APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 2011, p. 3478–3483 0099-2240/11/$12.00 doi:10.1128/AEM.02708-10 Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Vol. 77, No. 10
A Contingency Locus in prfA in a Listeria monocytogenes Subgroup Allows Reactivation of the PrfA Virulence Regulator during Infection in Mice䌤 Toril Lindba¨ck,* Indira Secic, and Liv Marit Rørvik Department of Food Safety and Infection Biology, Norwegian School of Veterinary Science, P.O. Box 8146 Dep., N-0033 Oslo, Norway Received 19 November 2010/Accepted 22 March 2011
A nonhemolytic Listeria monocytogenes strain isolated from a fish processing plant was avirulent in a plaque-forming assay and in a subcutaneous mouse virulence assay. However, it showed 60% lethality (9/15 mice) when 109 CFU were intraperitoneally injected into mice. Hemolytic L. monocytogenes bacteria were recovered from liver and spleen of the deceased mice, and the pulsed-field gel electrophoresis patterns were indistinguishable for the nonhemolytic and the hemolytic isolates. Sequencing of prfA from the nonhemolytic strain revealed a duplication of 7 bp in the helix-turn-helix region, resulting in a truncated PrfA protein. We propose that the direct repeat of 7 bp causes a reversible inactivation of prfA and that slipped-strand mispairing regulates the phase variation in hemolytic activity and virulence. Nonhemolytic L. monocytogenes strains with identical duplications in prfA were isolated from several sources in France, as well as in Norway, suggesting that the reversible inactivation described in this study is not an isolated event. (26) and indicated a low prevalence of L. monocytogenes in the tested products. However, one producer had a high prevalence of an atypical L. monocytogenes strain over a period of half a year. Forty-two of 90 samples taken at two time points with 6 months between, 45 samples each time, from equipment and products at this plant were positive for the atypical L. monocytogenes strain (26). The atypical isolates appeared with typical L. monocytogenes colonies on OCLA agar, although they were nonhemolytic on blood agar and appeared with atypical white colonies on Rapid⬘L.mono agar plates. Based on hemolytic activity, this strain would have been considered avirulent (3), although in this study, we show that hemolysis and virulence may be phase variable. Phase variation is defined as the random switching of phenotypes at frequencies that are much higher than classical mutation rates. Slipped-strand mispairing, occurring during DNA replication and causing insertion or deletions (9), has been shown to function as a phase variation mechanism in L. monocytogenes (16), Neisseria meningitidis (24), Escherichia coli (23), Bacillus subtilis (10), and Helicobacter pylori (22). A frameshift deletion in a 5⬘ poly(A) homopolymeric tract (HT) in the L. monocytogenes virulence gene inlA causes selective inactivation of inlA and has been used as a model to study the role of HTs in reversible gene inactivation in prokaryotes (16). In the current study, an atypical, nonhemolytic L. monocytogenes strain isolated from a food production plant (26) was shown to harbor a 7-bp direct-repeat sequence in prfA that was lost during passage of the L. monocytogenes strain in mice, restoring hemolytic activity and virulence. These results indicate that prfA is reversibly inactivated and that slipped-strand mispairing regulates phase-variable expression of virulence in L. monocytogenes.
Listeria monocytogenes is a Gram-positive, facultative intracellular bacterial pathogen causing the food-borne infection listeriosis, a rare but serious illness with a mortality rate of 30%. Malignancies, diabetes mellitus, old age, pregnancy, and immunosuppressive diseases and treatments are predisposing factors to listeriosis. In 2007, 0.3 cases per 100,000 population were reported in the EU states (2); however, the annual numbers of reported listeriosis cases are increasing in several European countries (1, 4, 6). More elderly people, an increase in diabetes mellitus in the population, and more individuals on cancer and immunosuppressive medications results in a higher risk imposed by the presence of L. monocytogenes in foods. PrfA, a pleiotropic transcriptional regulator, activates the transcription of L. monocytogenes virulence genes, such as hly, plcA, plcB, and inlA, by binding to a DNA sequence present in the promoter of its target genes. Low production of listeriolysin O results in low hemolytic activity and has been linked to low pathogenicity (3); thus, hemolysis on blood agar is an important criterion in the diagnosis of L. monocytogenes. Chromogenic agars, such as OCLA (Oxoid chromogenic listeria agar) and Rapid⬘L.mono, utilize the expression of phospholipases to distinguish between pathogenic and nonpathogenic Listeria species. Low-virulence L. monocytogenes strains vary in their expression of listeriolysin O and phospholipases (7) and may easily be overlooked when the identification of Listeria species is based upon hemolysis and phospholipase activity. The pathogenicity of low-virulence L. monocytogenes strains toward predisposed individuals is unknown. A survey of L. monocytogenes in smoked salmon was carried out in Norway by the Norwegian Food Safety Authority in 2003 * Corresponding author. Mailing address: Department of Food Safety and Infection Biology, Norwegian School of Veterinary Science, P.O. Box 8146 Dep., N-0033 Oslo, Norway. Phone: 47 22 96 48 12. Fax: 47 22 96 48 50. E-mail:
[email protected]. 䌤 Published ahead of print on 1 April 2011.
