Jul 1, 1988 - controlling the synthesis of molecules involved in neuronal signaling, especially neuropeptides. Proenkephalin, vasoactive intestinal ...
MOLECULAR AND CELLULAR BIOLOGY, Oct. 1988, p. 4225-4233
Vol. 8, No. 10
0270-7306/88/104225-09$02.00/0 Copyright © 1988, American Society for Microbiology
A Common trans-Acting Factor Is Involved in Transcriptional Regulation of Neurotransmitter Genes by Cyclic AMP STEVEN E. HYMAN,l.2* MICHAEL COMB,"3 YOUNG-SUN LIN,4 JOSEPH PEARLBERG,' MICHAEL R. GREEN,4 AND HOWARD M. GOODMAN"3
Department of Molecular Biology, Massachusetts General Hospital, Boston, Massachusetts 021141; Department of Psychiatry, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 021152 and Department of Genetics, Harvard Medical School,3 and Department of Biochemistry and Molecular Biology, Harvard University, Cambridge, Massachusetts 021384 Received 23 February 1988/Accepted 1 July 1988
Activation of neurotransmitter receptors can regulate transcription in postsynaptic cells through the actions of second messengers. Trans-synaptic regulation of transcription appears to be an important mechanism controlling the synthesis of molecules involved in neuronal signaling, especially neuropeptides. Proenkephalin, vasoactive intestinal polypeptide, and somatostatin have been shown to be transcriptionally regulated by the second messenger, cyclic AMP (cAMP), as has the catecholamine synthesizing enzyme tryosine hydroxylase. cAMP-inducible elements have been mapped within these genes, and trans-acting factors which bind to several such elements have been identified. With the discovery that individual neurons generally contain multiple transmitters within their synaptic terminals, it has become important to understand in detail the mechanisms by which the synthesis of transmitters can be coregulated. Here we compare the structure and function of the proenkephalin cAMP-inducible enhancer with the mapped cAMP-inducible elements of the vasoactive intestinal polypeptide, somatostatin, and tyrosine hydroxylase genes and a putative cAMP-inducible element in the proto-oncogene c-fos. We have previously shown that the proenkephalin enhancer is composed of two different elements, ENKCRE-1 and ENKCRE-2. We show here that one of these, ENKCRE-2, is structurally similar to elements found within the vasoactive intestinal polypeptide, somatostatin, and tyrosine hydroxylase genes and binds a trans-acting factor that is competed for both in cotransfection experiments (in vivo) and in DNase I footprint assays (in vitro) by these other elements. The c-fos element has similar structural requirements to confer transcriptional induction by cAMP but competes less strongly. Protein purified by affinity chromatography with the ENKCRE-2 sequence binds to each of these elements. A second element within the proenkephalin cAMP-inducible enhancer, ENKCRE-1, binds a factor that is not competed for by these other genes and is therefore distinct. This analysis suggests a potential mechanism of transcriptional coregulation of the neuronally expressed genes investigated in this study and also demonstrates that multiple factors are involved in transcriptional activation by cAMP.
