A Conditional Knockout Mouse Line of the Oxytocin ... - CiteSeerX

0013-7227/08/$15.00/0 Printed in U.S.A.

Endocrinology 149(7):3256 –3263 Copyright © 2008 by The Endocrine Society doi: 10.1210/en.2007-1710

A Conditional Knockout Mouse Line of the Oxytocin Receptor Heon-Jin Lee, Heather K. Caldwell, Abbe H. Macbeth, Selen G. Tolu, and W. Scott Young, 3rd Section on Neural Gene Expression, National Institute of Mental Health, National Institutes of Health, Department of Health and Human Services, Bethesda, Maryland 20892 Oxytocin plays important roles in reproductive physiology and various behaviors, including maternal behavior and social memory. Its receptor (Oxtr) is present in peripheral tissues and brain, so a conditional knockout (KO, ⴚ/ⴚ) would be useful to allow elimination of the receptor in specific sites at defined times. We created a line of mice in which loxP sites flank Oxtr coding sequence (floxed) enable Cre recombinase-mediated inactivation of the receptor. We expressed Cre recombinase in these mice either in all tissues (Oxtrⴚ/ⴚ) or the forebrain (OxtrFB/FB) using the Ca2ⴙ/ calmodulin-dependent protein kinase II␣ promoter. The latter KO has reduced Oxtr binding beginning 21–28 d postnatally, leading to prominent reductions in the lateral septum, hippocampus, and ventral pallidum. The medial

amygdala is spared, and there is significant retention of binding within the olfactory bulb and nucleus and neocortex. We did not observe any deficits in the general health, sensorimotor functions, anxiety-like behaviors, or sucrose intake in either Oxtrⴚ/ⴚ or OxtrFB/FB mice. Females of both KO types deliver pups, but only the OxtrFB/FB mice are able to eject milk. Oxtrⴚ/ⴚ males show impaired social memory for familiar females, whereas the OxtrFB/FB males appear to recognize their species but not individuals. Our results confirm the importance of oxytocin in social recognition and demonstrate that spatial and temporal inactivation of the Oxtr will enable finer understanding of the physiological, behavioral, and developmental roles of the receptor. (Endocrinology 149: 3256 –3263, 2008)

T

out (KO, ⫺/⫺) mice do not release milk through suckling and are thus incapable of caring for their offspring. Interestingly, Oxt⫺/⫺ mice have otherwise largely normal parturition (19, 20), and studies in virgin females have revealed only mild disturbances in maternal behavior (21). Oxt⫺/⫺ mice do, however, have impaired social memory, as measured in a social recognition test (for review see Ref. 22). The lack of robust deficits in maternal behavior in Oxt⫺/⫺ mice was hypothesized to be due to compensatory mechanisms through activation of the Oxtr by vasopressin or via developmental compensation (22, 23). Vasopressin can activate the Oxtr in Oxt⫺/⫺ mice, at least within the ventromedial hypothalamus (24). Inactivation of the Oxtr was reported previously (25), but it was not conditional [that line (25) has a mutated loxP site that prevents its use as a conditional KO (Young, L., personal communication)]. As with the Oxt⫺/⫺ mice, milk ejection was impaired but parturition was not. These mice had deficits in social recognition and maternal behavior as well as increased aggression. To avoid potential developmental effects of Oxtr inactivation (e.g. poor social learning as neonates), we chose to develop a conditional Oxtr knockout mouse that would allow for temporal and spatial inactivation of the receptor. The approach would also allow the separation of peripheral from CNS receptor effects. We report here the construction and phenotype of a traditional whole-body Oxtr KO (Oxtr⫺/⫺). Furthermore, we demonstrate the functionality of this conditional KO through generation of a relatively forebrainspecific KO (OxtrFB/FB) using Ca2⫹/calmodulin-dependent protein kinase II␣ (Camk2a) promoter-driven Cre recombinase expression.

HE NEUROPEPTIDE OXYTOCIN (Oxt) is well known for its importance in parturition and milk ejection but has dynamic roles throughout the entire body (1). The Oxt receptor (Oxtr) gene is expressed in many tissues including brain, uterus, kidney, ovary, testis, thymus, heart, vascular endothelium, osteoclasts, myoblasts, and several types of cancer cells (2, 3). In the brain, the Oxtr is found in many regions including hypothalamus, olfactory bulb, amygdala and hippocampus (4) in which it has been implicated in the regulation of social behaviors such as affiliation, social bonding, maternal behavior, and social memory (5–7). In humans, Oxt has been linked to social cognition (8 –11), autism (12–14), and anxiety (15, 16). Most Oxt is synthesized in magnocellular neurons of the paraventricular and supraoptic nuclei of the hypothalamus and released to the periphery from their axon terminals (17). Lesser amounts of Oxt are generated by smaller, parvocellular neurons of the paraventricular nucleus and, depending on species, bed nucleus of the stria terminalis, medial preoptic area, and lateral amygdala and released within the brain. In both the periphery and the central nervous system (CNS), the Oxt signal is transduced by a single Oxtr isoform. Oxtr belongs to the G protein-coupled receptor family and is coupled to phospholipase C through G␣q11 (18). Previously, we and others have reported that Oxt knockFirst Published Online March 20, 2008 Abbreviations: Camk2a, Calmodulin-dependent protein kinase II␣; CNS, central nervous system; FB, forebrain specific; FRT, Flp recognition target; KO, knockout; Oxt, oxytocin; Oxtr, Oxt receptor; WT, wild type. Endocrinology is published monthly by The Endocrine Society (http:// www.endo-society.org), the foremost professional society serving the endocrine community.