MATERIALS AND METHODS Bacterial strains, culture conditions, and confirmation of L. monocytogenes. A survey for L. monocytogenes in smoked salmon in Norway was carried out by the Norwegian Food Safety Authority in 2003 (26). Two atypical, nonhemolytic L.
3478
VOL. 77, 2011
prfA-MEDIATED PHASE-VARIABLE VIRULENCE IN L. MONOCYTOGENES
3479
TABLE 1. Primers used in real-time PCR experiments Primer sequence Gene
plcB prfA plcA hly rpoB a b
Forward (5⬘ to 3⬘)
Reverse (5⬘ to 3⬘)
CAAGCGGAAAAAATACTAGCTA TGGTATCACAAAGCTCACGAGTATTA CACGAGCAATAAAATCCCTAGATTAA CGCAACAAACTGAAGCAAAGG GCTCCACTGCGCGTGAA
CCGCATCATATATTCCTTGAGCTAT CGAAAGCCCCTTTGTAGTATTGTAA GCTTTTTTGTGTGGTTCTCTGAAA GGTGCCATGGATGAAATTGAA TCTTTTACTTCGCCGGTTTCTT
Slopea
%Effb
⫺3.43 ⫺3.47 ⫺3.38 ⫺3.42 ⫺3.36
95.7 94.2 97.6 96.1 98.4
Regression coefficient (slope) was calculated from the regression line in the standard curve. Amplification efficiency (%Eff) was calculated using the slope of the regression line in the standard curve {%Eff ⫽ 关10(⫺1/slope) ⫺ 1兴 ⫻ 100}.
monocytogenes isolates with indistinguishable pulsed-field gel electrophoresis (PFGE) patterns, L. monocytogenes NVH295 and NVH966, were isolated in spring and autumn, respectively, from a fish processing plant included in the survey (26). L. monocytogenes EGDe and EGDe BUG1600 (Pasteur Institute Culture Collection, France) were used as reference strains for sequence analysis and virulence tests. L. monocytogenes strains were cultured in brain heart infusion (BHI) broth (Oxoid) or on blood agar plates (5% bovine blood in blood agar base [Oxoid]) at 37°C. Selective chromogenic agars, such as OCLA (Oxoid chromogenic listeria agar; Oxoid) and Rapid⬘L.mono (Bio-Rad) were used for the identification of L. monocytogenes according to the manufacturers’ instructions. PCR amplification and DNA sequencing. The 16S rRNA gene was amplified using the forward primer 5⬘-ACGGGAGGCAGCAG-3⬘ and the reverse primer 5⬘-ACGGGCGGTGTGTRC-3⬘ (12, 25). All PCRs were carried out in an Eppendorf Mastercycler gradient. DyNAzyme II DNA polymerase (supplied with 10⫻ buffer) and deoxynucleoside triphosphate (dNTP) mix from Finnzymes (Finland) were used as instructed by the manufacturer. The standard program was as follows: 95°C for 1 min, 30 cycles of 95°C for 1 min, 52°C for 1 min, and 72°C for 1 min and then a final extension step of 72°C for 7 min. PCR products were used for DNA sequence analysis performed by Source BioScience Geneservice (United Kingdom). DNA sequences were analyzed using Vector NTI Advance 11 (Invitrogen). Intraperitoneal mouse virulence assay. For investigation of the virulence potential of the nonhemolytic L. monocytogenes strain NVH295, groups of five 7- to 8-week-old outbred female ICR mice (Charles River GMBH, Sulzfeld, Germany) were injected intraperitoneally (i.p.) with 1 ⫻ 109 CFU in 100 l physiological saline. The number of injected bacteria was confirmed by plating serial dilutions on BHI agar. After injection, mice were observed for up to 5 days, and the signs of disease recorded. Mice considered to have survived the infection were killed after 5 days. The spleen and the liver from deceased and euthanized mice were aseptically removed and homogenized in physiological saline, and serial dilutions were plated on blood agar and on Rapid⬘L.mono plates. The experiments in mice complied with the Norwegian School of Veterinary Science’s regulations for care and use of laboratory animals. Subcutaneous mouse virulence assay. The mouse subcutaneous (s.c.) virulence assay was conducted by S. M. Roche at Institut National de la Recherche Agronomique, Tours, France, as previously described (21). Animals were handled humanely according to established protocols (SR-2005-03) under the responsibility of an authorized person (S. M. Roche, Certificat d’autorisation d’expe´rimenter sur des animaux vivants, agreement no. 37-017). Briefly, 7-weekold conventional Swiss female mice (Iffa-Credo, Saint-Germain-sur