PC-12 cell line (in response to nicotinic cholinergic stimulation) (13) and to be cAMP inducible (28). cis-acting elements required for transcriptional activation by cAMP have been identified within a variety of genes. cAMP response elements (CREs) containing the 5-base core sequence CGTCA have been mapped by deletion analysis in the human proenkephalin (2), human VIP (34), rat somatostatin (25), rat TH (19), and human glycoprotein hormone alpha subunit genes (8, 30). Certain of these elements, e.g., that within the proenkephalin gene (6), have been shown to be constituents of enhancers, modular arrays of sequence elements that stimulate accurate initiation of transcription without strict requirements for distance or orientation with respect to the promoter (22). Such sequence elements serve as binding sites for trans-acting factors that are involved in regulation of transcriptional activity. Factors that interact with some of the CGTCA-containing elements involved in transcriptional activation by cAMP have recently been identified and, in some cases, purified (8, 19a, 24). Purified transcription factors AP-1 and AP-4, initially identified by their interactions with the simian virus 40 promoter, have been shown to bind to the CGTCA-containing sequence within the proenkephalin gene (Comb et al., submitted). A factor called CREB, which binds to the cAMP-inducible element of somatostatin, has been purified (24). ATF, a
The synthesis of proenkephalin (the precursor of the opioid peptides Met- and Leu-enkephalin) (27), vasoactive intestinal polypeptide (VIP) (34), somatostatin (25), and the catecholamines (1) can be stimulated by increased levels of the intracellular second messenger cyclic AMP (cAMP). In the case of neuropeptide synthesis, it appears that the primary effect of cAMP is at the level of transcription (6, 7). The effects of cAMP on catecholamine biosynthesis are more complex, including both transcriptional induction (32) and posttranslational modification (1) of the rate-limiting enzyme, tyrosine hydroxylase (TH). With the discovery that multiple transmitters, including both peptides and small molecules, coexist within synaptic terminals, a more precise understanding of the mechanisms of coregulation of transmitter production and secretion is needed. Of particular interest from the point of view of coregulation by cAMP is the coexistence of proenkephalin, catecholamines, and somatostatin in adrenal medullary chromaffin cells (21) and in cells of the nucleus locus coeruleus (4). Other cells within the adrenal medulla contain additional peptides, including VIP (20). In addition to these neurotransmitter-related genes, the proto-oncogene c-fos has been shown to be trans-synaptically inducible in the rat pheochromocytoma *
Corresponding author. 4225
4226
MOL. CELL. BIOL.
HYMAN ET AL. ENKCRE-1
Proenkephalin
cFOS
-114
ENKCRE-2
r,r,r,r,r,r,r,r, r, MMT,2n,Wr, r,r,r. rYr-,?WTI!A",r, r.Tr,r, A
-332 CCCCCTTACACAGGATGTCCATATTAGGACATCTGCGTCAGCAGGTTTCCACGGC
VIP
Somatostatin
-94
-71
-278
-70
CCCATGGATGGACT TGACGTC'
GTGAGATCTGGGGGCGCCTCCTTGGC
-80
AGAGAGAGTT
-27
-71 TH IC>GCCTGGCCI -27 AGGAGGTGGGGGACCCAGAGGGGCII FIG. 1. Sequence similarities of the CREs of the proenkephalin (6), VIP (34), somatostatin (25), and TH (18) genes and of a region of the c-fos gene (33). The ENKCRE-1 and ENKCRE-2 elements of the proenkephalin gene, within which single-base substitutions (Comb et al., submitted) markedly decrease responsiveness to cAMP, are shaded, as are CGTCA-containing core sequence within the CREs of the other genes. In the promoter-proximal element of VIP the sequence is on the minus strand from nucleotides -72 to -76.