3256

Lee et al. • Technical Communication

Materials and Methods Generation of mice lacking Oxtr in the forebrain To generate the targeting vector construct (Fig. 1A), 129/Sv mouse genomic DNA fragments were amplified by PCR. A 3.4-kb 5⬘ fragment containing the Oxtr promoter and exon 1 was inserted upstream of a phosphoglycerate kinase promoter-driven neomycin resistance cassette (pgk-neor or neo) flanked by Flp recognition target (FRT) sites. For the 3⬘ homology part of the construct, a 1.3-kb of fragment containing exons 2 and 3 was inserted between two loxP sites, and a 2.9-kb fragment was added to its 3⬘ end. A diphtheria toxin A gene were used to select against random insertion. After electroporation into ES cells (129/Sv R1 cell line), DNA samples from G418-resistant clones were screened by PCR and then digested with SpeI for confirmational analysis by Southern blotting using an internal probe. The ES cells were injected into blastocysts to generate chimeras. Tail DNA Southern blotting was also performed to check the targeted alleles. Correctly targeted alleles produced a 8.2-kb SacI fragment owing to the insertion of the selectable drug-resistant maker (neo gene), compared with the wild-type (WT) allele of 6.4 kb (Fig. 1B). The neo cassette, flanked by FRT sites, was removed by crossing the conditional KO line with a transgenic mouse expressing FLPe recombinase using a human ␤-actin promoter (B6;SJLTg(ACTFLPe)9205Dym/J; The Jackson Laboratory, Bar Harbor, ME) (26). This generated mice with a floxed Oxtr allele (Oxtr⫹/flox). Homozygous floxed mice (Oxtr flox/flox) did not differ from WT littermates and expressed normal amounts of Oxtr (supplemental Fig. 1, published as supplemental data on The Endocrine Society’s Journals Online Web site at http://endo.endojournals.org). To generate forebrain-specific (FB) Oxtr knockouts, we crossed the L7ag13 transgenic line that expresses Cre

Endocrinology, July 2008, 149(7):3256 –3263

3257

recombinase under the control of the Camk2a promoter (kindly provided by Dr. Alexei Morozov, National Institute of Mental Health) (27, 28) with Oxtr⫹/flox or Oxtr flox/flox mice. Oxtr flox/flox male mice were crossed with female Oxtr⫹/flox mice that contained one transgenic allele expressing Cre recombinase (Oxtr⫹/flox, cre or Oxtr⫹/FB). The offspring thus had the following genotypes: 1) Oxtr⫹/flox, 2) Oxtr flox/flox, and 3) Oxtr⫹/flox,cre, and Oxtr flox/flox,cre. The former two are considered WT and the latter one a forebrain-specific Oxtr KO (OxtrFB/FB). To generate whole-body Oxtr KO mice, we bred male Oxtr⫹/flox, cre mice, which have germ cell expression of Cre recombinase, with female Oxtr flox/flox mice (29). This led to heterozygous progeny with one Oxtr allele inactivated throughout (Oxtr⫹/⫺). We crossed these mice to get homozygous total Oxtr KO (Oxtr⫺/⫺) mice. Due to the early postnatal activation of Cre expression in L7ag13 transgenic mice (see below), adult mice older than 10 wk were tested in general health and behavioral studies.

Genotyping Mice were genotyped by PCR using specific primers (Table 1) on DNA extracted from tail snips. A single forward primer, Seq. 1, was designed for amplification of the WT, neomycin resistance cassette, and floxed and recombined loci. The first reverse primer, Seq. 4, was designed to amplify both WT and floxed loci (221 and 291 bp, respectably). The second reverse primer, Neo-1, was designed to detect the neomycin resistance cassette (460 bp). The third reverse primer, DTAo10.3, was designed to amplify the recombined locus (150 bp). To identify mice carrying the Cre recombinase transgene, two primers were used to amplify a specific product of 460 bp. The PCR was carried out for

FIG. 1. Generation of Oxtr⫺/⫺ and OxtrFB/FB mice and analysis of genotypes. A, Schematic diagram of targeting strategy. Arrows indicate the primers used for genotyping. Black chevrons indicate loxP sites and white chevrons FRT sites. A neomycin resistance cassette (pgk-neor) was inserted in intron 1 and flanked by FRT sites that can be excised by FLP recombinase. Exons 2 and 3 (open boxed 2 and 3) were flanked by loxP sites and can be excised by Cre recombinase. B, Southern blot analysis of wild-type and targeted ES cell DNA using an internal probe (left panel) and tail snip DNA analysis using a 3⬘ external probe (right panel). Locations of the probes are indicated in A. C, Genotyping of various Oxtr alleles and the Cre transgene by PCR of DNA isolated from tail snips. Primers are designed to distinguish WT (221bp), targeted (neo, 469 bp), floxed (flox, 291 bp), and recombined (⫺/⫺, 150 bp) Oxtr alleles. The floxed allele PCR product is 70 bp larger than WT due to integration of one FRT and one loxP site between the PCR primers. Additional Cre-specific PCR on tails snip DNA was performed for the OxtrFB/FB allele (right bottom panel, 460 bp). M, Size marker.

3258


TABLE 1. Primers for genotyping Primer

Sequence (5⬘–3⬘)

Seq. 1 Seq. 4 Neo-1 DTAo 10.3 Cre1 Cre2

ACCCCAGGAAGATGTACCCGTAGTAAAGC TTAGGTCCCAGGAAAGAGTCAGCCGCTCTGCCTGCAGAGAGG ACCCCTTCCCAGCCTCTGAGCCCAGAAAGCGAAGG TGGGAGTCCAGAGATAGTGGAA AGAACCTGAAGATGTTCGCGATTATCTTCTATATC TAGTTACCCCCAGGCTAAGTGCCTTCTCTACAC

40 cycles with denaturation at 94 C for 45 sec, annealing at 59 C for 45 sec, and extension at 72 C for 45 sec.

Southern blot analysis Ten micrograms of ES cells or tail genomic DNA were digested overnight with SpeI or SacI, respectively. Digested DNA was resolved on a 0.8% agarose gel and transferred to a Hybond N⫹ membrane (Amersham, Piscataway, NJ). Both the internal (1.45 kb, GenBank accession no. NT_039353.7, bases 64753978 – 64755430) and the 3⬘ external (845 bp, GenBank accession no. NT_039353.7, bases 64748095– 64748939) probes were generated by PCR. Probes were labeled with 32P-dCTP (ES cells) or biotin (tail DNA) using the BioPrime DNA labeling system (Invitrogen, Carlsbad, CA). Labeled probes were applied to the membrane at 65 C. The signals were detected using x-ray film or Image Station 2000R (Kodak, Rochester, NY).