l’Arbresle, France) were injected s.c. in the left hind footpad with 104 CFU L. monocytogenes, using five mice for each strain. The mice were maintained in a controlled atmosphere during the experiments and killed by cervical dislocation 3 days after inoculation. PFGE. PFGE was performed using the standard CDC PulseNet protocol (8). Briefly, isolates were grown on bovine blood agar plates at 37°C for 18 h. Bacterial cultures were embedded in 1% agarose plugs (SeaKem gold agarose; Cambrex), lysed, washed, and digested with 200 U of the restriction enzyme ApaI (Roche Diagnostics) and 25 U AscI (New England BioLabs) for 18 h at 30°C and 37°C, respectively. Size separation of restricted DNA fragments was performed for 22 h in 1% agarose gels by using a CHEF DR III system (Bio-Rad Laboratories); voltage was set at 6 V/cm with switch times of 4 s to 40.01 s. Lambda ladder PFG marker (New England BioLabs) was used as a reference size standard. Screening for hemolytic subpopulations. To examine the possibility that the hemolytic strain isolated after infection in mice was a subpopulation of L. monocytogenes NVH295, we screened 3 ⫻ 105 colonies on blood agar by plating
dilutions of overnight cultures, followed by 48 h of incubation at 37°C. Each plate was checked for colonies with a hemolytic zone. The screening was performed three times, with 105 colonies each time. To investigate whether the transition from nonhemolytic to hemolytic phenotype could occur on plates, we plated the nonhemolytic mother strain, L. monocytogenes NVH295, for 50 passages on Rapid⬘L.mono plates. This experiment was repeated once. Plaque-forming assay. Cytopathogenicity testing using the HT-29 plaqueforming assay was carried out as previously described (21). The human colon adenocarcinoma cell line HT-29 (ECACC no. 85061109) was used between passages 86 and 95 and maintained as described previously (14). Confluent HT-29 cell monolayers were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with penicillin G (2 ⫻ 104 IU/ml) and streptomycin (20 mg/ml) in 96-well tissue culture plates for 4 or 5 days (Falcon) after the inoculation of 3.2 ⫻ 104 cells or 2.4 ⫻ 104 cells, respectively, in 100 l of culture medium per well. One day before infection, cells were incubated in culture medium without antibiotics. Numbers of 102 to 107 L. monocytogenes cells from an overnight BHI culture at 37°C were added to each well of the monolayers. After 2 h at 37°C, the extracellular bacteria were killed by incubation with 100 g/ml gentamicin for 1 h 30 min. The HT-29 cell monolayers were then overlaid with medium containing 0.8% SeaPlaque GTG agarose (Lonza) supplemented with 10 g/ml gentamicin and, later, with the same culture medium without agarose. After overnight incubation, the wells were examined for the formation of plaques using an inverted microscope. Duplicate wells were used, and the experiment was repeated once for each strain. The results were expressed as the number of plaques obtained for log 7 L. monocytogenes per well. Strains with values within the confidence interval (CI) of the EGDe strain were considered to be cytopathogenic. Expression and purification of His6-PrfA in Escherichia coli. prfA was PCR amplified from chromosomal DNA using primers 5⬘-ATGAACGCTCAAGCA GAAGA-3⬘ and 5⬘-TTAATTTAATTTTCCCCAAGT-3⬘. The PCR products were cloned into the pCR T7/NT-TOPO vector (Invitrogen), and the two His6PrfA proteins were expressed in E. coli BL21pLysS after isopropyl--D-thiogalactopyranoside (IPTG) induction. For visualization of the two overexpressed proteins, samples were run on NuPage polyacrylamide gels in morpholinepropanesulfonic acid (MOPS) buffer according to standard protocols (Invitrogen). The gels were stained with Coomassie blue, and the molecular mass of the proteins was estimated using SeeBluePlus2 standard (Invitrogen). RNA extraction and quantitative RT-PCR. For examination of transcription levels, RNA was isolated