foods and a high percentage of the population in Africa affected (Oladele, 2014). The adverse effect of chronic exposure of AFs on human health and nutrition has been ignored even though it has serious effects on children's growth. Development of chronic effects of AF has been reported to impair normal body immune function (Jaime-Garcia et al., 2010), either by reducing phagocytic activity or reducing T cell number and function. AFB1, classified as the most toxic of the AFs, is the most potent naturally occurring chemical liver carcinogen known. Specific P450 enzymes in the liver
Literature Review
01
metabolize AF into a reactive oxygen species (aflatoxin-8, 9-epoxide), which may then bind to proteins and cause acute toxicity (aflatoxicosis) to DNA and induce liver cancer (Wild and Gong 2010; Wu and Khlangwiset, 2010). A possible explanation of the transmission rates of AF is suggested by the exposure of human fetuses to maternal AF (Anfossi et al., 2011) and by the fact that AF is also secreted in human mothers milk (Ribeiro et al., 2010). Presences of AF traces were found in sera, maternal intravenous blood, breast milk, and umbilical cords of patients in the maternity wards in The Gambia (Ghaderi et al., 2011). In animals, exposure of the foetus and via milk has been shown to have significant effects on the immune competence of progeny (Liu and Wu, 2010). AFs have been reported to interfere with nutrition in a prescribed amount response relationship between exposure to AF and rate of growth in infants and children (Murugesan et al., 2015) Turner, (2013) detected AF albumin adducts in 93% of sampled children (6-9 years) in the Gambia and proved that effect of AF can diminish immuoglobin A (IgA) in saliva. AF also cause nutrient modification like vitamin A (Shirima et al., 2015), Zinc and Iron shortage in animals and thus making them unavailable for the normal body physiology and hence leads to nutritional deficiencies. AFs have been reported to cause digestive system effects such as diarrhoea, vomiting, intestinal haemorrhage, liver necrosis and fibrosis (Williams, 2011). The contamination of foods and feeds with AF can cause serious consequences in human and animal health.
2.10 The Stem Cells 2.10.1 Definitions of stem cells A stem cell is a cell that has the ability to reproduce itself for long periods or, has its capacity and potential to renew itself in high levels and to generate differentiated cell progenitors of different lineages in simplified conditions of the culture (in vitro) and after transplantation inside the host tissues (in vivo). It
Literature Review
07
also can develop into specialized cells that make up the tissues and organs of the body as an embryonic stem cell (ESCs) ( Liang and Ghaffari 2014; Chen et al., 2015).The term ‗stem cell‘ may be traced to the early botanical monographs documenting the regenerative competence of plant meristems (Nick, 2014). These simple and broad definitions may be satisfactory for embryonic or fetal stem cells. But this definition breaks down in trying to distinguish between transient adult progenitor cells that have a reduced capacity for self-renewal and adult stem cells (Li et al., 2014). It is therefore important when it describes adult stem cells to further restrict this definition to cells that self-renew throughout the lifespan of the animal, and are a reservoir for the substitution of short-lived cells or regeneration of damaged tissues (Ahmed et al., 2015). For example, HSCs are the reservoir for replacing the blood cells and are present in a frequency of 1 in every 10,000 to 100,000 blood cell (Upadhyay, 2015).
2.10.2 Types of stem cells Two types of stem cells have been distinguished according to their origin and potential of differentiation (Madonna, 2016), these types are:
1) Embryonic stem cells (ESCs) Embryonic stem cells (ESCs) are obtained from inner cell mass are pluripotent, which are the abutting cluster of cells forming at the blastula stage (Boroviak et al., 2014). A zygote passes through serial divisions during the embryonic development that happens after fertilization and forming blastocysts which consist of the pluripotent cell population that are able to generate the primitive ectoderm during embryogenesis. More specifically, in normal embryonic development, the primitive ectoderm gives rise during a gastrulating process to the primary germ layers including ectoderm, mesoderm and endoderm (Lim et al., 2013). These three germ layers might subsequently generate a variety of organized tissue structures involving complex epithelial-mesenchymal interactions.
Literature Review
08
Similarly, the injection of ESC-derived progenitors into severe combined immunodeficient (SCID) mice might also result in the formation of teratomas corresponding to the complex structure containing the differentiated cell types from three germ layers. Moreover, the ESCs can generate multiple cell progenitors that express the specific markers of three germ layers in vitro including endoderm, mesoderm and ectoderm (Sluder, 2016). In this matter, the ESCs, when cultured in suspension in vitro, are able to spontaneously form embryoid bodies (EBs) that consist of spheres containing a variety of more differentiated progenitor cell types (Huang et al., 2014).
2) Adult stem cells (ASCs) Adult or mature stem cells (ASCs) are also called somatic stem cells. They are found in organs and tissues for homeostasis by replacing or renewing the injured or dead cells in an adult organism (Pekovic and Hutchison, 2008). ASCs were demonstrated by some scientists as somatic stem cells whose orgin is not known (Jeong, 2008). ASCs raise fewer controversial matters than ES cells (Zacharias et al., 2011). However, ASCs are difficult to identify, isolate, maintain and grow in the lab compared to ESCs (Wartalski et al., 2016). They are more differentiated and less flexible and they have a very limited potent (multipotent vs pluripotent) (Berdasco and Esteller, 2011). There are ASCPs unique for almost every type of mammalian tissues, especially in the organs that need a continuous supply of cells and they are undergoing a constant cell division (Mieloch and Suchorska, 2015). ASCs can be found in several places, including the bone marrow, UCB, pancreas and brain (Ramakrishna et al., 2011). Although tissue-specific stem cells have specific markers for their own, they are not general markers for all ASC types (Tyler et al., 2016). In fact, ASCs can be originated during ontogeny and persisting in specialized niches within organs where they may keep their quiescence for short or long periods of time
Literature Review
09
(Watt et al., 2013). There is a huge advantage in the biology of ASCs because of their high elasticity (González et al., 2012). Adult stem cells are able to produce diverse mature cell progenitors that actively contribute to the maintenance of homeostatic processes (Tom and Thomas, 2013) in the body by replenishing the cells that use repair tissues that are organs along the lifespan and renew damaged tissues during injuries or traumas (Upadhyay, 2015).
2.10.3 Hematopoietic Stem Cells Hematopoietic stem cells (HSCs) are the stem cells that are responsible for the forming of blood cells such as white blood cells, red blood cells and platelets (Jun and Irving, 2011; Lim et al., 2013). Presently, many researchers have found through experimentation on animals that HSCs show some elasticity (Cheng et al., 2015). Moreover, HSCs have the capacity to submit the process that is called apoptosis or programmed cell death (Riether et al., 2015), in which unneeded cells undergo auto destruction, unfortunately, HSCs are hard in identification (Bruin et al., 2016). They can be isolated from numerous sources like bone marrow, cord blood cells and blood stream (Frecha et al., 2016). The discovery of HSCs represents a great modality for discovering the field of regenerative medicine due to both of their primary, inherent characteristics, both have the capacity to self-renewal and differentiation into more developmentally restrained lineages, (Figure 2.3) (Kekre and Antin, 2016). HSCs are of particular importance because they are considered the initial material for one of the most dynamic organs of the human body, replenishing all mature blood lineages during the adult life entirely (Leo and Amy, 2014). The transplantation of bone marrow (BM) from one mouse into an irradiated recipient was the basis for HSCs work and subsequently enumerate donor derived (Kent et al., 2013). Hematopoietic colony forming units (CFU) in the recipient‘s spleen (Tanaka et al., 2016). In order to explain CFU clonality,
Literature Review
32
they are sub-lethally irradiated the donor marrow, causing cell specific chromosomal abnormalities that will be observed later in all the cells of a given CFU (Doulatov et al., 2012). Clonal progenitors were demonstrated by Till and McCulloch which formed mixed myeloerythroid colonies, lymphocytic colonies and were capable of renewing itself, thus providing evidence for the existence of single cells in mouse BM capable of long-term survival and multipotent differentiation (Marusyk et al., 2010).
Figure 2.3. The development of different blood cells from HSC to mature cells (Schalm's et al., 2010).
2.10.3.1 Morphological characteristics The Morphological level, hematopoietic stem cells are considered to be undifferentiated and similar to small lymphocytes (Sawai et al., 2016).
Literature Review
34
However, in the G0 phase of the cell cycle, a large part of HSCs is quiescent and that protects them from the action of cell cycle-dependent drugs (Tesio and Trumpp, 2011). The stem cell's quiescence state can be kept by transforming the growth factor-β (TGF-β) (Li and Gotlieb, 2011). The activity of TGF-β is mediated by p53, is a tumor suppressor gene, i.e., its activity stops the formation of tumors, and responsible for the regulation of cell proliferation and targets the cyclin dependent kinase inhibitor (p21) (Tarek and Anindya, 2010). Quiescent characteristic of hematopoietic stem cells is critical, not only to protect compartment for stem cell but to sustain cell regeneration during long of the time (Keisuke and Suda, 2014), but also to lessen the accumulation of replication accompanying with mutations. Understanding quiescence regulation in HSC is of great importance not only for understanding the physiological foundation of HSCs, but also for understanding the pathophysiological origins of many related disorders. (Yong et al., 2014). The surface antigen-CD34 is used only to determine the hematopoietic stem cells. Nevertheless, most cells with CD34 antigen expression of bone marrow or umbilical cord blood have other antigenic determinants (Lim et al., 2013). The immunophenotype of stem cells/progenitors can be assessed using: the cytometric analysis of the presence of CD34/CD38 proteoglycan analysis of the marker of a mature line (HLA-DR) analysis of c-kit tyrosine kinase receptor and their respective labeling with the antibodies conjugated to fluorochromes (Joshi and Kundu, 2013). As it was mentioned above, a characteristic feature of hematopoietic stem and progenitor cells in the presence of CD34 antigen. It is a transmembrane glycoprotein of approximately 104–120 kDa, which belongs to the adhesion molecules known as sialomucins. It is composed of a protein core of 40 kDa containing 6 to 9 N-binding sites of glycosylation and more than 9 O-binding sites of glycosylation (Jianjun et al., 2010). The cytoplasmic part of CD34 antigen has two sites for the phosphorylation of protein kinase C, and one site
Literature Review
30
for tyrosine phosphorylation. Therefore its function is associated with the occurrence of transmembrane signaling (Garg et al., 2013). CD34 antigen is involved in the regulation of hematopoietic stem cell‘s adhesion to the stroma (Drake et al., 2011). An increase in the expression of CD34 antigen mainly precedes cell differentiation.
2.10.3.2 Classification of HSCs The pool of HSCs can be divided in accordance with its hematopoietic repopulation ability into three major groups: Short-term HSCs, which have the ability to generate clones of differentiating to many types of cells for only 4–6 weeks (Abe et al., 2011). Intermediate-term HSCs, capable of sustaining a differentiating cell progeny for 6–8 months before becoming extinct (Benveniste et al., 2009). Long-term HSCs, capable of maintaining hematopoiesis indefinitely (Testa, 2011).
2.10.3.3 Major Sources of HSC There are three major sources of HSCs for using in vitro transplantation: - Umbilical cord blood - Bone marrow - Peripheral blood. 1) Bone Marrow (BM) The best-known location for HSCs is BM, and BM transplantation has become synonymous with hematopoietic cell transplantation, in adults, the majority of HSCs reside in BM. However, cytokine mobilization can result in the release of large numbers of HSCs into the blood (Skogberg, 2014; Delaney et al., 2011). BM is considered one of the lymphatic organs that primarily form lymphocytes from embryonic hematopoietic primogenitor cells (Margaris and Black, 2012).
Literature Review
33
Healthy donors can give HSCs by BM aspiration that is considered a source of progenitor stem cells in the clinical preparation (Margini et al., 2014). BM represents the main source of MSCs, but their differentiation capacity declines with age (Liu et al., 2016). As an addition to HSCs that are responsible for the production of blood cell progeny, a type of cells called mesenchymal or stromal can be found also in marrow (Mendelson and Frenette, 2015). The previous cell supply every hematopoietic cell type and the rest of cells found inside of the marrow with support, and also focusing on the possible repairs of the tissue (Ravi, 2015). HSCs are found in BM and manifest an estimated frequency of 0.01% of whole nucleated cells and can be accompanied with iliac crest puncture and then separated from the other types of blood cells with the assistance of magnetic beads or cell sorting (Verovskaya, 2014). 2) Peripheral Blood (PB) Since the early 1990s, peripheral blood progenitor cells collected by apheresis have largely replaced bone marrow as a source of hematopoietic stem cells for autologous transplantation (Broxmeyer and Farag, 2013). Peripheral blood cells produce more rapid hematopoietic recovery, thereby leading to reduced costs (Kriebardis et al., 2012). Furthermore, researchers were used peripheral blood as source stem cells for transplantation in humans. Peripheral blood was collected from patients where marrow harvests were poor because of extensive previous radiotherapies and chemotherapies; sufficient stem cells collection was insured by apheresis for several hours (Li et al., 2012). Peripheral blood stem cells (PBSCs) have several advantages when compared to marrow grafts (Khera et al., 2013). Their procurement does not require hospital admission or exposure to general anesthesia (Weisdorf, 2014). Moreover, PBSCs have shortened the period of cytopenia following myeloablative therapy compared to the marrow (Crivori et al., 2011). The recovery of both neutrophils and platelets is so much more rapid with growth factor-mobilized PBSCs than with marrow, leading to simplified autologous
Literature Review
31
transplantation and made it a safer process (Bensinger, 2013), because patients will require fewer days of treatment with antibiotics, blood component support, and are discharged earlier from the hospital (Hequet, 2015). Unfortunately, HSCs short life span in vitro is not easy of obtaining their, because the proliferation is joined by differentiation (Pietrzyk et al., 2015). PBSC transplantation has become increasingly common with PBSCs largely replacing BM as the preferred stem cell source due largely to quicker engraftment kinetics and ease of collection (Pereira et al., 2014). HSCs are normally found in very limited numbers in the peripheral circulation (less than 0.1% of all nucleated cells). It is logical that progenitor cells circulate in the periphery, as this ensures an even distribution of hematopoiesis within the BM (Amanda et al., 2014). 3) Umbilical Cord Blood (UCB). Umbilical cord blood is the blood that is found in the placenta and the baby's attached umbilical cord after its birth (Raju et al., 2013). Cord blood is used because the stem cells can be found in it, and the latter component is used to treat genetic and hematopoietic disorders. UCB is considered to be the foundation of the scarce but priceless (Waller, 2011). Primary HSCs and progenitor cells that are responsible for repeating the system of hematopoietic that related to the patients with malignant and nonmalignant disorders cured with myeloablative treatment (Manuscript and Replacement, 2014). Placenta that is left over after birth is a source of stem cells (Ballen et al., 2013). The presence of relatively mature hematopoietic progenitor cells (HPC) in human (UCB) was demonstrated in 1974 (Awong et al., 2011). About ten years later, Ogawa and colleagues documented the presence of primitive HPC in UCB (Schuster et al. 2012). However, it was not until 1989 that experimental and clinical studies were published indicating that human UCB could be used in clinical settings. Kita et al. (2011) showed experimental evidence that UCB is a rich source of hematopoietic stem/progenitor cells (HSPC) (Ballen et al., 2016).
Literature Review
35
That same year, reported studies on the first hematopoietic cell transplant in which UCB was used instead of BM as the source of hematopoietic cells. They were able to reconstitute the hematopoietic system of a child with Fanconi anemia by means of UCB from an HLA-identical sibling (Parekkadan and Milwid, 2010; Domen et al., 2012). The concentration of HSCs in UCB collections is the same to those in collections of BM for transplantation (Park and Won, 2009) (Figure 2.4)
Figure 2.4. Cord blood contains HSCs as well as multipotent stem cells, such as mesenchymal stem cells, which have the ability to regenerate numerous tissue types, red blood cell and white blood cell (Lee, 2014).
The number of colonies forming unit granulocyte macrophage (CFU-GM) is greatly increased in UCB obtained from term neonates compared with peripheral blood obtained from adults. The number of circulating CFUgranulocyte, erythrocyte, monocyte, megakaryocyte (CFU-GEMM) also appears to be significantly increased in term UCB (Hofmann and Greiner, 2011; Danby
Literature Review
31
and Rocha, 2014). Moreover, committed megakaryocytic progenitor cells as identified by circulating colony forming unit megakaryocyte (CFU-Meg) are also enriched in term UCB compared with adult peripheral blood but to a much less degree than CFU-GM and CFU-GEMM (Ullah et al., 2015). Schuster et al., (2012) showed that UCB contains numbers of CFU-GM well within the range of marrow CFU-GM which previously allow successful engraftment after autologous BM. Human UCB also contains a more primitive subpopulation of MSCs than adult BM whose immature cells express the adhesion molecules such as CD13, CD29, CD44, CD90, CD95, CD105 and MHC class, but not the antigens of hematopoietic differentiation such as CD34 (Waller-wise, 2011; Roson-burgo et al., 2014). Thus, it appears that the differentiation of UCB stem cells progenitors might constitute an alternative strategy for cellular therapies of diverse disorders.
37
Materials and Methods 3. Materials and Methods 3.1. Materials 3.1.1. Equipment:-
The following equipment and apparatus were used in this study as represented in the following table:Table 3.1. Equipment used in this study and their company and origin No.
Apparatus
Company and origin
1
Autoclave
Tuttnauer, Germany
2
Centrifuge
LW Scientific, USA
3
CO2 incubator
Human Lab Instrument, Italy
4
Cooling Centrifuge
Selecta, Italy
5
Deep freeze
Sanyo, Japan
6
Digital camera
Sony, Japan
7
Distillatory
DZ, China
8
Electrical oven
Memmert, Germany
9
Electrophoresis unit
Bioneer, Korea
10
ELISA
Biotek, USA
11
High Performance Liquid Chromatography (HPLC)
Cuknm, G+9ermany
12
Inverted microscope
Novel, Italy
13
Laminar air flow hood
Techne, UK
14
Light microscope
Novel, China
15
Magnetic stirrer-Hot plate
Stuart, UK
16
Microcentrifuge
Bioneer, Korea
17
Microwave oven
Bioneer, Corea
18
Nanodrop
U.S.A
19
PCR
ESCO, European
20
pH meter
Hanna, Romania
21
Refrigerator
Concord, France
22
Sensitive balance
Precisa, Swiss
Materials and Methods 23
Shaking incubator
Novel, Italy
24
Stirrer Hot Plate
USA corning
25
Vortex shaker
Stuart scientific, UK
26
Waterbath
Clifton, England
3.1.2 Tools The tools used in this study illustrated in table (3.2) and their company and origin.
No.
Tools
Company and origin
1
Blood collection bags
Terumo, India
2
Cover slides
Ataco, China
3
Disposable petri dished
Sterilin, UK
4
Disposable Syringe 5cc
Medeco, Belgium
5
Disposable tissue culture falcon
Santa Cruz, USA
6
Disposable universal tubes
Afco Dispo, Jordan
7
Eppendorf tube
Eppendorf, Germany
8
Hemocytometer
Hirschmann, Germany
9
Micropipettes and tips
CYAN, Belgium
10
Millipore filters 0.2 microns
Thermo Scientific, USA
11
Multi- well tissue culture plates
Costar, USA
12
Multichannel Pipette
CYAN, Belgium
13
Nalgene filters
Apogent, USA
14
Pasteur pipette
Fortunr, Germany
15
Plastic tissue culture flask (50 cm2)
Falcon, USA
16
Separatory funnel
Afco Dispo, Jordan
17
Vacutainer blood collection tube
Afco Dispo, Jordan
18
Venoject –needle
Terumo, US
19
Venoject-holder
Terumo, US
20
Whatman Filter papers
Whatman, USA
38
39
Materials and Methods 3.1.3. Chemicals and culture requirements Chemicals, media and biological materials Chemical and biological materials used in this study were listed in table 3.3.
Table 3.3. Chemical and biological materials used in this study and their company and origin No.
Materials
Company and origin
1
Absolute methyl alcohol
Teeba, Iraq
2
Aceton
BDH, England
3
Acetonitrile
BDH, England
4
Agarose
Bioneer, Korea
5
Amphotericin B vial
Invitrogen, USA
6
CD34 Kit
Dako-America
7
Chloramphenicol
Troge, Germany
8
Chloroform
BDH, England
9
Dimethylsulfoxide (DMSO)
Sigma-Germany
10
Distill water
DZ, China
11
DNA ladder (100) bp.
Bioneer, Korea
12
Dulbecco's Modified Eagle Medium
Sigma, USA
13
Ethidium bromide
Promega, USA
14
Ethylenediaminetetraacetic acid (EDTA)
BDH, England
15
Fetal calf serum
Mediatech, USA
16
Ficoll – Paque
Mediatech, USA
17
Hepes buffer
Flow lab, England
18
Isopropanol
Bioneer, Korea
19
Lactophenol cotton blue
BDH, England
20
MTT stain
Sigma-Germany
21
Multi– well tissue culture plates
Sterilin, England
Materials and Methods 22
PCR PreMix
Bioneer, Korea
23
Penicillin + streptomycin vial
Invitrogene, USA
24
Potato Dextrose Agar medium (PDA)
Himedia, India
25
Sabouraud Dextrose Agar
Himedia, India
26
Sodium Sulfate Anhydrous (Na2SO4)
Fluka, Switzerland
27
Trypan blue
BDH, England
28
Wizard Genomic DNA Purification Kit
Promega, USA
12
3.1.4 Culture Condition All solutions and equipment coming into contact with live cells must be sterile, and proper aseptic technique should be used accordingly, conditions where the electric oven is used to sterilize the glass tools, while the solutions, media culture tissue and calf serum, are sterilized by using the millipore filter with 0.22 μm porosity. 3.1.5 Cultur media A. Preparation of mycological media Sabouraud Dextrose Agar medium and Potato Dextrose Agar medium (Himedia, India) is ready to use mycological powdered media that used to confirm the identification of A.flavus isolates. The media were prepared according to the instructions fixed on their containers as indicated by the manufacturers. After adjustment of pH at 5.5, they were sterilized by autoclaving at 121ºC and 15 psi for 15 minutes. B. Preparation of the tissue culture medium Ultra-Cruz™ Dulbecco‘s Modified Eagle‘s Medium (MDEM) was prepared according to manufacturer and supplemented with 100 IU/ml Penicillin G, 100 µg/ml Streptomycin Sulfate, and 25 µg/ml Amphotericin B, and with 10 % fetal calf serum (FCS) and pH of the medium was adjusted to 7.3 by using 1N
14
Materials and Methods
HCl and /or 1N NaOH then the medium was filtrated with 0.22 micron Nalgene filter.
3.1.6 Preparation of Solutions, buffers, stains and reagents 1- Phosphate buffer saline (PBS) It was prepared by dissolving the following components and completed to one liter by distilled water. KCl…………………………0.2 g NaCl………………………..8.0 g Na2HPO4……………………1.11 g KH2PO4……………………..0.2 g It was sterilized by autoclave and pH was adjusted to 7.2 and stored at 4 °C to be used for washing and dilution. 2. Trypan blue stain (0.04%) This stain was prepared by dissolving 0.1 g of trypan blue stain in 100 ml PBS then filtered to remove undissolved solids (Tran et al., 2011).
This stain
was used for determination of the viable cells count during cell counting. The dyes stain only dead cells, while viable cells exclude the dye and remain unstained. 3. Preparation
of
MTT
(3-(4,5-Dimethylthiazol-2-yl)
-2,5-diphenyl-
tetrazolium bromide) stain It was prepared by dissolving 2 mg of MTT stain in 1ml of PBS, then filtered to remove undissolved solids or precipitated stain and stored in the dark at 4°C. Fresh MTT stain was prepared for each experiment (Sano et al., 2012)
4. Preparation of DAB The DAB solution was prepared by mixing 2 µL DAB stain with 100µL DAB substrate buffer.
10
Materials and Methods Isolates A.flavus
Molecular work
HPLC
Mycological work DNA Extraction
AF Extraction Culturing (PDA, SDA)
AF detection
PCR Culture in rice
Sub Cultur e
Count spore
Gel Electrophoresis
AF Quantification
Correlate results Quantification
Cytotoxicity assay for HSCs after separation of UCB
Collection of UCB
Isolation and caltivation of hematopoietic stem cells (HSCs)
Figure 3.1. Experimental Design
Materials and Methods
13
3.2 Methodology 3.2.1 Isolation of A. flavus A- Environmental Samples The 21 imported and locally feed samples were randomly collected from different regions in Baghdad during the period from October 2015 to March 2016 and designated into Wheat 4 samples, Barley malt 3, Corn 5 samples, Fruits 4 samples, Nuts 2, Vegetables 2, Spices 1 sample. The fungal were isolated in laboratories of the Environment and Water Department, Ministry of Science and Technology, as shown in Table (3.4). The grains and fruits have been sterilized superficially with 5% of sodium hypochlorite solution for five minutes, then the grains have been washed with sterilized water and cultured in sterile petri dishes containing PDA medium with the addition of 0.05 g/l of Chloramphenicol to prevent the bacterial growth. Each dish was cultured with five grains, four of them were perimeter and the fifth one was in the middle of the dish. The dishes were incubated at 28 ± 1°C for seven days (Darwish et al., 2014). After that, A. flavus isolates have been refined by transplanting a disc from each colony into a new PDA dish, and repeated several times. Before collection of the soil samples, the surface of the profile soil was cleaned. The soil samples were collected from 10-15 cm depth from the soil surface using disinfected spatula. One sample was obtained from certain oil contaminated soil while the other isolates were collected from the contaminated area of the animal dung and stored in sterilized bottles until they reached the laboratory. Ten grams of soil were added to 90 ml of distilled water and were agitated on a shaker for 15 minutes (Lotfinasabasl et al., 2012). The sample was taken out of the shaker and allowed to settle for 15 minutes. 1 ml of the supernatant liquid was used for the isolation of the fungi by applying the liquid on SDA and PDA media using a serial dilution plate technique.
11
Materials and Methods
B- Clinical samples The 3 samples were randomly collected from different Baghdad during the period from October 2015 to March 2016 and designated into Fish 1 sample (fresh), Cow lung 1 sample and Poultry lung 1 sample. Fish samples were washed in a sterile water to remove sediments. The cleaned samples were rinsed twice in distilled water and dried with sterilized filter papers. Different parts of fishes, including skin, fans, gills and intestine were sliced (about 1 cm2). Five pieces were inoculated on either SDA or PDA medium (Hashem, 2011). Three plates from each part were used and media were supplemented as mentioned above. The samples of the infected lung were placed in a sterile container and infected parts were indicated and transferred to the laboratory and plated directly by cutting them into pieces using sterile scissors and forceps, and then a small piece of the inner part of the lung was taken and touched on SDA media, then after incubating at 28 °C for 5 days and after growing of A.flavus isolate, it was transferred to a new plate containing SDA media (Nucci et al., 2010). Table 3.4. A. flavus isolates from different source and origin Isolate No.
Isolate origin
Source of isolate
AFL1
Fish
Clinical
AFL2
Cow lung
Clinical
AFL3
Spices
Environmental
AFL4
Rice
Environmental
AFL5
Animal waste
Environmental
AFL6
Corn
Environmental
AFL7
Soil, black oil
Environmental
AFL8
Barley grain
Environmental
AFL9
Wheat
Environmental
AFL10
Bovine Milk
Environmental
AFL11
Fruits
Environmental
AFL12
Nuts
Environmental
AFL13
Poultry lung
Clinical
AFL14
Peanut grain
Environmental
AFL15
Vegetables
Environmental
Materials and Methods
15
3.2.2. Cultivation of isolates The A. flavus isolates were cultured on SDA supplemented with the addition of 0.05 g/l Chloramphenicol to inhibit the growth of bacteria, then incubated at 28°C and 37°C and examined after 7 days as in Figure (4.3), according to Duniere et al. (2017). 3.2.3 Identification of isolates Isolates were identified depending on the species level based on macroscopical and microscopical characteristics using SDA (Oueslatia et al., 2014) and scotch tape preparation (Diba et al., 2007). All fungal isolates which were identified as A. flavus were cultured and maintained in PDA supplemented with chloramphenicol and incubated for Lab days at 28±2°C (Afzal et al., 2013). All petri dishes used in the experiment were filled with 20 ml of PDA and were separately sealed with Parafilm. Moreover, slant culture was prepared and streaked with an organism and all stored in a refrigerator at 4°C (Burmeister, 2008). 3.2.4 Scotch tape preparation A small piece of transparent adhered tape which touches the surface of the suspected colony, and then adhered to the surface of the microscope slide with drops of lactophenol cotton blue stain. The shape of the fungus and shape and arrangement of the conidia was examined microscopically (Brooks et al., 2016). All isolates were identified according to the procedures mentioned by Larone (2002) and Kirk et al. (2008).
3.2.5 Preservation of isolates Pure cultures of all isolates were maintained in SDA and PDA slant media, these cultures were placed in 4°С as stock cultures (Midorikawa et al., 2008).
3.3 Counting spores using a hemocytometer The SDA slants were prepared as the company instructions sterilized with autoclave at a temperature of 121 ºC and a pressure of 15 psi for 15 minutes
Materials and Methods
11
(Erum and Ahmed, 2011). After completing the sterilization process, the media had been cooled to 45 °C and then Chloramphenicol of 0.05 g/l was added to prevent growth and contamination with bacteria (Lahouar et al., 2016). After that, the medium is poured into sealed tubes to harden diagonally and incubated at the temperature of 26 °C for seven days, after incubation the A. flavus was isolated and diagnosed according to taxonomic key according to Nyongesa et al. (2015). A loop was used for taking spores to implant in universal vial containing SDA slanted culture media and incubated at 28 °C for 5-7 days, thereafter was prepared 10 ml of distilled water sterile in the test tubes which mixed with fungi growth of A.flavus (Hooi and Sali, 2014). The spores were harvested by a loop sterile, suspension of spores was prepared in the tubes (Eissa et al., 2014). 1 ml of the spore suspension was transferred and diluted with the addition of 9 ml of sterilized distilled water to complete the size to 10 ml (Miyamoto et al., 2014) as follows:1- The container which was filled with the prepared spore suspension was swirled gently to make sure of the complete distribution of the suspension. 2- Before the suspension was settled, the spores were taken and placed in tubes by a sterile pipette. 3- The tubes with the spore suspension were mixed with a vortex for a few seconds. 4- Amount of 10 µl of spore solution that has been obtained were added to new tubes and added 0.4% of trypan blue, and then we mixed them gently and added into the counting chamber by placing the pipette tip between the coverslip and the chamber notch. 5- After completing spreading of the solution through the counting chamber by using 40x magnifications, the spores within the center grid were counted.
Materials and Methods
17
6- Using a hand tally counter, the living unstained spores were counted. Following the same guidelines, dead spores stained with trypan blue were counted for viability estimation if this is required. A pipette was used to take 10 µl of trypan blue-treated spores suspension and apply to the hemocytometer (Lai et al., 2015). By filling both chambers underneath the coverslip, we allow the spores suspension to be drawn out by capillary action. The number of spores was calculated by using the following equation (Al-warshan, 2012). Concentration of spore /mm3 N = Total number of calculated spores D = Depth between cover and hemocytometer A = Number of large squares of hemocytometer D F= Dilution factor Counting of the spore's number in each 10 µl of spore suspension was done to add an equal number of spores to each sample of sterile rice.
3.3.1 Rice grain cultures According to Babu and associates (2011), 50 gm of rice and 25 ml tap water were added to the rice in the Erlenmeyer flasks, the mixture was allowed to stand for 2 hours with frequent shaking. The flasks were autoclaved at 121°C, 15 psi for 15 minutes and then cooled, after that each flask was inoculated with million spores and incubated at 28 ± 1 °C in the dark for 21 days and shaken once or twice daily for 3 days to aid in the distribution of inoculum (mycelia). According to Karazhiyan et al. (2016), After 21 days of fermentation, the flasks were briefly put in the oven at 60°C for 3 hours to destroy the fungus and the amount of AF was determined by HPLC technique according to the manufacturer's instructions in the laboratory of the Ministry of Sciences and Technology, Baghdad.
Materials and Methods
18
3.3.2 Aflatoxin extraction method The AF in rice was quantified according to the method described in previous studies (Li et al., 2014), according to the following steps: 1. The weight of 25 grams of rice powder was taken after drying, grinding and placed it in a 250 ml beaker. 2. Amount of 25 ml of methanol and 25 ml of chloroform was added and then placed on the shaking device (shaker) for about 60 minutes for homogenization. 3. Samples were filtrated with Whatman filter paper No.1 and 25 ml of 90% methanol was added and the suspension was separated by a separating funnel. 4. The filtrate was transferred to a separating funnel, to which 25 ml of hexane and 25 ml 90% methanol were added and then separated with the separation funnel for 10 minutes. 5. The lower layer that contained methanol was taken which are dried in a water bath. 6. The specimen was taken and added to the chloroform and distilled water 25:25 ml in the separating funnel and washed twice with distilled water after the shaking of the funnel and left it until the separation of the two layers (the upper layer was neglected). 7. The lower layer of chloroform was passed through a filtration paper that contained 10 g of anhydrous sodium sulfate. 8. The filtrate was evaporated until it dried on the water bath. 3.3.3 Detection of AFB1 using High-Performance Liquid Chromatography (HPLC) The quantity and quality of AF were detected according to Lai et al. (2014). The AF has dissolved in acetonitrile 2 ml and filtered through a Millipore filter (0.45µm) then 100 µl was drawn to inject into the HPLC. The requirements for HPLC experiment:-
Materials and Methods
19
Column type: 250x4.6 mm ODs—C18 Mobile phase: CH3CN:H2O (40:6) Flow rate: 1 ml min Detector UV: 365 mm Temperature: 300C Pressure: 15-20 Injection volume: 100 µl Retention time: 7.30 min' The concentration of AF for each sample could be measured from the area under the peak, relative to those of AF standard peak (AOAC, 1990). 3.3.1 AFB1 Standard Curve The standard AFB1 solution was prepared according to AOAC (2000) in acetonitrile at a concentration of 25 µg/ml to prepare a stock solution and kept at (-20) °C. AFB1 standard curve was drawn with concentrations (1.25, 2, 5 and 10) µg/ ml for 1an apposite area of AFB1 by using HPLC technique (Figure 3.2).
Figure 3.2. The standard curve of AFB1 concentrations using HPLC technique.
Materials and Methods
52
Molecular part:3.4 DNA extraction: 3.4.1 Lysate of prepare A. flavus 1- Spores were harvested after 5 days growing cultures on SDA. 2- DNA was extracted from 0.5 g of fungal mycelia. 3- Mycelium/spores were transferred into a mortar, frozen in liquid nitrogen and were ground well.
3.4.2 DNA extraction kit: The genomic isolation kit was provided by Wizard Genomic DNA Purification Kit (Promega, USA) the components of this kit were as follow:-
Components
Amount
1. Proteinase K 2. Protein Precipitation Solution 3. Isopropanol 4. Ethanol 70% 5. DNA Rehydration Solution 6. RNase
20 µl 100 µl 300 µl 300 µl 50 µl 1.5 µl
The experiments were conducted in laboratories of College of Pharmacy, University of Anbar as follow:1. DNA was extracted from 0.5 g (wet weight) of fungal mycelium/spores harvested for 5 days growing cultures in SDA media. The mycelium/ spores were frozen in liquid nitrogen which freezes the fungus. After that, they were transferred into a mortar to be milled and crushed well. The temperature of liquid nitrogen was at -196 ºC. Gloves were worn during grinding in order to protect the hands and grinding was continued for a 1 minute, so that the fungus becomes a powdered. A grounded sample was transferred into clean micro tubes with the capacity of 1.5 ml (Abdel-Hadi et al., 2011b; Hashim et al., 2013)
Materials and Methods
54
2. Amount of 20 µl of proteinase K, cell lysis buffer was added to the samples and mixed thoroughly by vortex, and incubated at 60 °C for at 15 minutes to ensure the samples lysate and mix by vortex. 3. Then, 100 µl of the protein precipitation solution was added to the mixture, mixed by vortex for 10 seconds. 4. The mixture on the ice was incubated for 5 minutes. 5. Amount of 1.5 ml of supernatant was transferred into new clean tubes containing room temperature Isopropanol. 6. An aliquot of 300 µl Isopropanol was added, mixed thoroughly by vortexing for 20 times. 7. The mixture was mixed by inversion and centrifuge at 15,000×g for 2 minutes. 8. Decant supernatant, the tubes were dried at room temperature and added 600 µl of 70% ethanol with moving the tubes several times to wash DNA precipitate. 9. The mixture was centrifuged at 15,000×g for 2 minutes. 10. The ethanol was aspirated and air-dries the pellet. 11. DNA Rehydration Solution was added. 12. Amount of 1.5 µl of RNase was added and incubated at 37 ºC for 15 minutes and Rehydrated at 65 ºC for 1 hour or overnight at 4 ºC.
3.4.3 Estimation of DNA concentration and purity DNA concentration and purity of each sample were estimated by nanodrop and separated on agarose gel. Measuring of DNA quantity was done using Nanodrop system which consists of Nanodrop machine (Thermo Scientific Nanodrop, procedure 1000 Spectrophotometer) and its software. Based on the Nanodrop, 5µl was taken from each sample and put in Nanodrop and clicked on the measure icon through five seconds (Kang et al., 2016).
Materials and Methods
50
3.4.4 Preparation 1% of agarose gel: 1. Amount of 50 ml of X1-TBE solution was taken and put in a beaker. 2. A half gm (0.5 gm) of agarose powder was weighed and mixed with the previous solution. 3. By using a microwave, the solution was melted through boiling. 4. Two microliters of ethidium bromide (0.5 mg/ml) were added to the agarose solution. 5. The solution was left to be cooled to 50 – 60 ºC
3.4.5 Electrophoresis The extracted samples were electrophoretic by using agarose gel to make sure of DNA presence, five microliters of DNA sample were taken and mixed with two microliters of the loading dye and electrophoretic through 1% of agarose gel for 1hour/ 70 volt, and the gel will be stained with ethidium bromide stain. The gel was placed on a UV transilluminator to know the efficiency of DNA extraction by visualization and the presence of the band.
3.5. Polymerase Chain Reaction (PCR) Procedure: All extracted DNA from fungal culture was submitted by amplification PCR process. The specific primers were designed on the basis of sequence information of the gene repeated unit that amplifies a highly repeated sequence of A.flavus DNA (Shweta et al., 2013).
3.5.1 Primers All primers used in this study were supplied by (Bioneer- Korea). Three genes involved in Aflatoxin Biosynthesis, as a lypholized form in different concentration for each one, every primer was dissolved in the appropriate amount of free nuclease water to reach final concentration 100 pmole as a stock solution. For work of PCR the primers then diluted to 10 pmol/µl by dilution of
53
Materials and Methods
10 µl of stock with 90 µl of free nuclease water. The primers and their sequences are listed in Table 3.5. Table 3.5. The names and sequences of the primers used in this study. No. 1 2 3
Primers Product Sequence(´5-´3) Name size nor 1 nor1 ACCGCTACGCCGGCACTCTCGGCAC 400 bp (aflD) nor2 TTGGCCGCCAGCTTCGACACTCCG ver 1 ver1 GCCGCAGGCCGCGGAGAAAGTGGT (aflM) ver2 GGGGATATACTCCCGCGACACAGCC aflR1 TATCTCCCCCCGGGCATCTCCCGG aflR aflR2 CCGTCAGACAGCCACTGGACACGG
600 bp 1000 bp
References Rashid et al., (2009) Rashid et al., (2009) Rashid et al., (2009)
3.5.2 Preparation of PCR mix reaction Items required 1. PCR primers: The PCR primers sequence was shown in table 3.5. 2. AccuPower® PCR pre mix
Procedure:1. Template DNA and primers were added to Accupower PCR tube. 2. Free nuclease water was added to Accupower PCR tubes to a total volume of 25µl. 3. The sample was placed in specific holding wells in the instruments. 4. The samples were loaded on agarose gel without adding a loading dye mixture and perform electrophoresis. Amplification of genomic DNA was performed with the following master amplification reaction. PCR reaction kit (premix) was selected from the Bioneer. The PCR reaction was carried out in 25 µl solution containing (5 µl) premix (Taq DNA polymerase, 250 µM (each) dATP, dGTP, dCTP, dTTP and 1.5 Mm MgCl 2, reaction buffer (PH 9) and loading dye buffer (yellow and blue dye), 2 µl each of amplification primers, 4 µl target DNA, 12 µl free nuclease water, table 3.6.
51
Materials and Methods
Table 3.6. The original PCR reagents and final concentrations which were used in study procedure. Materials
Final concentration
Volume for 1tube
PCR PreMix Free nucleus water
1x —
5 µI 12 µI
Forward
10pmol/ml
2 µI
Revers
10pmol/ml
2 µI
DNA template
100ng
4 µI
Final volume
_
25 µI
3.5.3 PCR program The thermal cycler (ESCO, USA) was used with a thermal profile for (nor1, aflR, ver 1) genes involving 4 minutes at 95 oC, followed by 30 cycles each, of 1 minute at 95 oC, 1 minute, at 62 oC, 1 minute at 72 oC and a final elongation step at 72 oC for 10 minutes table 3.7. Table 3.7. The PCR program which was used in the amplification of the targets DNA for: aflR, nor1 and ver 1 Steps
Temperature (°C)
Time
Initial denaturation
95
4 minutes
Denaturation
95
1 minute
58 – 62
1 minute
Annealing
30 cycles Extension
72
30 second
Final extension
72
10 minutes
Our PCR process consists of a series of thirty cycles to (nor1, aflR, ver 1) genes. Each cycle consists of three main steps: 1- Initial Denaturation of (nor1, aflR, ver 1) genes Prior to the first cycle, the mixture was heated at 95 ºC for 4 minutes for nor1, aflR and ver 1 gene. Which is sufficient to ensure that the DNA, as well as
Materials and Methods
55
the primers, has melted, so both the template DNA and the primers have been completely separated and become single strand (Hussain et al., 2015) 2- Denaturation The DNA sample was heated to 95 ºC for 1 minute to (nor1, aflR, ver 1) gene and to for each cycle in order to separate the strands. It breaks apart the hydrogen bonds that connect the two DNA strand )Hussain et al., 2015(.
3- Annealing After separating the DNA strands, the temperature was lowered, so the primers can attach themselves to the single DNA strands. The temperature of this stage depends on the primer which is usually 5 oC below their melting temperature, so the temperature used in nor1, aflR and ver 1 gene program was 62 ºC for 1 minute as in (figure 3.3). A wrong temperature during the annealing step can result in unbinding of the primer to the template DNA at all or binding at random. The primers are jiggling around. They are caused by the Brownian motion and short bonds which are constantly formed between the single stranded primer and the single stranded template (Bintvihok et al., 2016).
Figure 3.3. PCR temperature condition for nor1 (58 ºC), ver 1 (58 ºC) aflR (60 ºC).
4- Extension Finally, the sample heated at 72 ºC for 30 sec. in nor1, aflR and ver 1 gene program at which DNA polymerase starts copying the DNA strands. It starts at
Materials and Methods
51
the annealed primer and works its way along the DNA strand. The Taq polymerase elongates optimally at a temperature of 72 ºC, and the time for this step depends both on the DNA polymerase itself and on the length of the DNA fragment to be amplified (Kennedy and Oswaled, 2011). A final elongation step was used after the last cycle to ensure that any remaining single-stranded DNA was completely copied. The PCR products were identified by their size using agarose gel electrophoresis. The size of the PCR products was determined by comparing them with a Bench top PCR Markers (Bioneer, 100 or 1500 bp) which contain DNA fragment of known size (Kennedy and Oswaled, 2011).
3.5.4 Optimization of polymerase chain reaction Since PCR is very sensitive, adequate measures were taken to avoid contamination from other DNA which may present in the lab environment (bacteria, viruses, own DNA, etc.). The DNA sample preparation reaction mixture assemblage and the PCR process, in addition to the subsequent product analysis, were performed in separated areas. For the preparation of reaction mixture, a laminar flow cabinet with UV lamp was used fresh gloves used for each PCR step as well as micropipettes with sterile tips. The reagent for PCR was prepared separately in ice and used solely for this purpose and also used optimum concentration. Aliquots were stored separately from other DNA samples (Gudkova and Polinaa, 2016).
3.5.5 Reagents for electrophoresis:• Ethidium bromide • Agarose • 1X TBE buffer • Bench top PCR marker.
Materials and Methods
57
3.5.6 Agarose gel electrophoresis:The preparation of agarose gel with ethidium bromide was achieved according to the (Sambrook et al., 2006) as the following procedures:1- The amount of 1X TBE (50ml) was taken in a beaker. 2- Agarose powder (1gm) was added to the buffer. 3- The solution was heated to boiling using Microwave until all gel particles were dissolved. 4- Ethidium bromide (2 µl of 10mg/ml) was added to the agarose. 5- The agarose was stirred in order to be mixed to avoid making bubbles. 6- The solution was left to cool down at 50-60 ºC.
3.5.7.1 Casting of the horizontal agarose gel:After sealing both edges of the gel tray with a cellophane tapes and fixing the comb in 1 cm away from one edge, the agarose solution was poured into the gel tray. The agarose was allowed to solidify at room temperature for 30 minutes. The fixed comb was carefully removed and the gel tray was placed in the gel tank. The tank was filled with 1X TBE buffer until it reached 1-2 mm over the surface of the gel (Sambrook et al., 2006).
3.5.7.2 Loading DNA sample:1- The surface of the desk was wiped with a piece of cotton and ethanol 70%, and in the sterile eppendorf tube of on a clean piece tape, DNA loading was done. 2- The gel with tray was laid into the chamber with 1X TBE and assured that the gel was completely covered with TBE until top surface of the gel submerged with approximately 2 minutes, and that the wells were at the negative electrode 3- Bench top PCR Markers (Bioneer, 100 bp) were transferred onto the gel well by micropipette.
Materials and Methods
58
4- Amount of 5 µl of the amplification DNA samples were loaded into the wells of the gel. 5- The safety cover was placed onto the chamber carefully, ensuring that both plugs were secured and connected with power supply. 6- Electrophoresis condition was set up at 100 volts for 1 hour for a small tank and 150 volts for a large tank with same time. After that, the power supply was turned off and disconnected the leads. 7- The gel for DNA fragments was observed by examining the gel under UV light of (transilluminator) (Kennedy and Oswaled, 2011).
3.6 Cord blood collection Collection of cord blood units started in September 2016 until November 2016 using vacuum tubes and blood bags and this was carried out in the delivery room. Umbilical cord blood was obtained after the birth of 15 full-term infants from a group of women aged 30-35 years of cesarean section at the University Hospital in Baghdad after that protocol was approved by the local hospital ethics committee and with the informed consent of the mother before cord blood was taken. There are two main techniques for collecting UCB from the umbilical vein. With the in utero technique, the blood is collected in the delivery room while the placenta is still inside the uterus (Volpe et al. 2011). When the ex utero method is used, the UCB is collected in a different room from that in which the birth occurred, after delivery of the placenta. All UCB specimens were freshly collected from the umbilical vein. Thirty seconds after delivery of the baby, the umbilical cord is clamped then cut the link between the baby and placenta and the baby separated from the cord, then a 5-8 cm area of umbilical cord was cleaned with betadine solution and, in open method, The UCB is collected from the umbilical vein with a 12.5-gauge needle connected to a sterile 150 mL bag (Maco Pharma S.A. Laboratoires Pharmaceutiques, France), containing 21 mL of phosphate-citrate dextrose anticoagulant.
Materials and Methods
59
A- Closed System Method Caesarean section was performed with a low uterine transversal incision in all patients according to common obstetrical practice. Umbilical cord clamping time was decided by the operator, and the collection was performed after delivery of the infant and ligation of the cord. Before placental delivery (in utero) Collection after delivery, the umbilical cord was clamped immediately using two hemostatic clamps all UCB specimens were freshly collected from the umbilical vein. Thirty seconds after delivery of the baby, then cut the link between the baby and placenta and the baby separated from the cord, then a 5-8 cm area of umbilical cord was cleaned with betadine solution, the blood was collected directly by inserting the venoject needle into the umbilical vein, so the blood was drowned inside the vacutainer tubes which supplied with heparin as anticoagulant as in Figure (3.4). B- Open System Method After Placental Delivery (ex utero) cord blood collection was performed ex utero. Once the placenta was spontaneously or manually removed, it was transported quickly to the collection area, which contains necessary supplies and equipment. No time limit was set between placental delivery and the cord blood collection. The placenta was placed on a specially designed tray with a central hole that allows the umbilical cord to hang down as in Figure (3.4). After stringently cleaning the umbilical cord with 70% alcohol and iodine swab, The UCB is collected from the umbilical vein with a 12.5-gauge needle connected to a sterile 150 mL bag (Maco Pharma S.A. Laboratoires Pharmaceutiques, France), containing 21 mL of phosphate-citrate dextrose anticoagulant.The blood bag needle was inserted into the umbilical cord vein. The blood was flow by gravity into the bag, during collection the blood bag was shaken gently so that the anticoagulant freely mixed with UCB (Shamkhi et al., 2011). Cord blood collection was stored at 4 °C.
Materials and Methods
12
The UCB samples were handled precisely and brought to the stem cell culture laboratory to avoid the direct sunlight exposure and the high extreme temperature.
A
B
C
D
Figure 3.4. Collection of umbilical cord blood during cesarean section. (A): the umbilical cord is a conduit between the fetus and the placenta (B): Vein of umbilical cord from it collect blood whiles the placenta in utero (closed system). (C): The placenta out of a uterus. (D): Vein of umbilical cord from it collect blood whiles the placenta exutero (open system)
3.6.1 Cord blood cells separation After a successful collection of UCB, it was kept in an anticoagulanttreated bag and kept at 4°C and processed within few hours. The Hematopoietic stem cells (MNCs) were separated from UCB by density gradient centrifugation according to the protocol described by Rafael and Vaclav (2000) as follows:
Materials and Methods
14
1. UCB was diluted in a proportion of 1:1 in a PBS. 2. Amount of four ml of diluted blood was transferred to 10 ml round bottom tubes and layered carefully on 3 ml of Ficoll-Paque solute and centrifuged at 2200 rpm for 25 minutes at 4°C in order to isolate HSCs (figure 3.5).
Figure 3.5. Diluted blood overlaid on Ficoll-Paque before gradient centrifugation.
3. Centrifugation resulted four distinct layers (from top to bottom): A transparent yellowish plasma layer. A cloudy buffy coat layer containing the mononuclear cells. A clear layer of Ficoll® A red layer containing red blood cells and polymorphonuclear cells (figure 3.6). (Basford et al., 2010). 4. By using Pasteur pipette, the MNCs rich zone (buffy coat layer) was aspirated and transferred into a new 10 ml round bottom tube and washed twice with culture medium (DMEM) through centrifugation at 4°C in 2000 rpm for 8 minutes and 1000 rpm for 10 minutes, respectively.
Materials and Methods
10
Figure 3.6. Separation tube of blood four layers after gradient centrifugation, the upper one (A) represent the supernatant plasma, (B) represents the medium cloudy layer (Buffy coat) represent the MNCs, (C) represent the layer of the Ficoll-Paque and (D) represent the remainder cells which settled in the lower layer. 5. The final pellet was resuspended with 1ml of culture medium (DMEM)
supplemented with 10% FCS and was considered ready for cells count, viability and percentage of HSCs by taken 100 µL from these suspended cells, while the remainder was subjected to cultivation and isolation of the MNCs (hematopoietic stem cells).
3.6.2 Determination of cell number and viability The cell count and viability can be determined by using trypan blue stain. About 100 µl from the resuspended cells were diluted 1:1 with trypan blue solution and transferred into an Eppendorf tube then incubated at room temperature for two minutes to determine the cell viability, where dead cells were stained (blue color), while alive cells not stained (Cadena-herrera et al., 2015) Then 10 µl of the mixture was transferred to a hemocytometer chamber. Viable cells in each of the four corners squares on either side of the counter chamber
Materials and Methods
13
were calculated. The average of the counts was multiplied by 2×104 to give the number of cell/ml (Freshney, 2010). Viable Cells (%) = [No. of viable cells/Total No. of cells (dead and viable)]× 100
3.6.3 Isolation and cultivation of the hematopoietic stem cells from the human umbilical cord blood After determination of the cell count and viability, the remaining cells were subjected to isolation and cultivation procedure according to Weiss and Wradrop (2010), as follows: 1. A number of 1×106 cells were cultured in a 25-mm tissue culture flask which contains 5 ml of DMEM medium supplemented with 10% FCS and 100 U/ml penicillin, 100 μg /ml streptomycin and 25 μg/ml amphotericin B and Plated onto a 25-mm tissue culture dish and incubated overnight at 37°C with 5% carbon dioxide. 2. For 3 consecutive days, the non-adherent cells were replaced onto a new tissue culture flask to remove any contaminating adherent cells, (where it is known that the non-adherent cells are the MNCs). 3. After 3 days the non-adherent cells were harvested and subjected to centrifugation (10 minutes, 300g), the supernatant was aspirated and was cultured again in similar condition. 4. The cells were monitored daily and the half of the medium was replaced if the color turns orange until the cells reached to 80 % confluence. 3.6.4 CD34 staining method This procedure was performed according to the manufacturer company instruction (DAKO) as following: 1. The precoated charged slides were removed from the freezer, kept at room temperature, unwrapped and then dipped into PBS-filled jar for about 5 minutes on flat level surface.
Materials and Methods
11
2. Endogenous peroxidase was quenched by initial incubation of the smear with enough drops of peroxidase block for 5 minutes at room temperature, then rinsed with PBS, slides, then placed in PBS wash bath for 2 minutes and excess buffer were tapped and wiped around smear. 3. Block reagent (1/10 diluted in PBS) was applied for 10 minutes and excess blocking reagent was tapped, but not washed to avoid non-specific binding of antibodies. 4. The coated MNCs was covered by 20 µL of anti CD34 mouse monoclonal Ab ready to use (primary Ab) specific human CD-marker (CD34). Slides then incubated at 37°C for 1hr, then unreacted monoclonal Ab was removed by dipping the slides into PBS-filled jar for about 2 minutes, the slides were tapped and wiped around the smears. 5. Enough solution of biotinylated secondary antibody (anti-mouse Ab) was applied to cover each smear, distributed evenly over the precoated slides, then placed in a humid chamber for 1hr at 37 °C then bathed in PBS for 5 minutes then wiped around the smears. 6. Enough solution of streptavidin conjugated peroxidase was applied to cover the smear and slides were placed in a humid chamber for 1 hr at 37˚C then bathed in PBS for 5 minutes then wiped around the smears. 7. Enough drops freshly prepared 3, 3-Diaaminobenzidine (DAB) working solution were applied to cover the section at room temperature for 10 minutes or until the color was observed, then the reaction terminated by rinsing gently with D.W from a washing bottle. 8. The slides were placed in bath of harries haematoxylin stain for 30sec at room temperature. Slides were rinsed gently with D.W from a wash bottle and then rinsed under gently running tap water for 5 minutes. 9. A drop of mounting medium (DPX) was placed on the wet smear and the spot quickly covered with a coverslip, then let to dry.
Materials and Methods
15
10. Slides were examined under 40X-magnification power of light microscope. The dark brown (homogenous or membranous) staining revealed positivelabeled cells. 11. Then the MNCs became ready to perform the cytotoxicity assay. 3.6.5 Measurement of the Viable Hematopoietic stem cells by MTT Assay (Freshney, 2010): 1. An aliquot of 100 µl of the cell suspension was implanted in each of the 96 well microtiter plate, (104 cell /well). The plate was incubated at least for two hours in a CO2 incubator. 2. Serial of concentrations from each purified extract (AF) was prepared from each stock solution (µg/ml) to get (1, 0.5, 0.25, 0.12, 0.063, 0.031 0.016 and 0.00781) µg/ml, then sterilized with 0.22 µm millipore filter. 3. Then 100 µl from each concentration of the previous AF was added to each well of the lymphocytes implanting plate. 4. The plate was incubated at 37 ºC in a CO2 incubator for 24 hours. 5. Eventually, 50 µl of MTT stain (2mg/ml) was added to each well and then incubated for a further 4 hours. 6. After centrifugation, the medium (DMEM) was removed gently by fine gauge needle. Then MTT- formazan crystals that formed only as a result of live cells were dissolved in 100 µl of DMSO and added to all wells. 7. Absorbance at 620 nm was recorded immediately by ELISA reader. 8. Viable cell Lymphocytes as a percentage was calculated as followed: [Absorbance of the test /Absorbance of negative control] X 100. 9. A comparison between the results of both extract (AFs) at different concentrations was statistically calculated to pick up the most effective dosages of each concentration that may cause lymphocytes killing.
Materials and Methods
11
3.6.6 Photography A microstar-America inverted microscope with camera and digital camera were used photographically. An Olympus light microscope and digital camera (Sony, Japan) were used for slide photography.
3.6.7 Statistical Analysis The Statistical Analysis System- SAS (2012) program was used to affect different factors in the study parameters. Chi-square test was conducted to evaluate the significance and compare between percentages and least significant differences. LSD test was used to compare significantly between means in this study.
17
Results and Discussion 4. Results and Discussion
4.1 Isolation and identification of A. flavus from different sources. The Fifteen isolates of A.flavus were isolated from different sources distributed 12 (80%) environmental isolates and 3 (20%) clinical isolates as showed in table 4.1. Depending on the detection results of phenotypic tests, cultural and microscopically ones to confirm the genus and species of the isolates, it proved that (15) isolates belonged to A.flavus species, and such results were obtained after culturing these isolates on SDA and PDA media. This depended on the approved taxonomic keys in a number of references, including Quinn et al. (2013) and Pitt and Hocking (2009). All the isolates appeared as cottony aerial mycelium when young but soon became greenish yellow (figure 4.1 and 4.2). Table 4.1. A. flavus isolates from a different source. Isolate No. AFL1 AFL2
Isolate origin Fish Cow lung
Source of isolation Clinical Clinical
AFL3
Spices
Environmental
AFL4
Rice
Environmental
AFL5
Animal waste
Environmental
AFL6
Corn
Environmental
AFL7
Soil, black oil
Environmental
AFL8
Barley grain
Environmental
AFL9
Wheat
Environmental
AFL10
Bovine Milk
Environmental
AFL11
Fruits
Environmental
AFL12
Nuts
Environmental
AFL13
Poultry lung
Clinical
AFL14
Peanut grain
Environmental
AFL15
Vegetables
Environmental
Table 4.1 showed the fungal isolates from different sources, the isolate AFL1 was isolated from fish. The results of the present study corresponded to
Results and Discussion
18
the results of some researchers on fresh fish where they noted the existence of A. flavus with many other molds. The rise of the molds numbers in dried isolates may be due to a failure in following hygiene and health methods in the processing of dried fish, also their spores are very small and spread in the air falling on the fish body. The current results corresponded with what was mentioned by Hashem, (2011). In addition to that, the isolates AFL2 and AFL13 adapted with the presence of nutrients as well as qualifying factors for growth as pulmonary embolism. These results correspond with what was mentioned by Nucci et al. (2010) and Ben-ami et al. (2010). The isolates (AFL6, AFL14, AFL4, AFL12 and AFL3) were isolated from foods such as corn seeds, peanuts, rice, nuts and chili. This result was in agreement with what was mentioned by El-Shanshoury and El-Sabbagh, (2014) and Darwish et al. (2014), as these were important media for the growth of the fungus A.flavus. These findings were consistent with what was indicated by studies that the components of these grains are appropriate for growing of this species as well as the relative density of the produced spores and the ability of this genus to secrete many of compounds and lysis enzymes that lysine foods which are beneficial in the nutrition, so that this fungus can grow even with the existence of a low moisture content (Pusztahelyi and Pócsi, 2015). Isolate AFL10 was recovered from milk, which is considered as a good medium for the fungus growth. This result agrees with what was reported by Hassan et al. (2014). Milk contamination with fungi may be other reseon to the presence of fungal infection on the animal, leading to the spread of spores on the skin reaching down to the milk (Hymery et al., 2014). In addition to that, the milk is not well treated thermally (sterilized) and this is consistent with what was mentioned by Giovati et al. (2015). The results also showed that the isolates AFL5 and AFL7 belong to A.flavus species that were isolated from soil contaminated with oil derivatives and another one contaminated with horses dung. This result agreed with what
Results and Discussion
19
has been mentioned by Lotfinasabasl et al. (2012) where the fungus A.flavus was considered the most prevalent fungus in the areas that contaminated with oil products because of its ability to rapidly integrate with contaminated soil components and the ability of growth and reproduction in environments with reduced concentration of nutrients, moisture, and pH. The ability of this fungus to produce spores increases its importance as stated by Shafiq and Mizil (2009) and Flayyih and Jawhari, (2014) in their studies.
A=Top view B=Reversed view Figure 4.1. A. flavus has grown on PDA at 28 °C after 5 days
4.2. Aspergillus flavus cultural features and microscopic examination The isolates were cultured on SDA medium and supplied with 0.05 g/l chloramphenicol to prevent the bacterial growth, then incubated at 28±1 ºC (Abubakar et al., 2013). The growth reached to the edge of the petri dishes after a period of time estimated until one week. Colonies of A. flavus on SDA showed a rapid growth compared with colonies that cultured on PDA. The diameter of the colony reached to 9 cm within a week when grows on SDA and 7 cm when grows on PDA at 37°C, the colonies are like powdery. The color of this colony at first nearlly white and then turns to yellowish green. This result was in agreement with Odhiambo and Wagara, (2013) study, shown as in Figure (4.2)
Results and Discussion
A=Top view
72
B=Reversed view
Figure 4 2. A. flavus grown on SDA at 28 °C after 4 days
Microscopicall, the conidial head was produced in chains basipetally from phialides. Conidial chains were borne directly on packed clavate-shaped vesicles in the presence of metulae and by using of lactophenol cotton blue. The fungus remained unaffected and easily demonstrated from other substances that might be confused with the fungi in examining isolates. The microscopically examination showed that this isolate has a divided mycelium, a transparent spire with thick wall conidiophores appeared from the mycelium. These conidiophores end with the clavate-shaped vesicle, and a thickness completely covered with single layered privacy, each one of them holds a series of spherical and spiny rough conidiophore as in (Figure 4.3).Colonies of A. flavus appeared radial, and the conidiophores produce copious spherical or hemispherical conidia, similar to that have been shown by Kebeish and El-sayed, (2012). Phialides appear as arranged uniseriate upper vesicle conidia and parallel to the axis of conidiophore. They are produced in chains of spores basipetally from phialides. The chains of spores were borne directly on broadly clavateshaped vesicles in the presence of metal and represented by septet and branching hyphae. These features completely correspond with the taxonomic key that
Results and Discussion
74
belongs to Aspergillus genera that were mentioned by Quinn et al. (2013) and Mohammed and Chala (2014).
Figure 4.3. Microscopic features of A. flavus stained with lactophenol cotton blue (40X)
4.3 Molecular analysis 4.3.1 Concentration and purity of extracted DNA from A. flavus isolates The total genomic DNA was extracted efficiently from study isolates of A. flavus by using DNA extraction by Wizard Genomic DNA Purification Kit (Promega, USA). Concentration and purity of DNA were measured by using nanodrop technique. The yield of extracted DNA from A. flavus isolates was in the range of (81-473) ng/µl with purity (1.6-2.0), (Table 4.2(. These results corresponded with the results obtained by Abdulateef et al.,(2014), who reported that the purity between (1.6-1.9) on the genetic diversity among some A. flavus isolates by using PCR. The process of extracting DNA from fungi is a complex process because it contains the cellular wall which composed of polysaccharide and chitin, the tissue is frozen in liquid nitrogen and then crushed using a mortar and pestle. Because of the tensile strength of the chitin and other polysaccharide comprising
70
Results and Discussion
the cell wall, this method is the fastest and most efficient way to access DNA with the A. flavus. The basic idea is that individual cells or masses of cells when frozen at very low temperatures (-196 C) which crack easily under low-impact force (Almakarem et al., 2012). In current study, DNA was precipitated by isopropanol then washed with washing buffer which contained ammonium acetate. Finally, the DNA was dissolved in TE buffer and preserved in -20°C (Moťková and Vytřasová, 2011). The total genomic DNA was shown in (figure 4.4). Table 4.2. DNA concentration and purity of each isolate after estimation by nanodrop technique. Isolate No. AFL1 AFL 2 AFL 3 AFL 4 AFL 5 AFL 6 AFL 7 AFL 8 AFL 9 AFL 10 AFL 11 AFL 12 AFL 13 AFL 14 AFL 15
Con. DNA (ng/ul) 81 185 433 246 187 405 360 232 264 254 377 473 115 440 95
Abs260
Abs 280
260/280
1.60 3.69 8.64 4.92 3.73 8.1 7.19 4.63 5.28 5.08 7.55 9.47 20 18.5 10.8
1 2.277 5.055 2.942 2.011 4.56 4.25 2.65 2.63 2.77 4.06 5.24 10.9 9.7 6.1
1.6 1.8 1.7 1.7 1.8 1.7 1.75 1.7 2 1.8 1.75 1.8 1.83 1.9 1.77
The present study showed that the used kit yielded a pure DNA ready for use in PCR according to that reported by Rittenour et al. ( 2015), and the results of DN A extraction from these isolates were good. In addition to that, the safety and the quality of the extracted DNA were estimated depending on the bands that appeared by using the electrophoresis on agarose gel with a concentration of 1% for an hour (Figure 4.4).
Results and Discussion
73
Figure 4.4. Agarose gel electrophoresis of total genomic DNA isolated that were extracted by a commercial kit (Wizard Genomic DNA Purification). Fragments were fractionated by electrophoresis on 1% agarose gel (1hr, 5v/cm, 1xTris borate buffer) and visualized under U.V light after staining with ethidium bromide.
4.3.2 PCR analysis It is well documented that there are many applications deal with techniques in AF studies. For example, molecular techniques have been used to differentiate among the complexities of the A. flavus, determine the phylogenetic analysis, as well as the features of isolates, and eventually reaching to the identification of aflatoxigenic isolates taken from clinical and environmental sources, in addition to the study of the diversity of the isolates in order to understand the non-aflatoxigenic ones of A.flavus )Navya et al., 2013(. Out of 15 isolates, 11 (73%) were positive for aflR gene and 11 (73%) were neither positive for nor 1 gene, while 10 (67%) isolates were positive for ver 1 gene. Applications of such researchers can be beneficial in revealing the effectiveness of the toxigenic isolates rapidly because of their further role as potential biocontrol agents (Rosada et al., 2013). Distinguishing between aflatoxigenic and non-aflatoxigenic isolates of A. flavus (15 isolates) through molecular processes is important because conventional methods are not completely reliable (Makni et al., 2011). Furthermore, the molecular
Results and Discussion
71
mechanisms that responsible for the loss of AF production by A. flavus are not clearly understood (Tudzynski, 2014). Earlier reports mentioned that non-aflatoxigenic isolates of A. flavus were mainly associated with the deletions of a part or entire AF gene cluster (Adhikari et al., 2016) and defects in the involved AF genes aflR, ver 1 and nor1 that were found in A.flavus isolates, which were taken from different sources. These genes were also responsible for their toxigenic, as well as many other reasons that were responsible for their non-aflatoxigenic and can form a large deletion in the AF gene cluster (Rouhani and Chang 2014; Ehrlich, 2014). Jiang and co-workers, (2009) reported that there was a huge fragment deletion in the AF cluster gene and a replacement of its location by a heterologous insert. The non-aflatoxigenic A.flavus isolates can be identified rapidly by the analysis of deletion within an AF gene cluster that considered an effective process (Yin et al., 2009). Thirty genes were identified that were clustered within a 75- kB DNA region of the chromosome were involved in the AF biosynthesis (Jahanshiri et al., 2012). PCR was applied by utilizing three sets of primers for various genes that are involved in AF biosynthetic pathway. PCR assay was used for detecting the aflatoxigenic aspergilli depending on the intermediated enzymes that consist of many enzymes including the norsolorinic acid reductase encoding gene nor 1, the versicolorin a dehydrogenase encoding gene ver 1, the sterigmatocystin and the of regulating gene
(Luque et al., 2012). Bands of the fragments that
belonged to the earlier genes can be seen at 1000, 600 and 400 bp, respectively. A different DNA banding patterns with many other bands were obtained from all examined aflatoxigenic and non-aflatoxigenic isolates of A.flavus. These bands were ranging from zero to three. And out of fifteen aflatoxigenic A.flavus isolates, ten isolates shown DNA fragments that corresponded with the complete set of genes, similar to that have been shown by Davari et al. (2015).
Results and Discussion
75
4.3.2.1 The role of nor1 (aflD) in synthesis of aflatoxin Amplification of nor 1 gene targeted by PCR and electrophoresis by agarose gel electrophoresis showed that out of 15 isolates of A. flavus, 11 (73%) isolates of them were positive for nor1 (aflD) gene, while 4 (27%) isolates were negative, see (Figure 4.5). With regard to the molecular analysis of studied isolates, nor1 gene is a structural encoding of an enzyme which is involved in one of the primary steps related to AF biosynthesis pathway.
Figure 4.5. PCR product with nor1 primer on 1.5 % agarose gel electrophoresis with ethidium bromide, M: 100 bp DNA ladder. Lanes: AFL1, AFL2, AFL3, AFL4, AFL5, AFL6, AFL7, AFL8, AFL9, AFL10, AFL11, AFL12, AFL13, AFL14, AFL15.
The absence of genes in their genome means that the isolates of A. flavus cannot produce AF. In other words, the absence of DNA amplification indicates the inability of this isolate to produce aflatoxin. The previous findings were corresponding with what mentioned by Rouhani and Chang, (2014). The gene nor1 plays a great role in the early conversion of the norsolorinic acid to averantin (in the middle of AF biosynthetic pathway) while other genes are involved in converting sterigmatocystin to AFB1 in the last step of the AF pathway (Jamali et al., 2013). Interestingly, the results of curront study suggested that expression of aflatoxin biosynthetic gene (nor1) in A. flavus occurs in both isolates that produce aflatoxin and those that do not. Possibly, there is a threshold level for expression of the relevant genes. Where genes are expressed above this threshold, aflatoxin production is induced. This would
Results and Discussion
71
explain our finding of significantly higher expression levels of aflatoxin biosynthetic genes in aflatoxigenic isolates than in non-aflatoxigenic isolates. This results of agree with Rodrigues et al. (2009). This research concluded that the possibility of neither using nor 1 gene as a good indicator to distinguish between aflatoxigenic and non-aflatoxigenic isolates. These results corresponded with Abdel-Hadi et al., (2010( study. In addition to neither that nor 1 gene expression was the major factor responsible for AF production. The same observation was documented by Iheanacho et al., (2014). This study suggested that the nor1 expression was not a potent marker for distinguishing between aflatoxigenic and non-aflatoxigenic isolates by testing 15 isolates as represented in figure 4.5, four of isolates, as nor 1 was presented in some non-aflatoxigenic isolates like AFL1 (4-5). The nor 1 was expressed by using some isolates of A.flavus on SDA. These isolates produced AFs. Many isolates of A. flavus were non-aflatoxigenic because of the mutations occur in one or many genes related to the biosynthetic gene cluster (Moubasher et al., 2016). The certainty that the transcription of nor1 has been revealed when a nonproducing isolates (Isolated after growing on fish No.1) grew and produced AFs which confirmed that nor1 transcription is considered to be a good marker for AF production, and mentioned that nor1 plays a major functional role in the adaptive growth on different types of media. This corresponded with AbdelHadi et al. (2011a) study. Interestingly, noticing that conducive amplicon on agarose gel is not a critical assay to confirm whether the isolates were aflatoxigenic or non-aflatoxigenic (Schmidt et al., 2009). 4.3.2.2 The ver 1 (aflM) gene involved in aflatoxin synthesis Amplification of ver 1 gene targeted by PCR showed that a total of 15 isolates, 10 (73%) isolates of A. flavus were positive for ver 1 gene. While 5 (33%) were negative, see figure 4.6. The presence of the ver 1 gene, which is in charge of the production of AF was shown in 10 (67%) isolates of the A. flavus
Results and Discussion
77
from a total of 15 isolates, where it was noticed that the the primer of 600 bp detected ver 1 gene fragment. This result corresponded with the findings of Hamed et al. (2016). The findings of these studies were in agreement with the results of previous studies on the chain of DNA sequence that belongs to the gene ver 1 appropriate design significant primer to diagnose fungi producing AFs (Fakruddin et al., 2015).
Figure 4.1. PCR product with ver 1 primer on 1.5% agarose gel electrophoresis with ethidium bromide, M: 100 bp DNA ladder. Lanes: AFL1, AFL2, AFL3, AFL4, AFL5, AFL6, AFL7, AFL8, AFL9, AFL10, AFL11, AFL12, AFL13, AFL14, AFL15][[
A good correlation between ver 1 gene detection and aflatoxin production was observed in all these isolates except (AFL1, AFL5, AFL10, AFL13 and AFL15) that lacking the ver 1 gene. The results of this study are also similar to those of previous studies which used same DNA sequence in the gene ver 1 for appropriate design special primer for diagnosing fungi that produce AFs which have shown that ver 1 transcription can be used as a marker to discriminate between aflatoxigenic and non-aflatoxigenic. It is believed that the ver 1 gene encodes an enzyme that encodes a ketoreductase that is required for the conversion of versicoloin A (VERA) to demethylsteri-gmatocystin (DMST) in AF biosynthetic pathway (Avicor et al., 2015). Disruption of the ver 1 gene in A.flavus showed in the results the accumulation of VERA, confirming the important function of the ver 1 in AF synthesis pathway. In the present study, most of the isolates show the presence
Results and Discussion
78
of ver 1 gene meaning that these isolates are able to convert VERA into DMST (Yu, 2012). Other studies showed the regularity of AF biosynthesis in A.flavus containing a complex pattern of positive and negative transcription regulating factors that were under the influence of nutritional and environmental parameters (Wang et al., 2017). 4.3.2.3 The aflR (regulatory gene) Amplification of aflR gene targeted by PCR and electrophoresis showed that out of 15 of isolates A. flavus 11 (73%) were positive for aflR gene while 4 (27%) were negative as reflected in figure 4.7. Currelnt results showed that of 10 isolates out of 15 had ability to produce AF through the gene aflR responsible for regulating the AF biosynthetic process, especially the site 1000 of this gene (Hashim et al., 2013) and the Iraqi isolates of A.flavus )Hussain et al., 2015( (figure 4.7) The regulatory gene aflR plays a major role in controlling the level of structural gene expression. Currelnt findings revealed that the regulatory gene (aflR) is involved in the AF biosynthesis with structural genes by regulating the activity of other structural genes such as ver 1 and nor1 (Abdel-Hadi et al., 2011b; Caceres et al., 2016). Genes are more important to detect and identify the aflatoxigenic Iraqi isolates of A.flavus fungus. These genes with other regulatory genes play an important role in the biosynthesis of AF pathway by regulating the activity of other structural genes. The aflR primer pairs were selected to detect the aflatoxigenic isolates of A. flavus in the PCR technique as a marker because this gene has importance in the biosynthesis of AF. Although these specific primers amplified, the expected bands from the isolates and great variability were found in their aflatoxigenic capacity tested by the HPLC method which showed that it was not a sufficient marker for differentiation between aflatoxigenic and some non-aflatoxigenic isolates. The lack of AF production could too be due to simple mutations
Results and Discussion
79
(substitution of some bases) which lead to the formation of nonfunctional products. Lack of AF production can apparently be related to the incomplete pattern obtained by PCR. This suggested different types of mutations that may have inactivated the AF biosynthetic pathway of these isolates (Moubasher et al., 2015; Singh et al., 2015; Moubasher et al., 2016) Correspondence of AFL1 isolated from fish did not show the aflR, nor 1 set of genes, in spite of the non-aflatoxigenic of this isolate. These results were in correspond with the results of Min et al., (2011), who revealed some strains of A. flavus. These certain strains showed a complete set of genes but they do not produce AFs. Gherbawy et al., (2015) declared various results by PCR and HPLC. They stated that although nor1, ver 1 and aflR genes were detected in every strain, some of these isolates were negative for AF detection. The results of our study and some other worcks indicated that amplification of aflR gene is a golden test to detect aflatoxigenic fungi.
Figure 4.7. PCR product with aflR primer on 1 % agarose gel electrophoresis with ethidium bromide, M: 100 bp DNA ladder. Lanes: AFL1, AFL2, AFL3, AFL4, AFL5, AFL6, AFL7, AFL8, AFL9, AFL10, AFL11, AFL12, AFL13, AFL14, AFL15.
Generally, aflR and nor 1 were the most prevalent genes in the isolates tested in this study. This gene was obtained from 11 isolates of A. flavus (out of 15) as shown in Table 4.3. nor 1, ver 1 and aflR were regained respectively from 11, 10 and 11 isolates of non-aflatoxigenic and aflatoxigenic isolates of A. flavus. In Italy, Criseo et al., (2008) examined 134 of aflatoxigenic strains of A. flavus isolated from food, officinal plants and feed in order to study the various genes involved in the pathway of AF biosynthesis.
82
Results and Discussion
Currelnt results indicated that aflR and nor 1 was the most representative out of the three AF genes, followed by ver 1 that was presented with similar frequencies compared with the two previous genes as in Table (4.3). The presence of aflatoxigenic of A.flavus in isolates indicated that further investigation is needed to be conducted for supervising and routine analysis. Furthermore, appropriate harvesting, drying, handling, transport and storage conditions need to be performed. Table 4.3. Frequency of single genes in A. flavus isolates collected from the clinical and environmental source. Isolate No. AFL1 AFL2
Isolate origin Fish Cow lung
Source of isolation Clinical
Aflatoxin genes aflR aflD aflM + +
Clinical
+
+
+
AFL3
Spices
Environmental
+
+
+
AFL4
Rice
Environmental
+
+
+
AFL5
Animal waste
Environmental
AFL6
Corn grain
Environmental
+
+
+
AFL7
Soil, black oil
Environmental
+
+
+
AFL8
Barley grain
Environmental
+
+
+
AFL9
Wheat
Environmental
+
+
+
AFL10
Bovine Milk
Environmental
AFL11
Fruits
Environmental
+
+
+
AFL12
Nuts
Environmental
+
+
+
AFL13
Poultry lung
Clinical
AFL14
Peanut seeds
Environmental
+
+
+
AFL15
Vegetables
Environmental
+ = PCR amplification signal present.
- = PCR amplification signal absent. The aflatoxin biosynthesis in A. flavus is strongly dependent on the activities of regulatory proteins and enzymes encoded by three genes aflR, nor 1 and ver 1. By using specific PCR-based methods, they proved that the aflatoxigenic A. flavus isolates always show the complete gene set, whereas nonaflatoxigenic isolates lacking one, two, or three (Min et al., 2011). PCR products
Results and Discussion
84
indicated that the genes do not exist in these strains or that the primer binding sites changed (Criseo et al., 2008).
4.4 The ability of A. flavus isolates to produce of spores It has been clarified from table 4.4 that there is a considerable variation in the number of fungal spores after culturing the fungus on slant SDA. The results showed that there was a gradual increase in the growth after an incubation period where the fungal isolates approached the highest level of growth on the fifth day. These results were consistent with what was mentioned by Singh et al. (2015). Although the fungal isolates were grown under the same conditions of temperature, moisture, and pH, these factors are considered the most important environmental factors that control growth, metabolism and differentiation in A.flavus (Medina et al., 2014). The statistical analysis of the number of spores produced by the clinical isolate of A. flavus recovered from animal lung (as it produced 71.00 x103 spores / mm3) as compared with other clinical isolates where there are 55.60 x103 spores/ mm3 and 44.60 x103 spores / mm3 from fish and poultry lung isolates, respectively revealed that there was a high significant difference at which P value was less than 0.05 as in Table 4.4. The reason for the superiority of the isolates obtained from the lung of animals infected with fungi (A. flavus), which produces the largest number of spores is due to the appropriate conditions that were available for this isolate such as temperature, moisture, pH and chronic obstructive pulmonary. This result was consistent with what was mentioned by Shatty et al. (2011) beside numerous studies in the world have shown that A.flavus belongs to the saprophytic fungi that prevail in the respiratory tract, and this was confirmed by Paulussen et al. (2016). So the respiratory tract is considered a suitable place for the growth of this fungus after the continuous exposure to the spores of A. flavus (Khan and Karuppayil, 2012).
80
Results and Discussion Table 4.4. Origin of isolates and numbers of the produced spores Isolate number
Isolate origin
AFL1 AFL2 AFL3
Fish Cow lung Spices
AFL4 AFL5 AFL6 AFL7 AFL8 AFL9 AFL10 AFL11 AFL12 AFL13 AFL14 AFL15 LSD
Rice Animal dung Corn grain Soil, black oil Barley grain Wheat grain Milk Fruits Nuts Poultry lung Peanut grain Vegetables --* (P < 0.05)
Number of spores (x103/mm3 ± SE) 55.60 ± 2.68 71.00 ± 3.41 95.05 ± 3.98 56.00 ± 2.16 38.00 ± 1.46 50.60 ± 1.86 54.25 ± 2.13 41.05 ± 2.64 40.00 ± 2.07 52.35 ± 2.09 52.35 ± 2.63 30.02 ± 1.79 44.60 ± 2.54 78.00 ± 3.55 44.30 ± 2.39 11.205 *
Number of spores (x103/mm3 ± SE)
95.05
100 90
78
80
71
70 60 50 40
55.6
56
50.6 38
54.25
52.35 52.35 44.6
41.05 40
44.3
30.02
30 20 10 0 AFl1 AFl2 AFl3 AFl4 AFl5 AFl6 AFl7 AFl8 AFl9 AFl10 AFl11 AFl12 AFl13 AFl14 AFl15
Figure 4.8. Numbers of the produced spores by different isolates.
It has been clarified that the fish isolate produced 55.60 x103 spores/mm3, as the cause of the isolates activity in producing this number of spores which is due to its ability to withstand extreme conditions, as its ability to grow in the
Results and Discussion
83
marshland waters that may not be suitable for the growth of other species, see Table 4.4. Some researchers indicated that Indonesian dried fish after isolating the fungus, where they noticed that A. flavus isolates produced a number of spores after culturing them on the selective media (Immaculate et al., 2015). These findings were also consistent with the findings of Hassan et al. (2011) who noticed that the activity value of fish that lives in salty environments is low, which encourages the growth of halophile molds such as A.flavus, as well as the exposure of fish to the air, dust and various environmental conditions making them vulnerable to various kinds of molds. This agrees with the results that were mentioned by Dorostkar and Mabodian (2011). The environmental source isolates gave fluctuation in the number of spores as observed clearly in isolate no. AFL3, which gives high no. of spores (95.05 x103/mm3). This may be attributed to the isolates activity which was promoted by an availability of ideal conditions for the growth of A. flavus such as moisture, temperature and pH as mentioned by Kulshrestha et al., (2014). The isolate obtained from peanut produced a high rate of spores reached to 78.00 x103/mm3 with a significant superiority over all the other environmental isolates. The isolate AFL12 produced the lowest rate of the spore numbers which were 30.02 x103 spores/mm3. This result is consistent with many studies that have confirmed the existence of the differences between the activities of the environmental isolates in production spores. This was attributed to the fact that peanut contains a range of nutrients that support the growth of fungus and its spores, and thus have an impact on the production of metabolic products of the fungus, especially the AFs. This result was in agreement with what reported by Sultan and Magan, (2010); Rajarajan et al. (2013) and Valverde et al. (2013). It has been noticed that the ability of the isolate obtained from rice to produce of spores has outperformed significantly over the isolates (AFL 15, AFL 8, AFL 9, AFL 5 and AFL 12) in the production of spores with a rate of 56.00 x103 / mm3, but they didn't differ significantly (P > 0.05) from the isolates
Results and Discussion
81
(AFL7, AFL10, AFL11 and AFL6). The isolate activity in the production of the spores is due to the presence of the aleurone layer that contains high levels of lipids and it is the preferred site of growth and reproduction in A.flavus. These findings were inconsistent with those mentioned by Yan et al. (2012). The results of the study revealed that isolate AFL7 which was taken from soil contaminated with black oil was significantly outperformed in giving a high rate of spores number that reached to 54.25x103 spores/mm3 compared with isolates (AFL8, AFL9, AFL5, and AFL12) which significantly differ from each other which produced lower levels of this trait. The reason is that the isolate AFL7 has the superiority on the other isolates due to the activity of this isolate which depends on breaking the hydrocarbon compounds and turning them into simple substances such as water and carbon dioxide and other intermediate compounds that used by fungi as a mono source of carbon and energy. This result was inconsistent with what was reported by Adegunlola et al. (2012) and Hasan, (2014). The isolates which have been obtained from milk and fruits were significantly outperformed in the production of spores in a rate of 52.35 x103 spores/mm3 over the rest of isolates (AFL8, AFL9, AFL5 and AFL12). The reason behind these isolates activity and ability to produce spores was the high moisture and nutrients of milk which make it a suitable medium for the growth of A. flavus. The fungus also has the ability to live in a high thermal range that may reach to 43ºC. Since it is one of the opportunistic molds with small nutritional requirements, it is easy for this fungus to grow in a different temperature degree and moisture in addition to asexual reproduction and producing thousands of diploid conidia. The present study was consistent with what was reported by Beley et al. (2013) and Dheeb et al. (2015). The result revealed that isolate AFL6 which has been obtained from corn grain has also significant differences over the isolates AFL 5 and AFL 12 in a production of the spores with a range of 50.60 x103/mm3 but they weren't
Results and Discussion
85
different significantly from the isolates AFL15, AFL8 and AFL9. Houshyar et al. (2014) pointed out that the corn seeds may have a fungal infection if they are exposed to fungi that existed in the field, and then the seeds stored after harvesting and exposed to moisture and temperatures appropriate for the fungus growth and producing its spores. The isolates that have been obtained from the vegetables, barley and wheat have given convergent rates in the number of spores as it reached to 40.00 x103, 41.05 x103, 44.30x103/mm3, respectively where the isolates that gave these rates (41.05, 44.30 x103/mm3) were outperformed significantly the isolate that gave the lowest rate in producing spores, where the activity of these isolates is due to the ability of this fungus to secrete a large number of enzymes that lysate food that utilized in the nutrition and growth as well as increasing the capacity of its spread especially that some types of this fungus can grow in low moisture content as well as the relative density of the produced spores and the present study was inconsistent with those observed by Abdelwehab et al. (2014) and Fountain et al. (2014). Low production of spores in isolate AFL5 may be attributed to diversity fungal isolates dung and competition between fungi that appear on the dung and succession organizer in addition to the weakness of cellulose in the dung. This finding was in agreement with Mungai et al., (2011) and Alberto et al., (2016). The reduced number of spores produced by isolate 12 was related perhaps to the correct storage conditions or to the process of salting which may cause the reduction ratio of fungi that grow on seeds, and this result was consistent with Rostami et al., (2009) and Ostadrahimi et al. (2014).
4.4 Culturing of fungal spores on rice to produce AFB1 From the previous results and after determining the number of spores produced by each isolate of A. flavus which were considered to be the main fungus that causes AFB1 production, million spores from each isolate were put in a beaker of 300 ml which contains the sterilized rice that is one of the most
Results and Discussion
81
appropriate foods for fungal contamination because it has a high content of carbohydrates, where A.flavus has been grown in a vast thermal range, and the minimum levels of temperatures have reached to 6 – 8 ºC and the optimum tempereture degree reached to 25 – 28 ºC. Above that the maximum temperetur tempruture levels were between 44 – 46 ºC (Kosegarten et al., 2016 and Mukhtar et al., 2016). In addition to that, Pratiwi et al. (2015) reported that AFB1 was not produced at a temperature less than 20 ºC and more than 35 ºC. The best temperature degree for producing AFB1s is between 24 – 32ºC. The incubation period that is needed to make the fungus grow on its medium has its effect on the quantity that was produced. Karazhiyan et al. (2016) suggested that the highest quantity of AFB1 can be obtained from 5 to 21 days after the fungus growth and then with the increase of incubation period, the AFB1 production decreased where the metabolic reactions of the fungus affected with the occurrence of oxygen. In addition to fact that the production of AFBI from A. flavus decreased intensively with the decreasing of oxygen concentration, the pH of the medium tended to acidity or neutrality, and it may result from the stimulation of the gene that is responsible for producing these mycotoxins in the medium which allowed A. flavus to grow with low levels of pH (Avicor et al., 2015). The growth of fungal spores in rice appeared through 4-5 days after the formation of mycelium at 6 days, where the fermentation happened in fermentation flask used to the experience and after two days white spots appeared on the rice grains. On the third day, the rice color changes to yellowish. In the fourth day, it changes into a light brown that is similar the color of wheat grains as represented in Figure (4.9). The previous result was inconsistent with what has been mentioned by Demet et al (1995) and attributed to the fermentation process that led to the change in the physical and chemical properties and the deterioration of the
Results and Discussion
87
contents of the nutrients in rice. A bad smell appeared, especially if the fungal isolates were from the type that produces AF (toxigenic fungi). This result was in agreement with what was mentioned by Keller et al., (2012).
Figure 4.9. Inoculated rice (left); a flask of fermented rice (right): allowed to stand for 6 days with shaking by hand once a day.
4.5 The HPLC technique for detection the potentiality of A. flavus to produce AFB1. There is a variation in the production of AFB1 for the isolates that are responsible for producing AFB1 as shown in table 4.5. These isolates were examined using HPLC techniques with the ultraviolet radiation detector at a wavelength of 365 nm. The results showed the ability of most isolates of A. flavus to produce AFB1 as it gained the value of the retention time (RT) for each of the inoculated sample extract and the sample of the standard solution B1 (7.30) minutes as in Appendix: (1). The results of the study revealed that 10 isolates of A.flavus had the ability to produce AFB1. The isolate which was taken from cow lung was significantly dominated in giving the highest rate for the clinical isolates that reach to (11.66 ppm) compared to the isolates that were taken from fish and poultry lungs which did not produce AFB1. This disability may be due to
Results and Discussion
88
genetic diversity among the isolates. The isolate that produces AF has the gene that encodes for the production of AF, while the two isolates that were not able to produce AF which lack the gene that expresses this production or maybe there a mutation in that specific site that led to altering the site of the gene that is responsible for producing AF. This result was in agreement with Adhikari et al. (2016) and Cristina et al. (2017). In addition to the factors that increase the metabolic processes of the fungus, such as age, immune impairment and malignant diseases associated with certain chronic pulmonary disease, which is a favorable environment for the production of AF. They provide for the fungus the ability to overcome the basic defensive lines of the host, they also contribute in damaging in invade tissues (Awuor et al., 2016). The toxicity degree of the produced AF would be higher when it is inhaled through the respiratory tract compared to case when ingested through the mouth. When a single dose is administered by inhalation to be sufficient to induce an infection, it takes more than a single dose to cause the same changes when given by mouth (Patterson and Strek, 2014). Results of statistical analysis in table 4.5 showed the predomination of most of the isolates that produced and isolated from environmental sources over the clinical isolates in producing AFB1. It was also noted from the table that the isolate taken from peanut field was predominant over all isolates with a concentration reached to (45.03 ppm). This may be due to the fact that A. flavus has the ability to produce the highest rate of AFB1 when the isolates grow on peanut field that is the original substrate for the growth of fungus and the AF production (Sabet et al., 2016) as the production of AF may be affected by food consumed by the fungus. The peanut is considered as a rich nutritional environment of fat and represents a kind of pressure in producing AF (Yu, 2012) and the lipase genes are also a mainstay and they are indirectly related to the expression of AF by providing the basic substance for them (acetate) in the synthesis of AFB1 (Lee et al., 2016).
89
Results and Discussion
Table 4.5. Comparison between different isolates (isolate origin) in Co. AFB1 in HPLC Isolate AFL1 AFL2 AFL3 AFL4 AFL5 AFL6 AFL7 AFL8 AFL9 AFL10 AFL11 AFL12 AFL13 AFL14 AFL15 LSD value
Isolate origin Fish Cow lung Spices Rice Animal waste Corn grain Soil, black oil Barley grain Wheat Bovine Milk Fruits Nuts Poultry Lung Peanut seeds Vegetables --* (P