Maintenance of mice Animal housing and procedures were carried out in accordance with the National Institutes of Health guidelines on the care and use of animals using an animal study protocol approved by the National Institute of Mental Health Animal Care and Use Committee.

Oxtr autoradiography The distributions of Oxtr binding sites were determined using modifications of previously described methods (30, 31). Briefly, 12 ␮m freshfrozen brain sections were thaw mounted onto SuperFrost Plus slides and stored at ⫺80 C until needed. The slides were then placed on a room temperature surface for 10 min, rinsed in 170 mm Tris-HCl (pH 7.4), for 5 min, and fixed in 0.5% formaldehyde in PBS for 5 min. They were rinsed in the binding solution [160 mm Tris-HCl (pH 7.4) per 10 mm MgCl2 per 0.05% bacitracin per 0.1% BSA] for 5 min before incubation in the same solution containing 50 pm 125I-ornithine vasotocin analog (OTA; NEX 254; PerkinElmer, Waltham, MA) for 1 h. The slides were then rinsed with ice-cold binding solution twice for 5 min followed by 50 mm Tris-HCl (pH 7.4) per 100 mm MgCl2 over a gently rotating stir bar for 35 min at room temperature. The slides were then rapidly dipped in water and the sections blown dry. The sections were then apposed to x-ray films for 3 wk.

Phenotyping General methods. Measures of general health, neurological reflexes, sensory abilities and motor functions, sucrose intake, and social memory were conducted as previously described (32–34). Adult animals were housed in a vivarium on a 12-h light, 12-h dark cycle with food and water provided ad libitum. All testing was completed during the light phase of the light-dark cycle unless noted otherwise. The initial cohorts of Oxtr⫺/⫺ and OxtrFB/FB mice were tested on measurements of general health, followed by sensory, motor, and anxiety tasks, and sucrose intake (see Tables 2 and 3 for numbers and ages). For all tests, the WT animals used as controls were littermates; the two cohorts were tested in different facilities.

General health Each mouse was observed and any abnormalities in the general appearance of the fur, whiskers, posture, and gait were recorded. In addition, mice were observed for 3 min in a novel cage to assess any


stereotypies. Neurological reflexes were assessed, including eye blink, ear twitch, righting reflex, and trunk curl.

Sensory Vision was measured by confirming forepaw reaching. This was accomplished by holding the mouse by the tail and lowering toward the surface of a table. Hearing was tested by the Preyer startle response to a loud clap. Olfaction was measured using a habituation-dishabituation task, which consisted of 2-min presentations of five odorants three times each with a 1-min intratrial interval. The odorants used were water, almond extract (1:100), and male mouse urine (1:100) (collected from group-housed males). Odorants were presented to mice on cotton swabs suspended from the cage lid about 4 cm above the bedding. The amount of time mice spent in proximity (⬍1 cm) to the cotton tip was recorded. The presentation of the same odor three times assayed habituation, and switching to different odors, some with social valence, tested dishabituation. Each test was conducted in a clean mouse cage containing fresh bedding.

Motor Mice were tested for motor coordination using the accelerating Rotarod (San Diego Instruments, San Diego, CA). Mice were placed on a rod that was set to accelerate from 0 to 60 rpm over 120 sec. The latency to fall (as detected by photobeam sensors) was recorded. Muscle strength was measured using the hanging wire cage test. Mice were placed on the underside of a standard wire rat cage top approximately 20 cm above a large cage containing soft wood-chip bedding. The latency to release was recorded, with a maximum latency of 60 sec. Most of the general health measurements and sensorimotor tasks were compared between genotypes using a one-way ANOVA. The exception was the olfaction test for which repeated measures ANOVA was run to look for main effects of odor and genotype. Habituation was measured by a decline in time spent sniffing within an odor set. Dishabituation was measured by an increase in time spent sniffing to the first presentation of an odor in an odor set, compared with the last presentation of the previous odor in an odor set. P ⱕ 0.05 was considered statistically significant.

Sucrose intake Two drinking bottles (50-ml plastic tubes with a 6.4-cm sipper tube; Ancare, Belmore, NY), one containing drinking water and the other containing a 10% sucrose solution, were freely available to mice individually housed in standard mouse home cages. Bottle weights and body weights were measured every 24 h for 6 d. Throughout the experiment, the positions of the water and sucrose bottles were changed daily. Additionally, control bottles were placed in an empty cage to measure for evaporative and handling loss of water and sucrose. Sucrose intake for each day was converted to grams of sucrose per kilogram of body weight per 24 h (grams per kilogram per 24 h) and then averaged for all 6 d of measurement. The data were then analyzed using a one-way ANOVA to determine whether there was an effect of genotype on the amount of sucrose consumption. P ⱕ 0.05 was considered statistically significant.

Behavioral examination Anxiety. Anxiety-like behavior was assessed on two tasks: the novel open-field test and the elevated plus maze as previously described (23, 32) except that the inner square was 32 ⫻ 32 cm and the exploration time was 20 min. Open-field testing occurred 1 wk before elevated plus maze testing. Mice used in these tests were the same as those used for general phenotyping. Both tests were performed under dim white light illumination (100 lux for the elevated plus maze and 200 lux for the open field) during the dark phase of the light-dark cycle. Both the open-field and elevated plus maze were cleaned with 70% ethanol between each animal, and an observer blind to the genotype of the animals completed the testing. The data collected from the two genotypes were compared using a one-way ANOVA. P ⱕ 0.05 was considered statistically significant.