from bacteria scraped from blood agar plates incubated for 18 h at 37°C. Total bacterial RNA was extracted using TRIzol reagent (Invitrogen) combined with mechanical disruption with lysing matrix B (MP Biomedicals Europe) in a Mini-BeadBeater-8 (BioSpec) according to the manufacturer’s specifications. DNA was removed from each RNA preparation using a Turbo DNA-free kit (Ambion) according to the manufacturer’s instructions for rigorous DNase treatment. RNA quantity (A260) and purity (A260/280 ratio) were measured in a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). cDNA was synthesized from 500 ng RNA using a high-capacity cDNA reverse transcription (RT) kit (Applied Biosystems) in a 20-l reaction mixture volume according to the manufacturer’s instructions. Relative mRNA levels were determined by quantitative PCR (qPCR). Five microliters of a 1:100 dilution of the cDNA reaction was used as template for qPCR amplification in 25-l final volumes containing 12.5 l of Power SYBR green PCR master mix (Applied Biosystems) and 200 nM each primer. The primers used for qPCR are listed in Table 1. qPCR amplification was performed using a StepOne system (Applied Biosystems). The thermal cycling conditions were 10 min at 95°C followed by 40 cycles of 15 s at 95°C and 1 min at 60°C. Fluorescence was monitored during each extension phase, and a melting curve analysis was performed after each run to confirm the amplification of specific
3480
¨ CK ET AL. LINDBA
APPL. ENVIRON. MICROBIOL.
transcripts. Each assay included triplicate PCR of the samples, negative notemplate controls, and an endogenous (rpoB) control and were performed on three different RNA isolations. The slope of the standard curve and PCR efficiency for each primer pair were created by amplifying serial dilutions of the target (Table 1). The results were analyzed using the relative transcription software tool REST 2008, version 2.0.7 (17). Nucleotide sequence accession numbers. The DNA sequences of prfA from the nonhemolytic L. monocytogenes strain NVH295 and the hemolytic L. monocytogenes strain NVH295-H have been deposited in GenBank under accession numbers JF431462 and JF431463, respectively.
RESULTS Characterization of a nonhemolytic L. monocytogenes isolate. L. monocytogenes NVH295 and NVH966, two isolates with indistinguishable PFGE patterns, were isolated from a fish processing plant in Norway in 2003 as presumptive L. monocytogenes using OCLA agar plates, a selective medium for the isolation of L. monocytogenes. However, the strains appeared with atypical white colonies, instead of typical blue colonies, on Rapid⬘L.mono plates, and were nonhemolytic on blood agar plates after 48 h of incubation at 37°C. About 50% of samples taken from equipment and products were positive for the atypical L. monocytogenes strain, indicating that the strain was well established at this plant (26). Sequencing of the 1,036-bp amplicon of the 16S rRNA gene confirmed that the atypical L. monocytogenes NVH295 and NVH966 strains belonged to the L. monocytogenes species. The sequence revealed 1 and 3 bp that were discrepant between the Listeria marthii and Listeria innocua 16S rRNA genes, respectively. Nonhemolytic L. monocytogenes NVH295 regains hemolytic phenotype after infection in mice. To investigate the virulence potential of the atypical L. monocytogenes NVH295, 109 CFU were injected i.p. into five mice. Three of five mice died between 24 and 60 h after injection, while two of five mice did not show any signs of infection and were euthanized after 5 days. Both hemolytic L. monocytogenes colonies, appearing with typical blue colonies on Rapid⬘L.mono plates, and nonhemolytic white L. monocytogenes colonies were isolated from spleen and liver of mice that died from infection. The experiment was repeated twice, once with the same isolate as was used in the original experiment and once with a different isolate of the same strain, L. monocytogenes NVH966. The results were identical to those of the first experiment. Thus, 9 of 15 mice (60%) died after the injection of the nonhemolytic L. monocytogenes strain NVH295 and NVH966. Both hemolytic and nonhemolytic L. monocytogenes bacteria were recovered from both liver and spleen of all of the deceased mice. From mice euthanized after 5 days without any signs of infection, we did not obtain any Listeria spp. Two different isolates from liver of deceased mice injected with L. monocytogenes NVH295, of which one hemolytic isolate was designated NVH295-H and one nonhemolytic isolate was designated NVH295-NH, were used in further studies. NVH295-H appeared with typical blue colonies on Rapid⬘L.mono agar. The PFGE patterns of the nonhemolytic and the hemolytic isolates were indistinguishable. To examine the relationship between the L. monocytogenes isolates from mice, 10 nonhemolytic and 10 hemolytic isolates, as well as the nonhemolytic mother isolate NVH295, were analyzed by PFGE. The PFGE patterns from both ApaI and AscI digestion of all tested isolates were indistinguishable (data not shown). Figure 1 shows
FIG. 1. The genetic relationship between L. monocytogenes NVH295 and NVH295-H was examined using PFGE. DNA from NVH295 (lanes 1 and 3) and NVH295-H (lanes 2 and 4) digested with ApaI (lanes 1 and 2) and AscI (lanes 3 and 4) showed indistinguishable PFGE patterns, indicating that the atypical strain NVH295 had transformed to a typical phenotype during passage through mice. S, DNA size standard.
the PFGE patterns of ApaI and AscI digestion of the atypical mother strain L. monocytogenes NHV295 that was injected into the mice and the hemolytic L. monocytogenes NVH295-H that was isolated from liver. The hemolytic version is not a subpopulation of nonhemolytic L. monocytogenes NVH295. We did not observe any hemolytic colonies when screening 3 ⫻ 105 colonies for hemolysis on blood agar plates, indicating that L. monocytogenes NVH295-H was probably not a subpopulation of NVH295. When plating L. monocytogenes NVH295, the nonhemolytic mother strain, for 50 passages on Rapid⬘L.mono plates to see if the transition from nonhemolytic to hemolytic could occur on plates, no typical blue colonies were observed throughout the passages. Virulence of the nonhemolytic and the hemolytic versions of L. monocytogenes. Both the hemolytic and the nonhemolytic L. monocytogenes isolate were tested in the plaque-forming assay and in the s.c. mouse virulence assay. L. monocytogenes NVH295 expressed no cytopathogenicity in the plaque-forming assay, while L. monocytogenes NVH295-H expressed a log value within the CI of the EGDe control strain (6.22 ⫾ 0.07 [mean ⫾ standard deviation]) and was thus considered to be cytopathogenic (Table 2). L. monocytogenes NVH295-H was highly virulent in the s.c. mouse virulence assay, while L. monocytogenes NVH295 did not infect the mice when 104 CFU were injected s.c. (Table 2). Atypical appearance is caused by mutation in prfA. To investigate the cause of the atypical phenotype of L. monocytogenes NVH295, we sequenced prfA, hly, plcB, and plcA from
VOL. 77, 2011
prfA-MEDIATED PHASE-VARIABLE VIRULENCE IN L. MONOCYTOGENES
3481
TABLE 2. Expression of virulence of L. monocytogenes strains NVH265, NVH295-H, and NVH295-NH measured by formation of plaques in the human adenocarcinoma cell line HT-29 and in the mouse virulence assay Result for: Strain
Source
Hemolysis assay
Plaque-forming assaya (mean log ⫹ SD)
Mouse virulence assayb
EGDe (control) NVH295 NVH295-H NVH295-NH
Reference strain Fish processing plant Liver of mouse injected with NVH295 Liver of mouse injected with NVH295
⫹ ⫺ ⫹ ⫺
6.22 ⫾ 0.07 0 6.11 ⫾ 0.13 0
Not determined 0/5 5/5 Not determined
a b
The results for the plaque-forming assay are expressed as the number of plaques obtained for 107 CFU deposited per well. The results for the s.c. mouse virulence assay are expressed as the ratios of infected mice to inoculated mice.
both NVH295 and NVH295-H. Sequencing revealed a 7-bp duplication of the bases CAGGAGT in the prfA gene of L. monocytogenes NVH295 in comparison to the prfA genes of L. monocytogenes NVH295-H and L. monocytogenes EGDe (Fig. 2). The duplication resulted in a change of reading frame and a premature stop codon. The truncated PrfA protein of NVH295 consisted of 184 amino acids (aa), in contrast to the 237-aa wild-type PrfA proteins of NVH295-H and L. monocytogenes EGDe (Fig. 2). The prfA sequences from the two isolates NVH295 and NVH295-H were cloned and overexpressed in E. coli as histidine-tagged proteins. The theoretical calculated molecular-mass values of the truncated PrfA from NVH295 and PrfA from NVH295-H were 25 and 31 kDa, respectively. This corresponds well with the sizes of the two overexpressed PrfA proteins estimated using SDS-PAGE (Fig. 3). Transcript levels of prfA, hly, plcA, and plcB in NVH295-H compared to the levels in NVH295. The relative transcript ratios between the prfA, hly, plcA, and plcB genes of the hemolytic strain NVH295-H and the nonhemolytic mother strain NVH295 after 18 h of incubation on blood agar plates are shown in Fig. 4. The relative transcript levels of hly, plcA, and plcB in NVH295-H were 251, 119, and 50 times higher, respectively, than the levels in NVH295. The differences between the two strains were significant for hly, plcA, and plcB (n ⫽ 3, P ⬍ 0.02), while transcription of prfA did not differ significantly.
DISCUSSION Conventionally, lack of hemolytic activity in L. monocytogenes has been linked to low pathogenicity (3), and unfortunately, nonhemolytic L. monocytogenes isolates may be mistaken for nonvirulent Listeria species. We have characterized a nonhemolytic strain repeatedly isolated from a food processing plant (26), and when this atypical strain, NVH295, was injected i.p. into mice, we observed 60% lethality. Unexpectedly, we isolated both nonhemolytic and hemolytic L. monocytogenes strains with indistinguishable PFGE patterns from liver and spleen of the deceased mice, indicating that the hemolytic isolates were derived from the injected nonhemolytic L. monocytogenes NVH295. Further characterization of one of the hemolytic isolates, L. monocytogenes NVH295-H, revealed that it showed the characteristics of a fully virulent strain when subjected to plaque-forming assay and s.c. mouse virulence assay (Table 2). In contrast, the mother isolate, NVH295, was typed as nonvirulent in these assays. In the current study, we show that the switch from nonhemolytic NVH295 to hemolytic NVH295-H coincides with the restoration of a full-length prfA, encoding the virulence regulator PrfA. In the nonhemolytic isolate, prfA carries a 7-bp insertion that results in a frameshift mutation and premature termination of the PrfA protein (Fig. 2). The inserted 7 bp appear as a direct repeat, indicating that the restoration of
FIG. 2. Sequencing of prfA revealed a 7-bp duplication after aa 173 (in red). The insertion causes a frameshift that results in a premature stop of translation at aa 184. The sequence of L. monocytogenes NVH295 is compared to the prfA sequences of L. monocytogenes EGDe and NVH295-H that lack the 7-bp duplication. NVH295 PrfA lacks parts of the HTH motif and the entire C-terminal stabilizing domain G1, -2, and -3.
3482
¨ CK ET AL. LINDBA
FIG. 3. Coomassie blue-stained SDS-PAGE gel showing the overexpressed His-tagged PrfA from NVH295 (lane 3) and NVH295-H (lane 5). Lanes: 1, size standard; 2 and 4, uninduced cultures of NVH295 and NVH295-H. The estimated sizes of the truncated Histagged NVH295 PrfA and the His-tagged NVH295-H PrfA were 25 kDa and 31 kDa, respectively.
functional prfA in NVH295-H has occurred through a slippedstrand mispairing mechanism, excising one copy of the repeated 7 bp. Slipped-strand mispairing mechanisms may occur between the mother and the daughter strand during replication, and short sequence repeats appear to be hot spots for this event (9, 13). There is no apparent mechanism (e.g., slippage of the DNA polymerase) explaining the insertion of the 7-bp repeat. It is likely that the reversion mechanism reported here only occurs unidirectionally (i.e., elimination of the 7-bp repeat) and, thus, may not represent a phase-switching phenomenon. The appearance of the hemolytic phenotype in strain NVH295 occurs with a frequency of less than 1 in 3 ⫻ 105 under the tested conditions. The frequency of adenosine insertion restoring the inlA translational frame in the 5⬘ poly(A) HT in L. monocytogenes inlA is about 1,000-fold higher than the estimated average point mutation frequency (16). However, since the frequencies of frameshift mutations in poly(A) HTs increase with the numbers of As in the HT (15), we expect the mutation rate resulting from slipped-strand mispairing to be much higher in HTs than in a 7-bp duplication. Since NVH295 was nonvirulent when subjected to the s.c. mouse virulence assay, it appears that s.c. injection of 104 CFU is below the critical dose required for the transformation to occur. Further investigations will be required to determine whether hemolytic clones appear with different frequencies during infection in mice and during growth in the laboratory. Previous observation of switching between hemolytic and nonhemolytic phenotypes in L. monocytogenes was presented in a study by Pine et al. (18), in which a culture of L. monocytogenes ATCC 35152 contained both hemolytic and nonhemolytic colonies upon shipment from the American Type Culture Collection (ATCC). The two phenotypes occurred in ratios of approximately 3:1 and were stable when restreaked on agar plates. In contrast to the current study, in which hemolytic isolates were derived from a nonhemolytic strain, the investigations by Pine et al. (18) indicated that the avirulent, nonhemolytic strain had derived from the virulent strain. However, the molecular mechanism involved in the transition between
APPL. ENVIRON. MICROBIOL.
FIG. 4. Box-and-whisker plot representing increases in the relative transcription levels of prfA, hly, plcA, and plcB in the hemolytic L. monocytogenes strain NVH295-H compared to their transcription in the nonhemolytic strain NVH295 after 18 h of incubation on blood agar plates. Gene transcription was quantified by RT-qPCR, and data were analyzed using REST 2009, version 2.0.13, software (17). rpoB was used as the internal standard, and three independent experiments were performed. The horizontal lines in the boxes represent the median values, and the boxes encompass 50% of the observations. The whiskers represent the outer 50% of the observations.
hemolytic and nonhemolytic L. monocytogenes ATCC 35152 is not known. Transcriptional analysis demonstrated that transcript levels of the PrfA-regulated genes hly, plcA, and plcB, encoding the major virulence factors listeriolysin O, phosphoinositide-specific phospholipase C (PI-PLC), and phosphatidylcholine-specific phospholipase C (PC-PLC), respectively, showed 50- to 250-fold increases in the hemolytic strain (Fig. 4). These results correspond well with those of previous studies showing that the expression of PC-PLC and PI-PLC was negligible in the absence of a functional prfA, while the expression of listeriolysin O was strongly reduced (5, 11, 15, 20). The observed strong increases in the expression of the major virulence factors probably account for the observed dramatic increase in the virulence potential of strain NVH295-H (Table 2). Thus, the restoration of a functional prfA probably accounts for the transition from the nonhemolytic NVH295 to the hemolytic NVH295. Interestingly, the 7-bp direct repeat present in prfA of NVH295 has previously been observed in three low-virulence L. monocytogenes strains, AF95, BO38, and BO18, that were isolated from foods and a food-manufacturing plant in France (19, 20, 21). The PGFE profiles obtained for these strains (S. M. Roche, personal communication) closely resembled those obtained for L. monocytogenes NVH295 and NVH295-H (Fig. 1). Furthermore, the PFGE patterns of NVH295 and NVH295-H were indistinguishable from those of four hemolytic isolates typed as part of an investigation of 50 L. monocytogenes isolates from Norwegian salmon, patients, and environment (T. Lindba¨ck, unpublished data). Two of the isolates, NVH1264 and NVH1342, were isolated from smoked salmon at a food processing plant in Norway in 1994 and in 1995, respectively. NVH1069 and NVH1370 were clinical isolates from hospitalized patients from different parts of Norway in 1992 and 1993, indicating that these strains are human pathogens. These eight strains thus appear to belong to a subgroup of L. monocytogenes with similar PFGE patterns. At present, it
VOL. 77, 2011
prfA-MEDIATED PHASE-VARIABLE VIRULENCE IN L. MONOCYTOGENES
is not known whether the apparent prfA-mediated phase-variable expression of virulence is restricted to other low-virulence strains belonging to this phylogenetic group. Regardless, considering the potential risk for predisposed individuals, the possibility of reversal of low-virulence to virulent strains during infection should be taken into account when assessing the virulence potential of a given isolate of L. monocytogenes. ACKNOWLEDGMENTS We thank Sylvie M. Roche for conducting the mouse virulence assay and Annette Fagerlund for fruitful discussions and for critically reading the manuscript. REFERENCES 1. Allerberger, F., and M. Wagner. 2010. