A comparative study of ancient DNA isolated from ...

A comparative study of ancient DNA isolated from charred pea (Pisum sativum L.) seeds from an Early Iron Age settlement in southeast Serbia: inference for pea domestication Petr Smýkal, Živko Jovanović, Nemanja Stanisavljević, Bojan Zlatković, Branko Ćupina, Vuk Đorđević, Aleksandar Mikić, et al. Genetic Resources and Crop Evolution An International Journal ISSN 0925-9864 Genet Resour Crop Evol DOI 10.1007/s10722-014-0128-z

1 23

Your article is protected by copyright and all rights are held exclusively by Springer Science +Business Media Dordrecht. This e-offprint is for personal use only and shall not be selfarchived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.

1 23

Author's personal copy Genet Resour Crop Evol DOI 10.1007/s10722-014-0128-z

RESEARCH ARTICLE

A comparative study of ancient DNA isolated from charred pea (Pisum sativum L.) seeds from an Early Iron Age settlement in southeast Serbia: inference for pea domestication Petr Smy´kal • Zˇivko Jovanovic´ • Nemanja Stanisavljevic´ ´ upina • Vuk Ðord¯evic´ • Bojan Zlatkovic´ • Branko C Aleksandar Mikic´ • Aleksandar Medovic´

•

Received: 5 November 2013 / Accepted: 2 May 2014 Ó Springer Science+Business Media Dordrecht 2014

Abstract The development of agriculture was a key turning point in human history, a central part of which was the evolution of new plant forms, domesticated crops. Grain legumes were domesticated in parallel with cereals and formed important dietary components of early civilizations. First domesticated in the Near East, pea has been cultivated in Europe since the Stone and Bronze Ages. In this study, we present a molecular analysis of ancient DNA (aDNA) extracted from carbonized pea seeds recovered from deposits at Hissar, in southeast Serbia, that date to the eleventh century B.C. Four selected chloroplast DNA loci (trnSG, trnK, matK and rbcL) amplified in six fragments of 128–340 bp with a total length of

Electronic supplementary material The online version of this article (doi:10.1007/s10722-014-0128-z) contains supplementary material, which is available to authorized users. P. Smy´kal (&) Department of Botany, Faculty of Science, Palacky´ University in Olomouc, Sˇlechtitelu˚ 11, 783 71 Olomouc, Czech Republic e-mail: [email protected] Zˇ. Jovanovic´ N. Stanisavljevic´ Plant Molecular Biology Lab, Institute of Molecular Genetics and Genetic Engineering, University of Belgrade, P.O. Box 23, 11010 Belgrade, Serbia B. Zlatkovic´ Department of Biology and Ecology, Faculty of Sciences and Mathematics, University of Nisˇ, Visˇegradska 33, 18000 Nisˇ, Serbia

1,329 bp were successfully recovered in order to distinguish between cultivated and wild gathered pea. Based on identified mutations, the results showed that genuine aDNA was analyzed. Moreover, DNA analysis resulted in placing the ancient sample at an intermediate position between extant cultivated [Pisum sativum L. and wild P. sativum subsp. elatius (Steven ex M. Bieb.) Asch. et Graebn.]. Consequently, based on a combination of morphological and molecular data, we concluded that the material represents an early domesticated pea. We speculate that Iron Age pea would be of colored flower and pigmented testa, similar to today’s fodder pea (P. sativum subsp. sativum var. arvense (L.) Poir.), possibly of winter type. This is the first report of successful aDNA extraction and analysis from any legume species thus far. The implications for pea domestication are discussed here. B. Cúpina Department of Field and Vegetable Crops, Faculty of Agriculture, University of Novi Sad, Trg Dositeja Obradovicá 8, 21000 Novi Sad, Serbia V. Ðord¯evic´ A. Mikic´ Institute of Field and Vegetable Crops, Maksima Gorkog 30, 21000 Novi Sad, Serbia A. Medovic´ Museum of Vojvodina, Dunavska 35, 21000 Novi Sad, Serbia

123

Author's personal copy Genet Resour Crop Evol

Keywords Ancient DNA Archeogenetics Domestication Early Iron Age Legumes Pea

Introduction The development of agriculture was a key turning point in human history, a central part of which was the evolution of new plant forms, domesticated crops. Domestication occurs when cultivated plants consistently exhibit morphological (and genetic) changes not found in wild populations (Abbo et al. 2013, 2014). These resulting changes represent adaptations to cultivation and human harvesting. Common sets of traits have been recorded in unrelated crops, which are said to display domestication syndrome (Hammer 1984; Zohary and Hopf 2000). Similar human demands led to similar adaptations of many domestication traits over a wide range of plant species, thereby providing numerous examples of convergent phenotypic evolution (Lenser and Theißen 2013). These include two key traits: (1) loss of germination inhibition (dormancy) and (2) loss of seed dispersal. Members of the Fabaceae were domesticated as grain legumes in parallel with cereals and formed important dietary components of early civilizations (De Candolle 1884; Vavilov 1951; Hopf 1986; Smartt 1990; Zohary and Hopf 2000; Abbo et al. 2014). Among the first legumes domesticated in the Fertile Crescent were members of the galegoid tribe: pea, faba bean, lentil, grass pea and chickpea (Smy´kal et al. 2014). Archaeological evidence of pea in the Near East dates from 10,000 years before present (B.P.) (Baldev 1988; Zohary and Hopf 2000; Helbaek 1964, 1970; Fairbairn et al. 2002, 2005; Willcox et al. 2008) and suggests that the domestication of grain legumes accompanied or possibly preceded that of cereals (Baldev 1988; Kislev and Bar-Yosef 1988; Weiss et al. 2006). Rich etymological evidence also supports the status of pea as one of the most ancient Eurasian crops (Mikic´ 2012). Later on, cultivation of pea spread from the Fertile Crescent to southern Europe, where it has been cultivated since the Stone and Bronze Ages (Zohary and Hopf 2000), and westward through the Balkans (Kroll 1991; Borojevic´ 2006) to northern and western Europe. Pea cultivation also moved southward to Egypt and modern-day Sudan (7,000 years B.P.), eastward to Persia and India (4,000 years B.P.),

123

and to China (Makesheva 1979; Chimwamurombe and Khulbe 2011; Zohary and Hopf 2000; Hancock 2012). Despite of the crucial position of legumes as protein crops in the human diet, comparably little is known about their domestication. The removal of seed dormancy was by far the most important domestication trait in legumes (Ladizinsky 1985; Abbo et al. 2013, 2014). In the wild, many seeds exhibit dormancy and will only germinate after exposure to certain environmental conditions or after the seed coat has been physically damaged. In contrast, seeds produced by domesticated crops tend to germinate as soon as they are imbibed and planted; meaning seed dormancy was a potentially unwanted trait. Moreover, seed imbibition plays a crucial role in the ability to cook most grain legumes; it is often called hard-seededness due to the testa’s resistance to water permeability. Hence, reducing seed coat thickness led to a concurrent reduction of seed coat impermeability in all domesticated grain legumes (Werker et al. 1979; Smartt 1990; Weeden 2007). Seed dormancy was identified as a monogenic trait in lentil (Lens culinaris Medik., Ladizinsky 1985), lupine (Lupinus angustifolius L., Forbes and Wells 1968), yardlong (Vigna unguiculata (L.) Walp., Kongjaimun et al. 2012), rice bean (V. umbellata (Thunb.) Ohwi and Ohashi, Isemura et al. 2010), mungbean (V. radiata (L.) R. Wilczek, Isemura et al. 2012); associated with one to two loci in common bean (Phaseolus vulgaris L., Koinange et al. 1996); and with two to three loci in pea (Pisum sativum L., Weeden 2007). Ladizinsky (1987) argued that the low germination rates in wild pulses, particularly Lens, would have precluded successful cultivation due to their very low yields from planted seeds. He therefore suggested that hunter–gatherers must have recognized favorable wild mutants with quick germination from which to begin cultivation. That germplasm could have been part of a ‘pre-cultivation domestication’ process. Therefore, only after the seed dormancy-free mutation occurred could lentils be cultivated (Ladizinsky 1979; Weiss et al. 2006). The experimental harvest of wild lentils by Abbo et al. (2008) provided strong support for Ladizinsky’s (1979, 1985, 1987, 1998) arguments. This also holds true for pea, as intact wild pea seeds have a germination rate of only 2.6–7 % in a given year (Abbo et al. 2011, 2014). These results suggest that the free germination trait was a more important criterion for the adoption of a wild pea, lentil and possibly chickpea than their seed dispersal mode.


The second crucial domestication trait relates to the loss of fruit shattering, which has been under selection in most seed crops and resulted in better seed harvesting (Purugganan and Fuller 2009, Erskine 1985), whereas, shattering in wild plants is a fundamental trait to assure seed dispersal. The evolution of non-shattering would have occurred as a result of particular methods of harvesting that favored non-shattering mutants in harvested populations, which were then sown. Seed dispersal in wild legumes normally occurs via pod dehiscence. Central to the ballistic mechanisms of seed dispersal in pea is the dehiscent pod (single carpel fused along its edges), where the central pod suture undergoes an explosive rupturing along a dehiscence zone (Ambrose and Ellis 2008). Orthologous genes for seed shattering mechanisms and functions were identified to be purposefully conserved in mono and dicotyledonous plants (Konishi et al. 2006; Lenser and Theißen 2013) but not yet in legumes. Ladizinsky (1985) found that two different monogenic systems operated in crosses of Lens orientalis (Boiss.) Schmalh. and L. ervoides (Brign.) Grande, to cultivated lentil L. culinaris Medic. In the former, the allele for dormancy was dominant, while in the latter it was recessive. Moreover, the gene for dormancy in L. orientalis Popow appeared to be linked to one controlling pod shattering. The concurrent increase in the seed size of domesticates compared to that of their wild relatives is seen in almost all grains and even in forage legumes, and it has been suggested that this resulted from greater planting depth in agricultural systems leading to the selection of larger seeds that produced more vigorous seedlings, although this was recently refuted by Kluyver et al. (2013). Experimental in which wild peas and lentil were grown have demonstrated that both seed dormancy and pod dehiscence cause poor crop establishment via reduced germination, as well as dramatic yield losses via seed shattering (Abbo et al. 2011). These results were inconsistent with models suggesting the protracted domestication of Near Eastern grain legumes (Abbo et al. 2013). The genus Pisum contains the wild species P. fulvum Sibth. & Sm. found in Jordan, Syria, Lebanon and Israel; the cultivated species P. abyssinicum A. Braun from Yemen and Ethiopia, possibly independently domesticated of P. sativum; and a large aggregate of both wild [P. sativum L. subsp. elatius (Steven ex M. Bieb.) Asch. et Graebn.] and cultivated

forms of P. sativum subsp. sativum L. (Jing et al. 2010; Smy´kal et al. 2011, 2013, 2014; Ellis 2011). The current range of wild representatives of P. sativum extends from Iran and Turkmenistan through Anterior Asia, northern Africa, the Mediterranean region and southern Europe (Vavilov 1951; Makasheva 1979; Maxted and Ambrose 2001; Smy´kal et al. 2011, 2013, 2014). However, due to the early cultivation of pea, it is difficult to identify the precise location of the center of its diversity, especially considering that the large parts of the Mediterranean region and Near East have been substantially modified by human activities and changing climatic conditions since that time. Domesticated pea is thought to have originated from wild P. sativum subsp. elatius var. pumilio Meikle [formerly P. humile Mill. (P. syriacum (A. Berger) C. O. Lehm.] (Ben-Zeév and Zohary 1973; Ambrose 1995; Jing et al. 2010; Smy´kal et al. 2011), native to herbaceous formations in the open forest and in steppe habitats of the eastern Mediterranean. Together with faba bean, pea is the only legume species with robust growth (Zohary and Hopf 2000). However, when encountered in the wild, stands are extremely thin, comprising only few individuals (Abbo et al. 2013; Zlatkovic´ et al. 2010). Archeobotanical remains of legumes consist of charred seeds; therefore, in the absence of the remains of pods, pod indehiscence and seed dormancy are invisible (Abbo et al. 2014). However, the survival of fragmentary DNA in archaeological tissue has been recognized, and the first successful extraction of ancient DNA (aDNA) occurred nearly 30 years ago (Higuchi et al. 1984). To recognize the historical origin, the term aDNA was introduced, which denotes nucleic acid isolated from ancient specimens of plants, animals and humans (reviewed in Schlumbaum et al. 2008). aDNA was used in numerous studies devoted to the domestication of animals, including the origin of humans, and, to a lesser extent, to the analysis of plant material (Jones and Brown 2000). The aDNA has been recovered from charred wheat grains from dating to the Iron Age (Allaby et al. 1994), Neolithic dwellings (Schlumbaum et al. 2008), desiccated Egyptian barley (Palmer et al. 2009) or olive stones (Elbaum et al. 2006) to name a few. One of the main reasons such studies tend to disproportionately focus on animals is that while DNA in bones is relatively well preserved, it is less so in plant material, which is more prone to decay, with the exception of seeds.