3259

TABLE 2. Phenotypic characteristics of male Oxtr⫺/⫺ and OxtrFB/FB mice

Age (d, at start of phenotyping) General health Weight (g) Fur condition (3-point scale) Bald patches (%) Piloerection (%) Missing whiskers (%) Body tone (3-point scale) Limb tone (3-point scale) Skin color (%) Physical abnormalities (%) Reflexes Trunk curl (%) Righting reflex (%) Forepaw reaching (%) Corneal (%) Pinna (%) Vibrissae (%) Toe pinch (%) Auditory startle (%) Habituation/dishabituation (sec) Water, first exposure Water, third exposure Almond, first exposure Almond, third exposure Male urine, first exposure Male urine, third exposure Reactivity Positional passivity (%) Petting escape (%) Empty cage behavior Wild running (%) Transfer freezing (%) Stereotypies (%) Grooming (3-point scale) Exploration (3-point scale) Wire hang (sec) Rotarod (sec) Anxiety-like behavior Open field Time in inner square (%) Time in outer square (%) Distance traveled (cm) Elevated plus maze Time in open arms (%) Time in closed arms (%) Latency to enter open arms (sec) Sucrose intake (g/kg䡠d)

WT (n ⫽ 8)

⫺/⫺ (n ⫽ 9)

WT (n ⫽ 9)

FB/FB (n ⫽ 8)

70.8 ⫾ 1.6

73.1 ⫾ 2.3

112.0 ⫾ 8.0

92.7 ⫾ 12.9

25.3 ⫾ 1.1 3.0 ⫾ 0.0 0 0 0 2.0 ⫾ 0.0 2.0 ⫾ 0.0 100 0

24.4 ⫾ 0.7 3.0 ⫾ 0.0 0 0 0 2.0 ⫾ 0.0 2.0 ⫾ 0.0 100 0

34.2 ⫾ 2.3 3.0 ⫾ 0.0 11 0 0 2.0 ⫾ 0.0 2.0 ⫾ 0.0 100 0

26.5 ⫾ 1.2a 3.0 ⫾ 0.0 25 0 0 2.0 ⫾ 0.0 2.0 ⫾ 0.0 100 0

100 100 100 100 100 100 100 100

100 100 100 100 100 100 100 100

100 100 100 100 100 100 100 100

100 100 100 100 100 100 100 100

3.2 ⫾ 0.7 2.5 ⫾ 0.5 1.9 ⫾ 0.5 1.1 ⫾ 0.4 9.7 ⫾ 4.1 1.9 ⫾ 0.6

2.7 ⫾ 0.5 1.7 ⫾ 0.2 1.5 ⫾ 0.5 0.4 ⫾ 0.3 5.6 ⫾ 1.8 0.4 ⫾ 0.2

4.0 ⫾ 0.8 3.0 ⫾ 0.9 2.5 ⫾ 0.7 0.4 ⫾ 1.0 6.6 ⫾ 2.5 0.9 ⫾ 0.3

4.7 ⫾ 0.6 2.3 ⫾ 0.5 3.6 ⫾ 0.8 0.5 ⫾ 0.2 4.5 ⫾ 1.1 0.9 ⫾ 0.2

100 87.5

80 66.7

33.3 88.9

37.5 100

0 12.5 0 0.8 ⫾ 0.2 1.6 ⫾ 0.1 51.8 ⫾ 4.9 32.2 ⫾ 4.4

0 20.0 0 1.1 ⫾ 0.2 1.6 ⫾ 0.2 45.5 ⫾ 7.3 31.3 ⫾ 4.4

0 22.2 0 0.6 ⫾ 0.2 1.9 ⫾ 0.1 28.3 ⫾ 8.0 38.1 ⫾ 3.9

0 12.5 0 0.5 ⫾ 0.2 2.0 ⫾ 0.3 55.4 ⫾ 4.6a 38.3 ⫾ 3.5

20.2 ⫾ 3.4 79.4 ⫾ 3.3 6287 ⫾ 599

23.2 ⫾ 3.3 76.7 ⫾ 3.2 6408 ⫾ 518

16.1 ⫾ 3.3 83.9 ⫾ 3.3 5752 ⫾ 357

26.6 ⫾ 5.8 73.4 ⫾ 5.8 5645 ⫾ 439

19.3 ⫾ 3.2 61.9 ⫾ 4.5 10.3 ⫾ 3.6 37.0 ⫾ 7.3

18.9 ⫾ 4.7 61.9 ⫾ 5.7 6.9 ⫾ 1.5 28.0 ⫾ 8.2

7.8 ⫾ 1.1 74.2 ⫾ 5.1 19.3 ⫾ 7.5 28.9 ⫾ 10.1 (n ⫽ 8)

13.2 ⫾ 4.0 66.7 ⫾ 7.5 53.6 ⫾ 35.9 25.5 ⫾ 8.4 (n ⫽ 6)

Mice were assessed on general health, reflexes, reactivity, cage behavior, motor abilities, anxiety-like behaviors, and sucrose intake. Columns 1 and 2 are one cohort, and columns 3 and 4 are another. Oxtr⫺/⫺ and their WT littermates did not significantly differ on any measurements (first and second columns). In contrast, male OxtrFB/FB mice weighed less than and hung for longer than their WT littermates. a P ⬍ 0.05; third and fourth columns; ⫾SEM are shown where applicable.

Social recognition. The two- and five-trial social recognition tasks were performed as described previously (32, 33, 35, 36). Subject males were individually housed at least 2 wk before testing to allow for a home cage territory to be established. All stimulus animals were ovariectomized BALB/c females. Sex behavior was extinguished as previously described (32) with genotypic differences in the times necessary. Animals that did not extinguish their sex behavior by d 8 were not included in the final statistical analysis because their mounting introduced a confound when trying to measure investigation time. For the tests of social recognition in the Oxtr⫺/⫺ mice, WT (n ⫽ 8) and KO (n ⫽ 8) males were used; in the OxtrFB/FB mice, WT (n ⫽ 10) and KO (n ⫽ 10) males were used. For all tests, the WT animals used as controls were littermates. Ages of the mice at the start of testing were: WT, 113.6 ⫾ 10.2 d (⫾sem) and Oxtr⫺/⫺

littermates, 114.6 ⫾ 11.3 d; WT, 158.5 ⫾ 9.0 and OxtrFB/FB littermates, 141.2 ⫾ 13.0 d. In the two-trial task, if subject animals were presented with a familiar female on trial 2 (30 min after trial 1) of wk 1, then 1 wk later, they were presented with a novel female on trial 2 of wk 2 and vice versa. Within each genotype, the time spent investigating in trials 1 and 2 for the familiar and novel females were compared using a paired-samples t test. One week after completion of the two-trial social recognition task, subject males (WT and OxtrFB/FB) completed the five-trial social recognition task (adapted from Ref. 36). Subject males remained singly housed throughout the task, and ovariectomized BALB/c females were again used as stimulus females with 10 min between trials. The five trials were compared between genotypes using a repeated-measures ANOVA with genotype and trial as the main factors.

3260



TABLE 3. Phenotypic characteristics of female Oxtr⫺/⫺ and OxtrFB/FB mice

Age (d, at start of phenotyping) General health Weight (g) Fur condition (3-point scale) Bald patches (%) Piloerection (%) Missing whiskers (%) Body tone (3-point scale) Limb tone (3-point scale) Skin color (%) Physical abnormalities (%) Reflexes Trunk curl (%) Righting reflex (%) Forepaw reaching (%) Corneal (%) Pinna (%) Vibrissae (%) Toe pinch (%) Auditory startle (%) Habituation/dishabituation (sec) Water, first exposure Water, third exposure Almond, first exposure Almond, third exposure Male urine, first exposure Male urine, third exposure Reactivity Positional passivity (%) Petting escape (%) Empty cage behavior Wild running (%) Transfer freezing (%) Stereotypies (%) Grooming (3-point scale) Exploration (3-point scale) Wire hang (sec) Rotarod (sec) Anxiety-like behavior Open field Time in inner square (%) Time in outer square (%) Distance traveled (cm) Elevated plus maze Time in open arms (%) Time in closed arms (%) Latency to enter open arms (sec)

WT (n ⫽ 10)

⫺/⫺ (n ⫽ 10)

WT (n ⫽ 20)

FB/FB (n ⫽ 11)

107.1 ⫾ 7.1

108.9 ⫾ 11.1

106.2 ⫾ 5.9

98.0 ⫾ 14.7

20.1 ⫾ 0.7 3.0 ⫾ 0.0 10 0 0 2.0 ⫾ 0.0 2.0 ⫾ 0.0 100 0

21.3 ⫾ 0.7 3.0 ⫾ 0.0 0 0 0 2.0 ⫾ 0.0 2.0 ⫾ 0.0 100 0

25.2 ⫾ 1.1 3.0 ⫾ 0.0 10 0 5 2.0 ⫾ 0.0 2.0 ⫾ 0.0 100 0

20.1 ⫾ 0.6a 3.0 ⫾ 0.0 0 0 9.1 2.0 ⫾ 0.0 2.0 ⫾ 0.0 100 0

100 100 100 100 100 100 100 100

100 100 100 100 100 100 100 100

100 100 100 100 100 100 100 100

3.0 ⫾ 0.5 1.9 ⫾ 0.3 1.4 ⫾ 0.4 0.5 ⫾ 0.2 8.7 ⫾ 1.9 0.9 ⫾ 0.3

2.6 ⫾ 0.5 1.6 ⫾ 0.3 0.7 ⫾ 0.2 0.5 ⫾ 0.2 8.0 ⫾ 1.2 0.9 ⫾ 0.3

3.1 ⫾ 0.5 1.8 ⫾ 0.6 2.2 ⫾ 0.6 0.5 ⫾ 0.2 5.3 ⫾ 1.6 1.1 ⫾ 0.4

4.1 ⫾ 0.8 2.7 ⫾ 0.6 3.2 ⫾ 0.7 0.7 ⫾ 0.3 7.2 ⫾ 2.1 1.0 ⫾ 0.5

70 40

70 50

65 95

36 90

0 10 0 1.0 ⫾ 0.2 1.9 ⫾ 0.1 53.1 ⫾ 4.7 44.6 ⫾ 10.9

0 20 0 0.5 ⫾ 0.2 1.9 ⫾ 0.2 53.7 ⫾ 5.1 59.1 ⫾ 15.6

0 15 10 0.8 ⫾ 0.2 2.1 ⫾ 0.1 49.8 ⫾ 4.5 48.0 ⫾ 4.7

0 9 18 0.7 ⫾ 0.6 2.1 ⫾ 0.1 54.9 ⫾ 5.1 58.9 ⫾ 4.7

20.5 ⫾ 3.5 79.5 ⫾ 3.5 6840 ⫾ 701

21.8 ⫾ 2.2 78.2 ⫾ 2.2 7080 ⫾ 488

23.3 ⫾ 3.4 76.7 ⫾ 3.4 5503 ⫾ 379

22.3 ⫾ 1.5 77.7 ⫾ 1.5 5831 ⫾ 492

21.7 ⫾ 4.3 58.1 ⫾ 5.0 14.2 ⫾ 5.8

25.7 ⫾ 3.5 55.2 ⫾ 3.6 4.0 ⫾ 1.2

10.6 ⫾ 1.5 67.9 ⫾ 3.0 8.7 ⫾ 3.7

10.9 ⫾ 1.6 70.3 ⫾ 3.4 12.9 ⫾ 3.8

100 100 100 100 100 100 100 100

Mice were assessed on general health, reflexes, reactivity, cage behavior, motor abilities, anxiety-like behaviors, and sucrose intake. Columns 1 and 2 are one cohort, and columns 3 and 4 are another. Oxtr⫺/⫺ and their WT littermates did not significantly differ on any measurements (first and second columns). In contrast, female OxtrFB/FB mice weighed less than and hung for longer than their WT littermates. a P ⬍ 0.05; third and fourth columns; ⫾SEM are shown where applicable.

⫺/⫺

Generation of Oxtr

Results and OxtrFB/FB mice

We flanked the neomycin selectable marker in an intron by FRT sites and Oxtr coding sequence by loxP sites (Fig. 1A). This permitted their removal using the FLP-FRT and CreloxP systems, respectively (37, 38). Successful recombination at the Oxtr allele in ES cells was confirmed by Southern blot analysis (Fig. 1B) after initial screening by PCR. For the OxtrFB/FB mice, we used transgenic mice that used the Camk2a promoter to drive Cre recombinase expression in the forebrain (L7ag13) (27). The Oxtr⫺/⫺ mice were produced through leaky paternal germ cell expression of Cre recombinase (29). WT, floxed, and recombined alleles were con-

firmed through PCR analysis (Fig. 1C). The heterozygous dams from the Oxtr⫺/⫺ line have smaller litter sizes on average, compared with the heterozygous dams from the OxtrFB/FB line (5.7 ⫾ 0.3 pups vs. 7.1 ⫾ 0.5; F ⫽ 5.87, P ⫽ 0.03, one-way ANOVA with genotype as factor). Homozygous Oxtr⫺/⫺ mice successfully deliver mice, but details of parturition were not studied. The OxtrFB/FB mice demonstrate normal milk ejection, whereas the Oxtr⫺/⫺ do not (no milk in the stomachs of their pups). Oxtr binding in the brain

Oxtr protein levels were determined by in vitro receptor autoradiography using the 125I-labeled Oxt antagonist, [d(CH2)5,Tyr(Me)2,Thr4,Tyr-NH2]ornithine vasotocin (OTA)



3261

FIG. 2. Disruption of the Oxtr in mouse forebrain by Camk2a-driven Cre recombinase expression. Oxtr levels were examined by receptor binding in coronal sections from adult WT (A–C), OxtrFB/FB (D,–F), and Oxtr⫺/⫺ (G–I) mice. Most areas in the forebrain of OxtrFB/FB mice show decreased levels of binding, with the notable exception of the medial amygdala (MA). Oxtr⫺/⫺ mice show only background levels. Exposure was for 3 wk to x-ray film (C). Am, Amygdala; AON, anterior olfactory nucleus; CP, caudate-putamen; Ctx, cerebral cortex; Hi, hippocampal formation; LS, lateral septum; MA, medial amygdala; OB, olfactory bulb; PC, piriform cortex; VP, ventral pallidum. Scale bar, 0.5 cm.

(30). There are no differences in binding distributions between mice with floxed Oxtr exons (Oxtr flox/flox) and their WT littermates in the amount of Oxtr binding (supplemental Fig. 1), indicating the loxP insertions did not affect Oxtr levels. However, the knock-in mice in which the neomycin cassette was left in intron 1 of the Oxtr gene (OxtrNeo/Neo) show not only reduced levels of Oxtr but also ectopic distribution, especially in the striatum (supplemental Fig. 1). WT Oxtr binding (Fig. 2, A–C) is consistent with previous autoradiographic (36, 39) and Oxtr-lacZ reporter (4) studies in mice. Although the OxtrFB/FB mice show greatly reduced binding in most of the forebrain, especially within the lateral septum, hippocampus, and ventral pallidum (Fig. 2, D–F), significant levels remain in the anterior olfactory bulb and nucleus (Fig. 2D), medial amygdala (Fig. 2F), and neocortex (Fig. 2, E and F). We did not observe any consistent differences in Oxtr binding between OxtrFB/FB mice obtained from different breeding pairs or between sexes. Furthermore, Cre expression is temporally ineffective in inactivating the Oxtr gene until after postnatal d 21 (Fig. 3). We also did not observe any histological abnormalities in the brains of any of the mice.

Social recognition

As has been previously reported in total KOs (25), Oxtr⫺/⫺ mice have impaired social recognition on the two-trial task because they continue to investigate a familiar female as if she were novel (P ⫽ 0.314), rather than showing reduced investigation time as seen in WT controls (P ⫽ 0.007) (Fig. 4A). The investigation times did not significantly differ between trial 1 and trial 2 in WT (P ⫽ 0.708) or Oxtr⫺/⫺ mice (P ⫽ 0.462) when presented with a novel female. The OxtrFB/FB mice, on the other hand, show a different impairment of social recognition, with decreased investigation times by OxtrFB/FB when presented with either the familiar (P ⫽ 0.030) or the novel (P ⫽ 0.003) female in the second trial (Fig. 4B). However, in the subsequent

General health measurements and basic behavioral analyses

The data for general health measurements, anxiety, and sucrose intake are summarized in Tables 2 and 3 for male and female mice, respectively. There are no phenotypic differences between male or female Oxtr⫺/⫺ mice, compared with WT controls, including for vision, hearing, and olfactory habituation/dishabituation (Tables 2 and 3). Similarly, assessments of male and female OxtrFB/FB mice indicated no differences, compared with controls, on measurements of general health, sensorimotor functions, anxiety-like behavior, and sucrose intake with one exception: the OxtrFB/FB mice weigh less (which may explain the longer wire hang time for the male OxtrFB/FB mice) and that difference becomes more exaggerated with age (supplemental Fig. 2).

FIG. 3. Postnatal disruption of the Oxtr in mouse forebrain by Camk2a-driven Cre recombinase expression is not apparent until 4 wk after birth. Oxtr levels, demonstrated by receptor binding autoradiography in sagittal sections from WT (A, C, and E) and OxtrFB/FB (B, D, and F) mice, were the same at 2 (A and B) and 3 (C and D) wk postnatally. However, at 4 wk postnatally (E and F), receptor binding was reduced in the OxtrFB/FB mice. Exposure was for 3 wk to x-ray film. CP, Caudate-putamen; Ctx, cerebral cortex; Hi, hippocampal formation. Scale bar, 0.5 cm.

3262



FIG. 4. Social recognition in Oxtr⫺/⫺and OxtrFB/FB males is impaired in different ways. Trials 1 and 2 of exposure to a familiar or novel female were compared within each genotype. A, Oxtr⫺/⫺ males (n ⫽ 8), compared with WT males (n ⫽ 8), do not remember that they have met females before; they do not decrease their investigation time when exposed to the familiar female in trial 2. B, OxtrFB/FB males (n ⫽ 13), compared with WT males (n ⫽ 10), engage in less investigation, regardless of whether the stimulus female in trial 2 is familiar (*, P ⫽ 0.03) or novel (*, P ⫽ 0.003). C, Both OxtrFB/FB (n ⫽ 13) and WT (n ⫽ 10) male mice increase their investigation time when presented with a novel female on trial 5, compared with investigation of a familiar female on trial 4 (*, P ⫽ 0.001).

five-trial social recognition study, with shorter times between tests but longer overall duration, OxtrFB/FB mice do not significantly differ from WT controls and investigate a novel female significantly more than a familiar female (Fig. 4C), indicating that OxtrFB/FB mice do not lose interest during the social recognition tasks. Discussion

In the present study, we have shown that Oxtr⫺/⫺ mice do not differ from WT controls in many aspects of their behavior but have distinct phenotypes in a social memory task. In general, measures of health, including reflexes, sensory, and motor tests, the Oxtr⫺/⫺ and OxtrFB/FB mice perform similarly to their WT littermates. Previously Amico et al. (40) found that Oxt has a role in restraining the consumption of sugar solution. Specifically, female and male Oxt⫺/⫺ mice have significantly enhanced initial and sustained sucrose intake (40); this enhanced intake is independent of photoperiod (41). It is for this reason that we examined sucrose intake in males from Oxtr⫺/⫺ mice. We found that sucrose intake does not differ from that of WT controls, suggesting that Oxt acting via the Oxtr may not be responsible for the restraining sugar intake, at least in males. It is intriguing that the Oxtr KO lines differ in their performance on the social recognition task. The reduced social recognition (social amnesia) in Oxtr⫺/⫺ mice in this study is consistent with previous reports demonstrating that Oxt is critical for normal social recognition (25, 36). However, OxtrFB/FB mice show a different type of impaired social recognition: they appear to fail at recognizing individual mice. One potential explanation is that these mice are less motivated in subsequent tasks. This is unlikely because they perform the five-trial task the same as the WT mice and, in unpublished observations in which novel and familiar mice are presented simultaneously, no decrease in total exploratory time is seen. Future studies exploring their social cognition are planned and will likely provide greater insight into specific phenotypic differences between the Oxtr⫺/⫺ and

OxtrFB/FB mice. Other Cre-expressing transgenic lines or anatomically precise injections of Cre-expressing viruses should lead to a more complete understanding of Oxt’s role in social recognition. This initial example of the use of the conditional KO is only one of potentially many. The OxtrFB/FB mice are able to eject milk so it should be possible to generate a variety of lines in which a subpopulation of CNS Oxtr is inactivated yet the inability to eject milk is not a confound in evaluating maternal care. These may lead to useful models of neurodevelopmental disorders as we evaluate the influence of Oxt at different ages or stages of development. Conversely, with appropriately timed and targeted expression of Cre recombinase in the periphery, it should be possible to better understand Oxtr’s role there by comparing the pre- and postinactivation physiologic states. Acknowledgments The authors thank Dr. Jim Pickel of the transgenic core facility for helping to generate these mice; James Heath, Emily Shepard, and Anna Iacangelo for technical assistance; and Clair Briggs for behavioral scoring. Received December 11, 2007. Accepted March 13, 2008. Address all correspondence and requests for reprints to: Dr. W. Scott Young, 3rd, Building 49, Room 5A51, 9000 Rockville Pike, Bethesda, Maryland 20892-4483. E-mail: [email protected]. This work was supported by National Institutes of Mental Health Intramural Research Program Grant Z01-MH-002498-17. Current address for H.K.C.: Department of Biological Sciences, Kent State University, Kent, OH 44242. Disclosure Statement: The authors of this manuscript have nothing to declare.

References 1. Argiolas A, Gessa GL 1991 Central functions of oxytocin. Neurosci Biobehav Rev 15:217–231 2. Gimpl G, Fahrenholz F 2001 The oxytocin receptor system: structure, function, and regulation. Physiol Rev 81:629 – 683 3. Zingg HH, Laporte SA 2003 The oxytocin receptor. Trends Endocrinol Metab 14:222–227


4. Gould BR, Zingg HH 2003 Mapping oxytocin receptor gene expression in the mouse brain and mammary gland using an oxytocin receptor-LacZ reporter mouse. Neuroscience 122:155–167 5. Lim MM, Young LJ 2006 Neuropeptidergic regulation of affiliative behavior and social bonding in animals. Horm Behav 50:506 –517 6. Young LJ, Winslow JT, Wang Z, Gingrich B, Guo Q, Matzuk MM, Insel TR 1997 Gene targeting approaches to neuroendocrinology: oxytocin, maternal behavior, and affiliation. Horm Behav 31:221–231 7. Caldwell HK, Young 3rd WS 2006 Oxytocin and vasopressin: genetics and behavioral implications. In: Lim R, ed. Neuroactive proteins and peptides. New York: Springer; 573– 607 8. Kirsch P, Esslinger C, Chen Q, Mier D, Lis S, Siddhanti S, Gruppe H, Mattay VS, Gallhofer B, Meyer-Lindenberg A 2005 Oxytocin modulates neural circuitry for social cognition and fear in humans. J Neurosci 25:11489 –11493 9. Domes G, Heinrichs M, Michel A, Berger C, Herpertz SC 2007 Oxytocin improves “mind-reading” in humans. Biol Psychiatry 61:731–733 10. Fries AB, Ziegler TE, Kurian JR, Jacoris S, Pollak SD 2005 Early experience in humans is associated with changes in neuropeptides critical for regulating social behavior. Proc Natl Acad Sci USA 102:17237–17240 11. Kosfeld M, Heinrichs M, Zak PJ, Fischbacher U, Fehr E 2005 Oxytocin increases trust in humans. Nature 435:673– 676 12. Jacob S, Brune CW, Carter CS, Leventhal BL, Lord C, Cook Jr EH 2007 Association of the oxytocin receptor gene (OXTR) in Caucasian children and adolescents with autism. Neurosci Lett 417:6 –9 13. Hollander E, Bartz J, Chaplin W, Phillips A, Sumner J, Soorya L, Anagnostou E, Wasserman S 2007 Oxytocin increases retention of social cognition in autism. Biol Psychiatry 61:498 –503 14. Jansen LM, Gispen-de Wied CC, Wiegant VM, Westenberg HG, Lahuis BE, van Engeland H 2006 Autonomic and neuroendocrine responses to a psychosocial stressor in adults with autistic spectrum disorder. J Autism Dev Disord 36:891– 899 15. Scantamburlo G, Hansenne M, Fuchs S, Pitchot W, Marechal P, Pequeux C, Ansseau M, Legros JJ 2007 Plasma oxytocin levels and anxiety in patients with major depression. Psychoneuroendocrinology 32:407– 410 16. Heinrichs M, Baumgartner T, Kirschbaum C, Ehlert U 2003 Social support and oxytocin interact to suppress cortisol and subjective responses to psychosocial stress. Biol Psychiatry 54:1389 –1398 17. Brownstein MJ, Russell JT, Gainer H 1980 Synthesis, transport, and release of posterior pituitary hormones. Science 207:373–378 18. Young 3rd WS, Gainer H 2003 Transgenesis and the study of expression, cellular targeting and function of oxytocin, vasopressin and their receptors. Neuroendocrinology 78:185–203 19. Nishimori K, Young LJ, Guo Q, Wang Z, Insel TR, Matzuk MM 1996 Oxytocin is required for nursing but is not essential for parturition or reproductive behavior. Proc Natl Acad Sci USA 93:11699 –11704 20. Young 3rd WS, Shepard E, Amico J, Hennighausen L, Wagner KU, LaMarca ME, McKinney C, Ginns EI 1996 Deficiency in mouse oxytocin prevents milk ejection, but not fertility or parturition. J Neuroendocrinol 8:847– 853 21. Pedersen CA, Vadlamudi SV, Boccia ML, Amico JA 2006 Maternal behavior deficits in nulliparous oxytocin knockout mice. Genes Brain Behav 5:274 –281 22. Winslow JT, Insel TR 2002 The social deficits of the oxytocin knockout mouse. Neuropeptides 36:221–229 23. Caldwell HK, Stewart J, Wiedholz LM, Millstein RA, Iacangelo A, Holmes A, Young 3rd WS, Wersinger SR 2006 The acute intoxicating effects of ethanol