factor which interacts with five CGTCA-containing sites within the adenovirus E4 promoter, has also been shown to interact with the CRE regions of VIP, TH, and somatostatin (19a), although it does not confer cAMP induction on the E4 promoter (K. Lee and M. R. Green, manuscript in preparation). Evidence reported elsewhere suggests that ATF and CREB may be identical (19a). In addition to CGTCA-containing sequences, cAMP and phorbol ester induction of transcription may be conferred by a dissimilar sequence. It has recently been reported to be that multiple copies of an oligonucelotide containing the sequence CCGCCCGCG, derived from the human metallothionein IIA promoter, can confer both cAMP- and phorbol ester-inducible transcription on the human beta-globin promoter (15). This sequence has been shown to interact with the transcription factor AP2 (15, 23). Single-base substitution analysis of the cAMP and phorbol ester-inducible enhancer found within the proenkephalin gene revealed two elements sensitive to single-base substitutions (Comb et al., submitted) (Fig. 1). The element distal to the TATA box, ENKCRE-1, is located between -104 and -98 base pairs upstream of the RNA cap site and contains the sequence TGGCGTA; it is essential for cAMP-regulated transcription. The second element, ENKCRE-2, is located between nucleotides -92 and -86 and contains the sequence TGCGTCA; it is essential for both basal and regulated transcription (Comb et al., submitted). Purified AP2 has been shown to interact with the proenkephalin gene between ENKCRE-2 and the TATA box (between nucleotides -80 and -65) (23). By itself this AP2-binding site confers no activity on the proenkephalin promoter, since a plasmid containing a deletion to nucleotide -84 (pENKAT-A84, Fig. 2A and B) contains the AP2-binding site but is transcriptionally inactive. This site does, however, appear to act synergistically with the ENKCRE-1 and ENKCRE-2 sites to increase the transcriptional response to cAMP (S. E. Hyman, M. Comb, J. Pearlberg, and H. M. Goodman, submitted for publication). There is a high degree of sequence similarity between the ENKCRE-2 element and the other CREs shown in Fig. 1. In addition to these known CREs, the c-fos gene contains an
element adjacent to its serum-responsive enhancer (31) that has 11 out of 12 bases identical to the ENKCRE-2 region of proenkephalin. Although the c-fos gene is inducible by cAMP (17), the functional role of this ENKCRE-2-like element in c-fos gene regulation is unknown. We have examined (i) the structure and function of the similar (CGTCA-containing) elements known to be required for cAMP induction in the genes encoding proenkephalin, VIP, somatostatin, TH, and the structually similar element in the c-fos gene and (ii) the possibility that the trans-acting factors that interact with these elements are the same. The evidence from this and other studies suggests that the ENKCRE-1 and ENKCRE-2 elements of proenkephalin interact with different factors but that a common factor interacts with ENKCRE-2 and the CGTCA-containing sequences of the VIP, somatostatin, and TH genes and, under certain circumstances, with the c-fos gene. In addition, results from mutational analysis and in vivo (cotransfection) competition experiments suggest that this factor is essential for transcriptional activation by cAMP. MATERIALS AND METHODS
Oligonucleotides and plasmids. Oligonucleotides were synthesized on an Applied Biosystems DNA synthesizer. Unless otherwise stated, the wild-type sequences (Fig. 1) were as follows: VIP bases -94 to -70 of the human sequence, somatostatin bases -71 to -27 of the human sequence, TH bases -61 to -32 of the rat sequence, and c-fos bases -332 to -278 of the human sequence. Mutated sequences are as shown in Fig. 3. In addition, all oligonucleotides had PstIcohesive ends added to allow cloning (G on the 5' end and CTGCA and the 3' end). To construct fusion plasmids, oligonucleotides were ligated into the PstI sites at proenkephalin nucleotide -80 in pENKAT-A84 or pomc nucleotide -80 in pPOMCAT-A84. (Fig. 2A). The number and orientation of oligonucleotides within plasmids was confirmed by the double-stranded sequencing method of Chen and Seeburg (5). The plasmid pENKAT-12 described previously (6) contains human proenkephalin sequences from bases -193
COMMON FACTORS IN cAMP-REGULATED TRANSCRIPTION
VOL. 8, 1988
-84
I
-60
3
1
4227
1
I
ptVCI B -40
I
-20 I
I|
+1
I
GGGGCTMATATAAAGTGGCTCCAGCAGCCGTTAAGCCCCG
FIG. 2B
FIG. 2A
INDUCTION OF CAT ACTIVITY
12 3 4 5 6
BY
FORSKOUN/IMX PROMOTER
ENHANCER
HUMAN ENK
MCUSE P0MG
.s
ENKEPHALIN
am
12 3.0
SOMALTOSTATIN
40
9.3
23
32
FOS
2.2
7.5
ENHANCEFESS
1.0
1.6
FIG. 2C
FIG 2D
FIG. 2. (A) Structure of pENKAT-A84. Symbols: U, noncoding exons from the human proenkephalin gene; -, regulatory sequences, introns, and 3' flanking sequences from the proenkephalin gene; U sequences encoding CAT; M pUC18 sequences; O, portion of the pUC18 polylinker extending from the EcoRI site to the PstI site. All of the oligonucleotides described were cloned into this unique PstI site. Construction of this plasmid has been described previously (6). The plasmid pPOMCAT-A84 differs in that the 5' enkephalin sequences have been replaced by bases -84 to + 174 of the mouse proopiomelanocortin gene. This plasmid has also been described previously (6). (B) Human proenkephalin 5'-flanking sequences contained within pENKAT-A84. The bases from -65 to -80 constitute a binding site for the transcription factor AP2 (23; Hyman et al., submitted). (C) S1 analysis of RNA from pools of C6 glioma cells transfected with the VIP-pENKAT-A84 fusion plasmid (lanes 1 and 2), somatostatin-pENKAT-A84 (lanes 3 and 4), and c-fos-pENKAT-A84 (lanes 5 and 6). RNA was from untreated cells (lanes 1, 3, and 5) or cells treated with 25 ,uM forskolin and 0.5 mM IMX (lanes 2, 4, and 6). The bands are at the expected positions for transcipts correctly initiated from the human proenkephalin promoter. (D) Transient analysis of CAT activity in CV-1 cells. The values shown represent fold induction of CAT activity above basal in response to treatment with forskolin and IMX for 6 h. Each CRE was tested by linking an oligonucleotide containing a single copy to the human proenkephalin and the mouse proopiomelanocortin promoters within the plasmids pENKAT-A84 and pPOMCAT-A84, respectively. Data were normalized for transfection efficiency by using P-galactosidase activity.
to +70 with respect to the mRNA cap site fused to chloramphenicol acetyltransferase (CAT)-coding sequences. Cell culture and regulator treatment. Rat C6 glioma cells and CV-1 cells (derived from green monkey) were grown in Dulbecco modified Eagle medium supplemented with 10% fetal calf serum. Regulator treatment of cells consisted of the adenylate cyclase agonist, 25 ,uM forskolin, and 0.5 mM 3-isobutyl-1-methylxanthine (IMX), a phosphodiesterase inhibitor. CV-1 cells were used for transient analysis and cotransfection competition because of their greater transfection efficiency and ability to tolerate large doses of DNA; C6 glioma cells were used for stable analysis (6) because of the rapidity with which stable lines could be developed. In transient expression assays of (i) pENKAT-12 in HeLa, C6 glioma, and CV-1 cells and (ii) the fusion plasmid VIPpPOMCAT-A84 in C6 glioma and CV-1 cells, no significant differences were found in fold induction of CAT activity by forskolin and IMX across cell lines for each plasmid (data not shown). Transient and stable analysis of gene expression. Transfection of CV-1 cells was performed with CaPO4-precipitated DNA as previously described (12). For transient analysis of CAT expression, 5 ,ug of the CAT fusion plasmid was cotransfected with 10 p.g of pUC18 as a carrier and 10 ,ug of
(11), which carries the P-galactosidase gene linked to the Rous sarcoma virus promoter-enhancer. After glycerol shock, cells were incubated for 16 h in medium containing 10% fetal calf serum. Regulators were then added, and cells were harvested 6 h later. Plates (10 cm) of cells were washed with phosphate-buffered saline and scraped in phosphate-buffered saline into a 1.5-ml microfuge tube. The cells were pelleted for 1 min, suspended in 100 [lI of a lysis buffer containing 0.25 M Tris (pH 7.5)-0.5% Triton X-100, and pelleted for 10 min. The supernatant was assayed for CAT activity by incubating 25% of the extract with a cocktail of 3 mM butyryl coenzyme A (Pharmacia Fine Chemicals), 9 ,uCi of [14C]chloramphenicol (54 ,uCi/mmol; Amersham Corp.) per ml, and 2.5% glycerol in 0.25 M Tris (pH 7.5) for 2 h at 37°C and then extracted with a 2:1 mixture of pristane (Aldrich Chemical Co., Inc.) xylenes and (J. T. Baker Chemical Co.). The butyrylated chloramphenicol was extracted into the organic (upper) phase, which was counted in scintillation fluid (B. Seed and J.-Y. Sheen, Gene, in press). ,-Galactosidase activity was determined on another 25% of the cell extract as previously described (10) to control for differences in transfection efficiency among different precipitates. Stable lines were produced by cotransfecting 8 x 105 C6
pRSVPGal
4228
HYMAN ET AL.
MOL. CELL. BIOL. FOLD INDUCTION OF CAT ACTIVITY WITH FORSKOLIN + IMX
LINKED TO THE MOUSE POMC PROMOTER
ENHANCERLESS
A
1.7
B
9.1
C
3.8
D
9.0
VIP -94 CCCATGGCCGTCATACTGTGACGTC -70
-A T
T T
|
0
T T
C
T
T
E
9.0
F
9.0
G
1.7
H
1.7
SOMATOSTATIN -74
GTGAGATCTGGGGGCGCCTCCTTGGCTGACGTCAGAGAGAGAGTT -27
3.0
T
J
1.7
K
7.5
L
18
C-FOS
-332
CCCCCTTACACAGGATGTCCATATTAGGACATCTGCGTCAGCAGGTTTCCACGGC T
-278
FIG. 3. Transient expression of CAT activity in CV-1 cells directed by wild-type and mutated CRE oligonucleotides ligated into pPOMCAT-A84 (described in Materials and Methods). Values represent fold induction of CAT activity above basal in response to 6 h of treatment with forskolin and IMX. The CREs tested were the sequences shown in the figure with the addition of PstI-cohesive termini, which allowed cloning into the PstI site of pPOMCAT-A84. Data were normalized to P-galactosidase activity (11).
glioma cells with both 20 ,g of a CAT fusion plasmid and 5 ,g of pRSVNeo (14, 31), which expresses the dominant selectable marker, neomycin resistance. Two days after transfection, normal medium was replaced with selective medium containing 500 p,g of G418 per ml. Under these conditions 25 to 50% of G418-resistant colonies expressed the unselected CAT plasmid. Approximately 1,000 independent colonies were pooled from each transfection. Equal numbers of cells from these pools were used for each experiment. Control and induced cells were harvested 2 h after the addition of regulators. Total RNA was isolated by washing plates in phosphate-buffered saline, scraping into 1.5-ml microfuge tubes in phosphate-buffered saline, spinning for 1 min in the cold to recover the cells, and suspending the cell pellet in 500 ,ul of 50 mM Tris (pH 8.0)-100 mM NaCl-5 mM MgCl2-0.5% (vol/vol) Nonidet P-40. After a 5-min incubation on ice, nuclei were spun out in the cold for 2 min. The supernatant was transferred to a new tube, brought to 0.2% in sodium dodecyl sulfate, and extracted with phenol-chloroform (1:1) until there was no interphase. The aqueous phase was then precipitated with sodium acetate and ethanol. RNA was hybridized with a single-stranded probe from the 5' untranslated region of the human proenkephalin gene and subjected to Si analysis (27). Cotransfection competitions. Competitions were performed by transient analysis in CV-1 cells. This differed from our usual method of transient analysis only in the amount of DNA transfected. Each plate received a precipitate containing a total of 112.5 ,ug of DNA made up of an indicator plasmid (2.5 Kg of either pENKAT-12 or the VIP-pPOMCAT-A84 fusion plasmid), an excess of the competitor plasmid, 10 ,ug of pRSVPGAL, and pUC18 to make the total. This amount of total DNA had been previously determined neither to be toxic to the cells nor to affect the reproducibility of CAT expression.
Preparation of nuclear extracts and affinity-purified proteins. Small-scale nuclear extracts were prepared from 2 to 5 g of HeLa cells by the method of Dignam et al. (9). For protein purification, large-scale nuclear extracts were prepared from HeLa S3 cells (9) grown in spinner culture in 7.5% horse serum. The purification was performed by affinity chromatography as described by Kadonaga et al. (16). The affinity column was produced by using sequences from the proenkephalin gene spanning nucleotides -93 to -85 (ENKCRE-2) with the addition of BamHI-compatible termini: gatcggCTGCGTCAGgg. Nuclear proteins binding the ENKCRE-2 element were purified by three sequential passes over the affinity column. The activity of the eluted protein was approximately 1 footprint unit per ng of protein, where 1 footprint unit is defined as the amount of protein required to protect 10 fmol of DNA probe from DNase I digestion. DNase I footprinting. Probes were end labeled with [a32P]dATP by using Moloney murine leukemia virus reverse transcriptase (Bethesda Research Laboratories, Inc.) at 37°C. Footprint competitions with the proenkephalin probe were performed as previously described by Lee et al. (17). Competitor promoter fragments were used at 100-fold molar excess over the probe. The E4 fragment contains a single CGTCA-binding site (19a). For the footprints shown in Fig. 6 and 7, the temperature at which the probe was incubated with nuclear extracts was 0°C. For the VIP-proenkephalin probe, competitor oligonucleotides were used at 250-fold molar excess over the probe. RESULTS of Regulation heterologous promoters by CREs. We compared the functional activity of different CGTCA-containing cAMP-responsive elements when they were linked in an
VOL. 8, 1988
COMMON FACTORS IN cAMP-REGULATED TRANSCRIPTION
identical configuration to the same promoters. Based on the reported minimal elements needed to reconstitute cAMPinduced gene expression, we synthesized double-stranded oligonucleotides for the human VIP and somatostatin elements and, in addition, synthesized a portion of the 5'flanking region of the human c-fos gene, which includes the region of similarity to the human proenkephalin ENKCRE-2 element and the contiguous serum-inducible element (33). Since the presumed cAMP-inducible element of TH is identical in sequence and position relative to the TATA box to that for somatostatin, and since the somatostatin element has been mapped in greater detail, we did not repeat this part of the analysis for TH. The synthetic oligonucleotides contained the sequences shown in Fig. 1 with the addition of PstI-compatible termini at both ends. These were ligated into the PstI site of plasmids containing truncated (enhancerless) derivatives of fusion genes containing either the human proenkephalin or the mouse proopiomelanocortin promoter linked to the bacterial CAT transcription unit and human proenkephalin polyadenylation sequences. These plasmids, pENKAT-A84 and pPOMCAT-A&84 respectively, are shown in Fig. 2A and B. Plasmid pENKAT-A84, which lacks the proenkephalin cAMP-inducible enhancer, produces no correctly initiated transcripts basally or in response to cAMP. Without additional sequences, pPOMCAT-A84 produces a small amount of correctly initiated transcription basally and produces a 1.7-fold induction of CAT activity when treated with forskolin and IMX. When ligated into the PstI site of pENKAT-A84, which is 80 base pairs upstream of the normal proenkephalin mRNA cap site, each of the synthetic oligonucleotides confers correctly initiated basal and cAMP-regulated transcription on the proenkephalin promoter as demonstrated by S1 analysis of RNA isolated from pooled stably transfected C6 glioma cells (Fig. 2C; see Materials and Methods). Transient analysis of CAT expression directed by each of these CRE-containing oligonucleotides ligated into either pENKAT-A84 or pPOMCAT-A84 paralleled the inductions seen by Si analysis (Fig. 2D) but underestimated the degree of induction of correctly initiated transcription because of a constant amount of readthrough transcription originating in vector sequences. The enkephalin and VIP elements conferred greater inductions in response to cAMP than the somatostatin element. Mutational analysis: a critical role for the CGTCA core sequence. To investigate the structural requirements of the cAMP-inducible elements in greater detail, mutations were made in each of the elements based on predictions derived from a mutational analysis of human proenkephalin CRE (Comb et al., submitted). If each of these elements conferred cAMP induction by interacting with the same trans-acting factor(s), similar point mutations should have similar functional consequences. Based on analysis of the proenkephalin ENKCRE-2 element, the hypothesis to be tested was whether the CGTCA sequence would be critical for the functioning of each element. Synthetic oligonucleotides with base substitution mutations within the CGTCA elements were synthesized with PstI-compatible termini and ligated into the PstI site of pPOMCAT-A84. The results of stimulation by the cAMP agonists forskolin and IMX are shown in Fig. 3. No single-point mutation within the VIP element completely inhibited cAMP induction, unlike the case for mutations within the ENKCRE-1 or ENKCRE-2 domains of proenkephalin (Comb et al., submitted). It is possible that the two CGTCA-containing regions within VIP can interact in such a way as to compensate for a single-base substitution. Since the promoter-proximal VIP element has no A at
4229
nucleotide -69, we hypothesized that the critical CGTCA is on the opposite strand. Since an A-to-T change at position -86 of proenkephalin (the A in the CGTCA motif of ENKCRE-2) completely inhibits cAMP induction (Comb et al., submitted), we made the analagous T-to-A change at position -76 of VIP (resulting in an A-to-T change in the CGTCA on the opposite strand; line C in Fig. 3). This was the strongest down mutation that we were able to achieve by a single-point change in the VIP CRE. A single change in the upstream CGTCA element (A to T at position -82, line D) gave essentially wild-type expression, suggesting that the CRE could function with the downstream CGTCA-containing element alone. An A-to-T mutation at position -91, outside of the CGTCA-containing domains, was made as a control and had no effect on induction (line E). A double mutation involving bases -91 and -82 (line F) had little effect. In contrast, double mutations affecting both CGTCAcontaining elements within the VIP CRE decreased induction to the level of the enhancerless parent plasmid (lines G and H). Both somatostatin and c-fos have single CGTCAcontaining elements, although the somatostatin elemnent is palindromic (Fig. 1). Single A-to-T mutations at position -38 of somatostatin (line J) and -294 of c-fos (line L) within the CGTCA domains decrease the response to cAMP to the level of the enhancerless parent plasmid. These results confirm the functional importance of the CGTCA sequence in each of these CREs. Competition for shared trans-acting factors in vivo. Competition experiments were performed by cotransfecting pENKAT-12 (see Materials and Methods), an indicator plasmid which expresses high levels of CAT in response to cAMP, with excess competitor plasmids containing multiple copies of either the proenkephalin, VIP, somatostatin, or c-fos elements (Fig. 4). Plasmids were constructed by deleting the CAT-coding sequences and the 3'-flanking sequences from the pENKAT-A84 fusion gene (Fig. 2A) (to produce an enhancerless control plasmid) and then cloning three copies of a double-stranded oligonucleotide containing one of the CRE sequences shown in Fig. 1 into the PstI site of this control plasmid (to produce each of the competitor plasmids). The enhancerless control plasmid produced some decline in cAMP-induced transcription, presumably by competing for factors that bind to the common promoter region, e.g., AP2 (23) or the TATA box factor. Competitor plasmids differed from the control only by the addition of three copies of a CRE. cAMP-inducible CAT expression is potently diminished by cotransfection with increasing amounts of a plasmid containing multiple copies of the entire proenkephalin CRE. This suggests that a limiting positively acting factor essential for inducible transcription is titrated off the CATexpressing indicator plasmid by the competitor DNA. In a similar fashion, the VIP competitor plasmid diminishes expression of the proenkephalin indicator almost as strongly as the proenkephalin competitor itself. In a complementary experiment (data not shown), an excess of the proenkephalin competitor plasmid strongly diminished expression of the VIP-pPOMCAT-A84 fusion plasmid (cAMP induction shown in Fig. 2D). The somatostatin plasmid competes against pENKAT-12 less effectively than either the enkephalin or VIP plasmids, although at high molar excess competition was reproducibly demonstrated. The c-fos-containing plasmid only competed at the highest levels of excess and then only weakly. A competitor plasmid containing the nonfunctional VIP CRE double-point mutation (Fig. 3, line G) competed at the same level as the enhancerless control (data not shown).
4230
MOL. CELL. BIOL.
HYMAN ET AL. Indicator plasmid pEnkat-12 2.5 119
1 0%
z. 6 jr8 6
m
*m
z
80
.I
0
m
X