123


Until now, crop domestication and plant archaeological studies focused largely on cereals, both due to the abundance of material and genetic information available (reviewed in Hancock 2012). Although genes underlying domestication traits in legumes have not yet been identified, the analysis of plastid-encoded genes can lead to inference on origin of plant material. In this study, we present an analysis of chloroplast encoded aDNA fragments to elucidate the identity of charred pea seeds from the Early Iron Age in comparison to modern cultivated and wild peas. This is the first report of successful aDNA analysis of any legume.

Materials and methods Archeobotany The fortified hill fort settlement Hissar in Leskovac is a multilevel settlement of the Brnjica cultural group, 1350–1000 B.C., Iron Age I in the Morava valley at southern Serbia (Stojic´ et al. 2007). The earliest occupation at Hissar is believed to have been by Neolithic cultures, Starcˇevo and Vincˇa. Moreover, Hissar was continuously inhabited throughout Eneolithic, Bronze Age, Iron Age, Roman, Byzantine, Serbian medieval and Turkish periods, the providing thus a continuous record of over 3,000 years of human activities. The hill (341 m alt.) is in a strategic position at a crossroads along the Jablanica and Veternica river valleys and along the Morava river valley. The site is very important for the precise chronological determination of the transitional period from the Bronze to the Iron Age. In addition to classical archaeological remains, the site has been sampled for plant remains since 1999 (Medovic´ 2005, 2012; Medovic´ et al. 2011). In 2005, a rich charred seed sample was gathered from a storage pit of the Brnjica II a-level (eleventh century B.C.). The volume of the subjectively taken sample was 7 liters. Earth substrate was packed in the plastic bag and transported to the Museum of Vojvodina, Novi Sad, Serbia. The flotation took place in 2006. The sieve with mesh size of 0.25 mm was used for the hand flotation. The sample was dried in shade and then packed in a paper bag. The dried, charred material weighed 121 g. The identification work was done in 2006 (Medovic´ et al. 2011).

123

Ancient DNA extraction Protocols for aDNA analysis were strictly followed (Gilbert et al. 2005). Extraction was carried out in dedicated laboratory, which had not been used previously to extract DNA from modern pea samples, physically isolated from PCR set up and post PCR analyses (in separate institutes). Extraction and amplification blanks were carried out in parallel, with each sample extraction and PCR analysis to ensure authenticity. All equipment was thoroughly cleaned with 70 % ethanol and DNA away solution (Molecular Bioproducts, UK) before processing to reduce the risk of contamination. The whole laboratory area, including PCR setup boxes and equipment, was UV irradiated before use. PCR setup was done in a forensic laboratory, in which modern plant material had never been analyzed. Protective clothing and gloves were worn at all times, and rigorous cleaning procedures were carried out (treatment with bleach, UV-irradiation), including the use of sterile tips with filter (Neptune, Schoeller) and dedicated chemicals and instruments. Two independent extractions of DNA from ancient material (500 mg, e.g. about 250 of charred seeds) were performed using a modified cetyltrimethylammonium bromide (CTAB) protocol (Doyle and Doyle 1987). Seeds were ground to fine powder in liquid nitrogen, with mortar and pestle, all UV treated and not used previously for any pea analysis. The powder was transferred to a 2 ml tube with preheated (65 °C) extraction buffer (2 % CTAB, 0.1 M Tris–HCl pH 8.0, 20 mM EDTA, 1.4 M NaCl and 1 % PVPP) and mixed thoroughly. The mixture was incubated for 3 days at 35 °C with agitation. After incubation, the mixture was centrifuged at 14,000 rpm for 10 min. The supernatant was removed, placed in a new tube and mixed with 500 ll of chloroform: isoamyl alcohol (24:1). Two phases were separated by centrifuging for 5 min at 14,000 rpm. The top layer was transferred into a new tube and centrifuged for 10 min at 14,000 rpm. The supernatant was transferred into a new tube and mixed with five volumes of AP3/E buffer (DNAeasy Mini Plant Kit, QIAGEN). The mixture was incubated at room temperature overnight. After incubation, the mixture was applied to Qiagen mini-spin column and processed according to the manufacturer’s protocol. Elution was performed with 100 ll of AE buffer, allowed to stand for more than 1 h, and DNA was recovered by centrifuging at


8,000 rpm for 1 min. Isolated DNA was quantified by NanoVue Spectrophotometer (GE Healthcare). Modern cultivated and wild pea material Several pea samples were included as comparative controls for sequencing analysis, namely wild collected [P. sativum subsp. elatius (Steven ex M. Bieb.) Asch. et Graebn.], from John Innes Centre, UK pea germplasm (JI1794, JI3147, 3155); specimens from the valley of the river Pcˇinja in far southeastern Serbia, near the Bulgarian and Macedonian borders (Zlatkovic´ et al. 2010); and one sample of P. abyssinicum A.Br. (JI1974), P. fulvum Sibth. et Sm. (JI1006), and cultivated (L0100001, L0100530) P. sativum subsp. sativum var. sativum L. or fodder pea (L0200201, L0200206) P.s.s. var. arvense (L.) Poir. accessions (Smy´kal et al. 2008, 2011). These accessions were purposely selected from a larger, ongoing biosystematics study of the Pisum genus (Smy´kal et al. 2011) to represent diverse haplotypes. DNA was extracted from young seedlings by DNAeasy Mini Plant Kit (QIAGEN, Germany) in accordance with the manufacturer’s instructions. PCR amplification and sequencing analysis Four genetic loci of chloroplast DNA were analyzed to capture informative single nucleotide polymorphic (SNP) sites. To assure amplification from fragmented aDNA, several short fragments of trnS(GCU)– trnG(UCC) intergenic spacer, tRNA-Lys (trnK)—maturase K (matK), ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) partial gene regions (128–333 bp) were amplified using specific primers (Generi Biotech, Czech Republic) in 20 ll PCR reaction (Table 1). In modern pea samples, larger (537–2,394 bp) fragments of respective genes were amplified (Table 1). These phylogenetically informative fragments were selected based on previous analysis of wild and cultivated pea samples, including related Vicieae tribe (Lathyrus, Vicia, Lens and Vavilovia) species (Kenicer et al. 2005; Smy´kal et al. 2011, unpublished; Schaefer et al. 2012; Mikic´ et al. 2013). Each reaction consisted of 1 unit of Phire Hot Start II polymerase (Finnzymes, Czech Republic), 19 supplier PCR buffer, 0.25 lM of each dNTP (Fermentas, Czech Republic), 0.5 lM of forward and reverse primers and 5 ll (about 5 ng) of aDNA

template. PCR amplifications were run at 2 min 98 °C initial denaturation, followed by 45 cycles of 98 °C for 30 s, 55 or 58 °C for 1 min and 72 °C for 1 min on a Gradient Master Cycler (Eppendorf, Germany) machine. Two negative controls were performed and included in each PCR run, one which contained all necessary PCR components except those of the template DNA, another with the template input from the blank extraction procedure. In separate reactions at a different institute, PCR amplification of extant pea material was performed, with amplification of entire fragments of respective genes. PCR products were subjected to 1.5 % NuSieve agarose gel electrophoresis in 19 TAE buffer, stained with ethidium bromide and visualized by UV light. Fragments of respective sizes were excised and purified using Invisorb Fragment CleanUp kit (Invitek, Germany). Finally, fragments were either directly sequenced or cloned into pJET 2.1 (Fermentas, Czech Republic) vector. Six clones per sample were sequenced using pJET 2.1 Forward and Reverse primers and BigDye terminator sequencing kit (Applied Biosystems, UK) at the DNA sequencing facility of Charles University, Prague, Czech Republic. Sequence visualization and editing were performed using Sequence Scanner version 1.0 (Applied Biosystems) and BioEdit Sequence Alignment Editor version 7.09.0 (Hall 1999) software. Sequences obtained from aDNA have been deposited in GenBank under accession numbers JX677840–JX677844, JX677866-67, and sequences of extant pea samples under accession numbers JX677845–JX677862. BLAST (Altschul et al. 1990) search and CLUSTAL alignment (Thompson et al. 1994) were performed to identify homologies. MEGA 5.05 software was used to compute and construct maximum likelihood (with Tamura-Nei model) and UPGMA trees using Maximum Composite Likelihood model (Tamura et al. 2007).

Results and discussion Morphological analysis of charred pea seeds The flotation yielded a total of 3,002 charred seeds and one-seeded fruits (Medovic´ et al. 2011). Small, rounded, ca. 3–4 mm large pulse seeds comprised almost 87 % of all charred plant items. Five hundred

123

Author's personal copy Genet Resour Crop Evol Table 1 Primer sequences, amplified regions and primer annealing temperature (Tm) used for the ancient and extant DNA analysis cpDNA marker

NCBI accession number

Forward primer sequence

Reverse primer sequence

Tm (°C)

Fragment length (bp)

tRNA-Lys (trnK) gene

JX677840

matK1L: ctcaatggtagagtactcggc

matK340R: gtataattagatgtggtaatcattc

58

340

Maturase K (matK) gene

JX677841

matK760F: cgatctagatctcgccaacaggac

matK1050R: gaggatttctgcctcctcgaagg

58

333

trnS–trnG intergenic spacer

JX677842

trnSGF1: caaaaccgaacgtgaaacttttg

trnSG128R: cattaattgtattcataccgaaagg

55

128

trnS–trnG intergenic spacer ribulose-1,5-bisphosphate

JX677843

trnSG530F: ggattcttgatccaattgcaaaaac

trnSG758R: caataatggtattgtagcgggt

55

253

Carboxylase/oxygenase (rbcL) gene

JX677844

rbcLF: atgtcaccacaaacagagactaaag

rbcLR1: ccaggaacaggctcgatctcgtagc

55

275

Maturase K (matK) gene

matK1L: ctcaatggtagagtactcggc

trnK2R: aactagtcggatggagta

55

2,394

trnS–trnG intergenic spacer ribulose-1,5-bisphosphate

trnSF: catcgcccttagcttgggcgt

trnGR: ctttagtccactcagccatctctc

58

1,562

Carboxylase/oxygenase (rbcL) gene

rbcLF: atgtcaccacaaacagagactaaag

rbcLR2: gtaaaatcaagtccaccacg

55

537

Ancient DNA

Modern pea DNA

seeds maintained pea-like hilum. The pea sample from Hissar was fairly free of admixtures of other pulses. Only 32 seeds of lentil (L. culinaris Medik.), bitter vetch (Vicia ervilia (L.) Willd.) and faba bean (Vicia faba L.) were observed and their identity clearly determined (Medovic´ et al. 2011). There are three Pisum subspecies or varieties expected to grow in the area. They differ in the shape and size of their hilum, although some overlap exists. The hilum of P. s. subsp. sativum var. arvense (L.) Poir. is ovoid or oval, and is the smallest among these three subspecies. The hilum of P. s. subsp. sativum L. makes up 1/14-1/10 of the seed’s circumference, while the elliptic hilum of P. s. subsp. elatius (Steven ex M. Bieb.) Asch. et Graebn., makes up 1/8-1/6 of the seed’s circumference (Bojnˇansky´ and Fargasˇova´ 2007). The ‘‘coffee-beanshaped hilum’’ (Kroll 1983) of the Early Iron Age seeds at Hissar match the description of the second subspecies listed above, cultivated P. s. subsp. sativum L. However, the bulk of the pulse seeds in material had no hilum. Charred pea seeds with preserved hilum were 3–4 mm long and 2.5–3.8 mm wide. They were broad ellipsoid (84.38 %) to globose (15.63 %). Length/Width (L/W) index of broad ellipsoid seeds was above 1 in 78.13 % cases, and only 6.25 % of

123

seeds were wider than they were long. The ‘‘naked’’ pea seeds had almost the same values: 2.8–4.5 mm long, 2.5–4.2 mm wide, broad ellipsoid (85.29 %) and sometimes globose (14.71 %). Among broad ellipsoid ‘‘naked’’ seeds, L/W-index was above 1 in 75.53 % of cases and under 1 in 11.76 % of cases. The seeds of cultivated fodder pea, P. s. var. arvense (L.) Poir., are also ellipsoid, but mostly globose to angular, while seeds of wild pea, P. sativum subsp. elatius (Steven ex M. Bieb.) Asch. et Graebn., are globose (Bojnˇansky´ and Fargasˇova´ 2007). Generally, the seed shape of peas depends on their position and space within a pod (Kroll 1983); however, this characteristic is not reliable in charred pea seeds, nor can seed size be used as a determining factor in distinguishing the three specimens of pea. In early finds, there was considerable overlapping in the dimensions of wild and domesticated forms (Weiss and Zohary 2011). Consequently, the most reliable morphological indication of domestication in peas was provided by the surface of the seed coat (Weeden 2007). Wild peas are characterized by a rough or granular surface, while domesticated varieties have smooth seed coats (Helbaek 1970; Weiss and Zohary 2011). However, only few pea seeds at Hissar displayed preserved, intact


smooth-surfaced testa, as the cultivated-type seed coat was retained in small fragments on less than one fifth of the recovered seeds. Seed coat was preserved mostly in the embryonic axis area and occasionally inside the concavities of the seeds. Comparative DNA analysis with wild Pisum species and cultivated pea The extraction procedure of approximately 250 seeds (500 mg) yielded 80 and 120 ng of isolated nucleic acids, as estimated spectrophotometrically. This amount likely included DNA that had been subject to microbial and fungal contamination. The extractions had to be performed from bulk rather than single seeds, considering the age, damage and presumed amount of DNA preserved in the sample. The use of bulk samples is well documented and has been used in numerous paleogenetic studies (Vahdati Nasab 2010; Allaby et al. 1994, 1999; Li et al. 2011). Consequently, we assume that several seeds contributed to the obtained results. As described in the archaeological section, seeds have been carefully identified to prevent admixture of any other legume species. Even so, any of the amplified DNA fragments were sufficient to identify the sample with a given species, so we could exclude any Vicia or Lathyrus sp. We have not been able to systematically test amplification success or amplicon length, since only a limited amount of DNA was available. Three to four independent amplifications from two independent extractions were performed for each marker, and the results of amplification success are summarized in Supplementary Table 1. These indicate that with the increasing length of amplicon there was a decrease in amplification, with failures from 290 bp. This result supports our assertion that we have analyzed genuine aDNA. Two regions of 340 and 333 bp lengths were successfully amplified from the matK-trnH gene, 128 and 253 bp of trnS-G gene and 275 bp fragment of rbcL gene, from two extractions, while negative controls did not yield any detectable product. In order to authenticate aDNA results, the products of independent amplifications from each DNA extraction were cloned and sequenced. Although we attempted to amplify selected nuclear encoded gene fragments, including part of bHLH (Mendels A) gene for pea flower color (Hellens et al. 2010), the convicilin gene for seed storage protein (Saénz de Miera et al. 2008)

and the phylogenetically informative internal transcribed spacer (ITS) of rDNA (Polans and Saars 2002), we failed to amplify any of these regions irrespective of fragment size. This likely indicates both extensive DNA degradation of extracted aDNA and/or minor quantity, which, together with single- or low-copy number (except of ITS, which is present in thousands of copies in genomes), prevented successful PCR amplification. This contrasts the preliminary study on the same material performed by Jovanovic´ et al. (2010), which obtained a 26S DNA fragment, although it was not sequenced. We also commonly experienced such failures on herbarium vouchers older than 40–50 years (not shown). This contrasts to results obtained in cereals (Banerjee and Brown 2002). Whether this reflects the differences between legumes and cereals in genome size and ploidy is a question for further study. Generally, in the case of charred and aged archaeological material, extensive DNA damage often prevents single-copy gene amplification. Selected chloroplast DNA regions are sufficiently phylogenetically informative (Palmer et al. 1985; Kosterin and Bogdanova 2008) and more successful in amplification, likely due to the greater number of copies and the circular character of the plastid DNA molecule. There was no difference between the six sequenced clones from the respective independently amplified regions in SNP sites. BLAST search and CLUSTAL alignment confirmed homologies to expected regions of Pisum. There were five informative SNPs in trnK, matK sequences, four SNPs in trnSG, and one SNP in rbcL (Fig. 1, Electronic Supplementary material S1). There were several additional substitutions (12 or 14 SNP in trnSG, 1 SNP in trnK, matK, 2 SNPs in rbcL fragment) likely attributed to damaged DNA or to polymerase errors (Binladen et al. 2006). Since the majority (12) of these 16 substitutions in 1,329 bp sequence were of type two transitions (C to T, G to A), it supports the evidence of amplification of truly ancient and not modern pea DNA. Such substitutions result from deamination of cytosine (and 5-methyl cytosine) to uracil (and thymine), which have been shown previously to be associated with post mortem damage (Binladen et al. 2006; Ho et al. 2007). The regions containing these unique mutations were excluded from the MEGA clustering analysis, since these 16 extra SNPs would result in a severe distortion of the results. This approach is justified, as we have not attempted any

123


Fig. 1 Fragments alignment of amplified ancient and extant (John Innes germplasm and sample from Serbia, Pcˇinja river) pea chloroplast trnK, matK, trnSG and rbcL genes with

indicated polymorphic sites. Numbers indicate position of the fragments with reference to modern pea DNA

phylogenetic study; we instead seek to infer on the origin of the pea seeds. Data showed that extant [P. sativum subsp. elatius (Steven ex M. Bieb.) Asch. & Graebn.] is composed of two groups (Smy´kal et al. 2011, 2013), one represented by JI1794 of P. sativum subsp. elatius var. pumilio Meikle (syn. Pisum humile Mill.), which is hypothesized to belong to the group of the putative ancestor of cultivated pea (Ben-Zeév and Zohary 1973; Ambrose 1995; Smy´kal et al. 2011, 2013, 2014), while another, represented by JI3151, is identical to cultivated pea P. sativum subsp. sativum L. (Figure 2). Two other species, P. abyssinicum A.Br. and P. fulvum Sibth. & Sm., are clearly separated (Fig. 2). The discrimination between wild and domesticated material is complicated, as there is currently no known single-marker (gene) to do so. Without an identified gene underlying domestication traits in legumes, including pea, we may only speculate about its origins. Moreover, there is a continuum among domesticated and wild P. sativum subsp. elatius/sativum complex (Jing et al. 2010; Smy´kal et al. 2011, 2014). All this agrees with studies by Jing et al. (2010) and Kosterin and Bogdanova (2008) performed using various marker types. The additional P. sativum subsp. elatius JI3147 accession is distinct, with intermediate position. Interestingly, the aDNA sample is different both from wild and cultivated peas, even when only phylogenetically informative sites are considered (e.g. with excluded SNPs related to post mortem damage). This makes ancient pea samples closer to wild than to modern cultivated pea (Fig. 2). Fragments of trnSG and rbcL were the most informative, and, in both analyzed aDNA samples, these sequences were identical (except in extra SNPs) to P. sativum subsp. elatius JI3147, which is true wild tall pea. It has large (20–30 mm), bicolor flowers with dark violet keels

and long peduncles (2–49 longer than stipules) with 2 flowers per node and producing large pods (50–80 9 10–12 mm). Leaflets are (1) 2–4 paired, ovate-elliptic, and subdentate. This subspecies has a chromosomal translocation difference from cultivated P. sativum, but it is inter-fertile, although some nucleo-cytoplasmatic conflict has been reported in specific crosses (Bogdanova et al. 2009, 2012). The second wild subspecies, P. sativum subsp. elatius var. pumilio Meikle, formerly P. humile Mill., in our analysis, represented by JI1794, has shorter internodes (20–40 cm stem length), shorter peduncles, smaller (40–45 9 7–10 mm) and often pigmented pods, and small flowers (15–18 mm). This is the presumed ancestor of cultivated pea. According to the ‘lost’ crops rationale, the Israeli southern P. humile Mill. populations may serve as evidence for a past pea domestication center (Abbo et al. 2013). Although it displays traits typical of wild pea (e.g. fully dehiscent pods, camouflage seed coloration, and strong (*90 %) seed dormancy mediated by water-impermeable seed coats), these southern P. humile Mill. never invade adjacent, less disturbed habitats (Abbo et al. 2013). It must be mentioned that extant wild P. sativum subsp. elatius (Bieb.) Aschers. and Graebn collected in southern Serbia, around 70 km from the Hissar locality (Zlatkovic et al. 2010) has a cpDNA haplotype identical to that of the JI3151 accession. On the other hand, owing to the high substitution rate in the trnSG region, we might speculate on a closer affinity to cultigen rather than to wild peas. In the ongoing study of the Pisum genus biogeography (Smy´kal unpublished), the wild P. sativum L. complex falls into two main groups, while P. abyssinicum A.Br. and P. fulvum Sibth. & Sm. were separated. Importantly, all tested cultivated pea accessions showed only one cpDNA haplotype,

123

Author's personal copy Genet Resour Crop Evol P elatius-JI3151 Cultigen P sativum(humile)JI1794 Ancient P elatius-JI3147 P abyssinicum-JI1974 P fulvum-JI1006

0.025

0.020

0.015

0.010

0.005

0.000

Fig. 2 UPGMA dendrogram for composed trnSG, trnK, matK and rbcL data. Real seed testa pigmentation and flower color are shown for extant and hypothesized for ancient pea sample. In case of cultivated Pisum sativum subsp. sativum both varieties:

arvense (fodder pee, colored flower and pigmented testa) and var. sativum (dry seed pea, white flowering, and no pigmented testa) are shown. (Color figure online)

suggesting a single domestication origin (Kosterin and Bogdanova 2008; Smy´kal unpublished). Moreover, there is substantial difference from any Vicia, Lathyrus or Lens sequences in each of the amplified fragments (Kenicer et al. 2005; Schaefer et al. 2012; Mikic´ et al. 2013); thus, any seed heterogeneity can be excluded or would be under the detection limit. Finally, although included in the analysis, it was obvious that charred seeds should not be P. fulvum Sibth. & Sm., which was never used for human feed or animal feed and does not grow in the Balkans, and DNA analysis confirmed that. Similarly, P. abyssinicum A.Br. is not considered to be found in that given area. Taken together, aDNA analysis suggests that our ancient pea seeds might represent an early domesticated form distinct from extant wild and cultivated peas.

assumed that the seeds could have been gathered in the wild rather than cultivated. However, even when collected in sufficient quantities, seed testa permeability will prevent proper imbibition of wild peas, resulting in impaired cooking ability, palatability and digestibility. Based on a molecular analysis of recovered aDNA, we found that the material used in our study was not wild pea; rather, it represents early pea domesticates. We speculate that Iron Age pea would be of colored flower and pigmented testa, similar to today’s fodder pea [P. sativum subsp. sativum var. arvense (L.) Poir.], possibly of winter type. Although charred pea seeds were found in many archeological sites previously, this is the first report of ancient pea seeds DNA analysis.

Conclusion Although pea served as one of the founding crops of Neolithic agriculture, a lucky find of 2,572 pea seeds in the Hissar settlement is unique in southeastern Europe. Pea from Hissar was a distinct crop, stored separately from others. Archeobotanically, the bulk of the peas recovered at eleventh century B.C. settlement at Hissar belongs to cultivated pea. Several morphological characteristics indicate this: the smooth surface of the seed coat, the ‘‘coffee-bean-shaped’’ hilum, the broad ellipsoid seed shape, the small size difference between seeds and the high 1,000-grain weight of charred seeds. However, since wild or semi-wild pea species can be found today in the area, it could be

Acknowledgments This work was supported by the projects 173005, 173030, 31016 and 31024 of the Ministry of Education and Science of the Republic of Serbia, and SEELEGUMES-168 within the EU programme SEE-ERA.NET. P.S. acknowledges funding from Grant Agency of Palacky´ University in Olomouc, IGA PrF-2013-003. The authors cordially thank Noel Ellis, Ge´rard Duc for useful suggestions, Milorad Stojic´ for providing archeobotanical material and Clarice Coyne for manuscript style improvement.

References Abbo S, Zezak I, Schwartz E, Lev-Yadun S, Gopher A (2008) Experimental harvesting of wild peas in Israel: implications for the origins of Near East farming. J Arch Sci 35:922–929. doi:10.1016/j.jas.2007.06.016 Abbo S, Rachamim E, Zehavi Y, Zezak I, Lev-Yadun S, Gopher A (2011) Experimental growing of wild pea in Israel and its bearing on Near Eastern plant domestication. Ann Bot 107:1399–1404. doi:10.1093/aob/mcr081

123

Author's personal copy Genet Resour Crop Evol Abbo S, Lev-Yadun S, Heun M, Gopher A (2013) On the ‘lost’ crops of the neolithic Near East. J Exp Bot 64:815–822. doi:10.1093/jxb/ers373 Abbo S, Pinhasi van-Oss R, Gopher A, Saranga Y, Ofner I, Peleg Z (2014) Plant domestication versus crop evolution: a conceptual framework for cereals and grain legumes. Trends Plant Sci. doi:10.1016/j.tplants.2013.12.002 Allaby RG, Jones MK, Brown TA (1994) DNA in charred wheat grains from the Iron Age hillfort at Danebury, England. Antiquity 68:126–132 Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215:403–410. doi:10.1016/S0022-2836(05)80360-2 Ambrose MJ (1995) From Near East centre of origin the prized pea migrates throughout world. Diversity 11:118–119 Ambrose MJ, Ellis THN (2008) Ballistic seed dispersal and associated seed shadow in wild Pisum germplasm. Pisum Genet 40:5–10 Baldev B (1988) Origin, distribution, taxonomy, and morphology. In: Baldev B, Ramanujam S, Jain HK (eds) Pulse crops. Oxford and IBH, New Delhi, pp 3–51 Banerjee M, Brown TA (2002) Preservation of nuclear but not chloroplast DNA in archaeological assemblages of charred wheat grains. Anc Biomol 4:59–63. doi:10.1080/ 1358612021000010659 Ben-Zeév N, Zohary D (1973) Species relationship in the genus Pisum L. Israel J Bot 22:73–91 Binladen J, Wiuf C, Gilbert TP, Bunce M, Barnett R, Larson G, Greenwood AD, Haile J, Ho SYW, Hansen AJ, Willerslev E (2006) Assessing the fidelity of ancient DNA sequences amplified from nuclear genes. Genetics 172:733–741. doi:10.1534/genetics.105.049718 Bogdanova VS, Galieva ER, Kosterin OE (2009) Genetic analysis of nuclear-cytoplasmic incompatibility in pea associated with cytoplasm of an accession of wild subspecies Pisum sativum subsp. elatius (Bieb.) Schmahl. Theor Appl Genet 118:801–809. doi:10.1007/s00122-008-0940-y Bogdanova VS, Galieva ER, Kosterin OE (2012) Inheritance and genetic mapping of two nuclear genes involved in nuclear-cytoplasmic incompatibility in peas (Pisum sativum L.). Theor Appl Genet 124:1503–1512. doi:10.1007/ s00122-012-1804-z Bojnˇansky´ V, Fargasˇova´ A (2007) Atlas of seeds and fruits of central and East-European Flora: the Carpathian Mountains region. Springer, Dordrecht Borojevic´ K (2006) Terra and Silva in the Pannonian plain. Opovo agro-gathering in the late neolithic. Archaeopress, Oxford Chimwamurombe PM, Khulbe RK (2011) Domestication of food legumes. In: Aditya P (ed) Food legumes. CABI. ISBN:9781845937669 De Candolle A (1884) The origin of cutlivated plants. London, K. Paul, Trench Doyle JJ, Doyle JL (1987) Rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11–15 Elbaum R, Melamed-Bassudo C, Boareto E, Galili E, Lev-Yadun S, Levy AA, Weiner S (2006) Ancient olive DNA in pits: preservation, amplification and sequence analysis. J Archeol Sci 33:77–88. doi:10.1016/j.jas.2005.06.011 Ellis THN (2011) Pisum. In: Kole C (ed) Wild crop relatives: genomic and breeding resources. Springer, Berlin, pp 237–248

123

Erskine W (1985) Selection for pod retention and pod dehiscence in lentils. Euphytica 34:105–112. doi:10.1007/ BF00022869 Fairbairn A, Asouti E, Near J, Martinoli D (2002) Macrobotanical evidence for plant use at Neolithic Çatalhoÿu¨k south-central Anatolia, Turkey. Veget Hist Archaeobot 11:41–54. doi:10.1007/s003340200005 Fairbairn A, Near J, Martinoli D (2005) Macrobotanical investigations of the north, south and KOPAL areas at Çatalhoÿu¨k. In: Hodder I (ed) Inhabiting Çatalhoÿu¨k: reports from the 1995–1999 seasons. Cambridge/Ankara: McDonald Institute for Archaeological Research, Cambridge, pp 137–201 Forbes I, Wells HD (1968) Hard and soft seededness in Blue Lupine, Lupinus angustifolius L.: inheritance and phenotype classification. Crop Sci 8:195–197. doi:10.2135/ cropsci1968.0011183X000800020018x Gilbert MTP, Bandelt HJ, Hofreiter M, Barnes I (2005) Assessing ancient DNA studies. Trends Ecol Evol 20:541–544. doi:10.1016/j.tree.2005.07.005 Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/ NT. Nucleic Acids Sci 41:95–98 Hammer K (1984) Das Domestikationssyndrom. [The domestication syndrome]. Kulturpflanze 32:11–34 Hancock JF (2012) Plant evolution and origin of species, 3rd edn. CABI, Wallingford Helbaek H (1964) First impressions of the Çatal Huÿu¨k plant husbandry. Anatol Stud 14:121–123 Helbaek H (1970) The plant husbandry of Haçilar. In: Mellaart J (ed) Excavations at Haçilar. Edinburgh University Press, Edinburgh, pp 189–244 Hellens RP, Moreau C, Lin-Wang K, Schwinn KE (2010) Identification of Mendel’s white flower character. PLoS One 5:e13230. doi:10.1371/journal.pone.0013230 Higuchi R, Bowman B, Freiberger M, Ryder OA, Wilson AC (1984) DNA sequences from the quagga, an extinct member of the horse family. Nature 312:282–284. doi:10. 1038/312282a0 Ho SY, Heupnik TH, Rambaut A, Shapiro B (2007) Bayesian estimation of sequence damage in ancient DNA. Mol Biol Evol 24:1416–1422. doi:10.1093/molbev/msm113 Hopf M (1986) Archaeological evidence of the spread and use of some members of the Leguminosae family. In: Barigozzi C (ed) The original and domestication of cultivated plants. Oxford, Elsevier, pp 35–60 Jing R, Vershinin A, Grzebyta J, Shaw P, Smy´kal P, Marshall D, Ambrose MJ, Ellis THN, Flavell AJ (2010) The genetic diversity and evolution of field pea (Pisum) studied by high throughput retrotransposon based insertion polymorphism (RBIP) marker analysis. BMC Evol Biol 10:44. doi:10. 1186/1471-2148-10-44 Jones M, Brown T (2000) Agricultural origins: the evidence of modern and ancient DNA. Holocene 10:769–776. doi:10. 1191/09596830095024 Jovanovic´ Zˇ, Stanisavljevic´ N, Nikolic´ A, Medovic´ A, Mikic´ A, Radovic´ S, Ðord¯evic´ V (2010) Pisum and Ervilia Tetovac—made in Early Iron Age Leskovac. Part two: extraction of the ancient DNA from CHARRED SEEDS FROM the site of Hissar in South Serbia. Ratar Povrt 48:227–232

Author's personal copy Genet Resour Crop Evol Kenicer GJ, Kajita T, Pennington RT, Murata J (2005) Systematics and biogeography of Lathyrus (Leguminosae) based on internal transcribed spacer and cpDNA sequence data. Am J Bot 92:1199–1209. doi:10.3732/ajb.92.7.1199 Kislev ME, Bar-Yosef O (1988) The legumes: the earliest domesticated plants in the Near East? Curr Anthropol 29:175–179 Konishi S, Izawa T, Lin S-Y, Ebana K, Fukuta Y, Sasaki T, Yano M (2006) An SNP caused loss of seed shattering during rice domestication. Science 312:1392–1396. doi:10. 1126/science.1126410 Kosterin OE, Bogdanova VS (2008) Relationship of wild and cultivated forms of Pisum L. as inferred from an analysis of three markers, of the plastid, mitochondrial and nuclear genomes. Genet Res Crop Evol 55:735–755. doi:10.1007/ s10722-007-9281-y Kluyver TA, Charles M, Jones G, Rees M, Osborne CP (2013) Did greater burial depth increase the seed size of domesticated legumes? J Exp Bot doi:10.1093/jxb/ert304 Kroll H (1983) Kastanas. Ausgrabungen in einem Siedlungshu¨gel der Bronze- und Eisenzeit Makedoniens 1975–1979. Die Pflanzenfunde. Verlag Volker Spiess, Berlin Kroll H (1991) Southeast Europe. In: van Zeist, Wasylikowa K, Behre KE (eds) Progress in old world palaeoethnobotany. Balkema, Rotterdam, pp 161–177 Ladizinsky G (1979) The genetics of several morphological traits in lentil. J Hered 70:135–137 Ladizinsky G (1985) The genetics of hard seed coat in the genus Lens. Euphytica 34:539–543. doi:10.1007/BF00022952 Ladizinsky G (1987) Pulse domestication before cultivation. Econ Bot 41:60–65. doi:10.1007/BF02859349 Ladizinsky G (1998) Plant evolution under domestication. Kluwer Academic, Dordrecht Lenser T, Theißen G (2013) Molecular mechanisms involved in convergent crop domestication. Trends Plant Sci 18:704–714. doi:10.1016/j.tplants.2013.08.007 Li J, Fu C, Lei G (2011) Biogeographical consequences of Cenozoic tectonic events within East Asian margins: a case study of Hynobius biogeography. PLoS One 6:1–10. doi:10.1371/journal.pone.0021506 Makasheva RKH (1979) Flora of cultivated plants IV, grain legumes 1, pea. Kolos, St. Petersburg Maxted N, Ambrose M (2001) Peas (Pisum L.). In: Maxted N, Bennett SJ (eds) Plant genetic resources of legumes in the Mediterranean. Kluwer, Dordrecht, pp 181–190 Medovic´ A (2005) Plant husbandry of fortified settlement Hisar near Leskovac southern Serbia (ca. 1350–1000 bc). Leskov Zb 45:201–209 (Serbian with English summary) Medovic´ A (2012) Late Bronze Age plant economy at the Early Iron Age hill fort settlement Hissar? Rad Muz Vojv 54:105–118 Medovic´ A, Mikic´ A, Cúpina B, Jovanovic´ Zˇ, Radovic´ S, Nikolic´ A, Stanisavljevic´ N (2011) Pisum and Ervilia Tetovac: made in Early Iron Age Leskovac. Part one. Two charred pulse crop storages of the fortified hill fort settlement Hissar in Leskovac, south Serbia. Ratar Povrt 48:219–226 Mikic´ A (2012) Origin of the words denoting some of the most ancient Old World pulse crops and their diversity in modern European languages. PLoS One 7:e44512. doi:10. 1371/journal.pone.0044512

Mikic´ A, Smy´kal P, Kenicer G et al (2013) The bicentenary of the research on ‘beautiful’ vavilovia (Vavilovia formosa), a legume crop wild relative with taxonomic and agronomic potential. Bot J Linn Soc 172:524–531. doi:10.1111/boj. 12060 Palmer JD, Jorgensen RA, Thompson WF (1985) Chloroplast DNA variation and evolution in Pisum: patterns of change and phylogenetic analysis. Genetics 109:195–213 Palmer S, Moore JD, Clapham AJ, Rose P, Allby RG (2009) Archelogical evidence of ancient nubian barley evolution from six to two-row indicates local adaptation. PLoS One 4:e6301. doi:10.1371/journal.pone.0006301 Polans NO, Saar DE (2002) ITS sequence variation in wild species and cultivars of pea. Pisum Genet 34:9–13 Purugganan MD, Fuller DQ (2009) The nature of selection during plant domestication. Nature 457:843–848. doi:10. 1038/nature07895 Saénz de Miera LE, Ramos J, Pe´rez de la Vega M (2008) A comparative study of convicilin storage protein gene sequences in species of the tribe Vicieae. Genome 7:511–523. doi:10.1139/G08-036 Schaefer H, Hechenleitner P, Santos-Guerra A, de Sequeira MM et al (2012) Systematics, biogeography, and character evolution of the legume tribe Fabeae with special focus on the middle-Atlantic island lineages. BMC Evol Biol 12:250. doi:10.1186/1471-2148-12-250 Schlumbaum A, Tensen M, Jaenicke-Despre´s V (2008) Ancient plant DNA in archaeobotany. Veg Hist Archaeobot 17:233–244. doi:10.1007/s00334-007-0125-7 Smartt J (1990) Grain legumes: evolution and genetic resources. Cambridge University Press, Cambridge Smy´kal P, Hy´bl M, Corander J, Jarkovsky´ J, Flavell AJ, Griga M (2008) Genetic diversity and population structure of pea (Pisum sativum L.) varieties derived from combined retrotransposon, microsatellite and morphological marker analysis. Theor Appl Genet 117:413–424. doi:10.1007/ s00122-008-0785-4 Smy´kal P, Kenicer G, Flavell AJ, Corander J, Kosterin O, Redden RJ, Ford R, Coyne CJ, Maxted N, Ambrose MJ, Ellis THN (2011) Phylogeny, phylogeography and genetic diversity of the Pisum genus. Plant Genet Res 9:4–18. doi:10.1017/S147926211000033X Smy´kal P, Coyne C, Redden R, Maxted N (2013) Peas. In: Singh M, Upadhya H (eds) Genetic and genomic resources of grain legume improvement. Elsevier, The Netherlands Smy´kal P, Coyne CJ, Ambrose MJ et al. (2014) Legume crops phylogeny and genetic diversity for science and breeding. Crit Rev Plant Sci. doi:10.1080/07352689. 2014.897904 Stojic´ M, Pesˇic´ J, Jovic´ S (2007) Cultural stratigraphy of archaeological site Hisar near Leskovac. Leskov Zb 47:29–40 Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) Software Version 4.0. Mol Biol Evol 24:1596–1599. doi:10. 1093/molbev/msm092 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. doi:10.1093/nar/22.22.4673

123

Author's personal copy Genet Resour Crop Evol Vahdati Nasab H (2010) The assessment of the prehistory of Southwestern Iran report (Hole and Flannery 1967). Int J Hum 17:1–12 Vavilov NI (1951) The origin, variation, immunity and breeding of cultivated plants. Translated by Chester KS. The Ronald Press Company, New York Weeden NF (2007) Genetic changes accompanying the domestication of Pisum sativum: is there a common genetic basis to the ‘domestication syndrome’ for legumes? Ann Bot 100:1017–1025. doi:10.1093/aob/mcm122 Weiss E, Zohary D (2011) The neolithic Southwest Asian founder crops: their biology and archaeobotany. Curr Anthr 52:S237–S254. doi:10.1086/658367

123

Weiss E, Kislev ME, Hartmann A (2006) Autonomous cultivation before domestication. Science 12:1608–1610 Werker E, Marbach I, Mayer AM (1979) Relation between the anatomy of the testa, water permeability and the presence of phenolics in the genus Pisum. Ann Bot 43:765–771 Willcox G, Fornite S, Herveux L (2008) Early Holocene cultivation before domestication in northern Syria. Veg Hist Archaeobot 17:313–325. doi:10.1007/s00334-007-0121-y Zlatkovic´ B, Mikic´ A, Smy´kal P (2010) Distribution and new records of Pisum sativum subsp. elatius in Serbia. Pisum Genet 42:15–18 Zohary D, Hopf M (2000) Domestication of plants in the Old World. Oxford University Press, Oxford