24.

25.

26. 27. 28.

29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41.

3263

are not dependent on the vasopressin 1a or 1b receptors. Neuropeptides 40:325–337 Ragnauth AK, Goodwillie A, Brewer C, Muglia LJ, Pfaff DW, Kow LM 2004 Vasopressin stimulates ventromedial hypothalamic neurons via oxytocin receptors in oxytocin gene knockout male and female mice. Neuroendocrinology 80:92–99 Takayanagi Y, Yoshida M, Bielsky IF, Ross HE, Kawamata M, Onaka T, Yanagisawa T, Kimura T, Matzuk MM, Young LJ, Nishimori K 2005 Pervasive social deficits, but normal parturition, in oxytocin receptor-deficient mice. Proc Natl Acad Sci USA 102:16096 –16101 Rodriguez CI, Buchholz F, Galloway J, Sequerra R, Kasper J, Ayala R, Stewart AF, Dymecki SM 2000 High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nat Genet 25:139 –140 Dragatsis I, Zeitlin S 2000 CaMKII␣-Cre transgene expression and recombination patterns in the mouse brain. Genesis 26:133–135 Zakharenko SS, Patterson SL, Dragatsis I, Zeitlin SO, Siegelbaum SA, Kandel ER, Morozov A 2003 Presynaptic BDNF required for a presynaptic but not postsynaptic component of LTP at hippocampal CA1-CA3 synapses. Neuron 39:975–990 Bastia E, Xu YH, Scibelli AC, Day YJ, Linden J, Chen JF, Schwarzschild MA 2005 A crucial role for forebrain adenosine A(2A) receptors in amphetamine sensitization. Neuropsychopharmacology 30:891–900 Insel TR, Shapiro LE 1992 Oxytocin receptor distribution reflects social organization in monogamous and polygamous voles. Proc Natl Acad Sci USA 89:5981–5985 Young 3rd WS, Kuhar MJ 1979 Autoradiographic localisation of benzodiazepine receptors in the brains of humans and animals. Nature 280:391–394 Wersinger SR, Caldwell HK, Martinez L, Gold P, Hu SB, Young 3rd WS 2007 Vasopressin 1a receptor knockout mice have a subtle olfactory deficit but normal aggression. Genes Brain Behav 6:540 –551 Wersinger SR, Ginns EI, O’Carroll AM, Lolait SJ, Young 3rd WS 2002 Vasopressin V1b receptor knockout reduces aggressive behavior in male mice. Mol Psychiatry 7:975–984 Crawley JN 2000 What’s wrong with my mouse: behavioral phenotyping of transgenic and knockout mice. 2nd ed. New York: Wiley-Liss Ferguson JN, Aldag JM, Insel TR, Young LJ 2001 Oxytocin in the medial amygdala is essential for social recognition in the mouse. J Neurosci 21:8278 – 8285 Ferguson JN, Young LJ, Hearn EF, Matzuk MM, Insel TR, Winslow JT 2000 Social amnesia in mice lacking the oxytocin gene. Nat Genet 25:284 –288 Sternberg N, Hamilton D 1981 Bacteriophage P1 site-specific recombination. I. Recombination between loxP sites. J Mol Biol 150:467– 486 Broach JR, Hicks JB 1980 Replication and recombination functions associated with the yeast plasmid, 2 ␮ circle. Cell 21:501–508 Insel TR, Gelhard R, Shapiro LE 1991 The comparative distribution of forebrain receptors for neurohypophyseal peptides in monogamous and polygamous mice. Neuroscience 43:623– 630 Amico JA, Vollmer RR, Cai HM, Miedlar JA, Rinaman L 2005 Enhanced initial and sustained intake of sucrose solution in mice with an oxytocin gene deletion. Am J Physiol Regul Integr Comp Physiol 289:R1798 –R1806 Billings LB, Spero JA, Vollmer RR, Amico JA 2006 Oxytocin null mice ingest enhanced amounts of sweet solutions during light and dark cycles and during repeated shaker stress. Behav Brain Res 171:134 –141

Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.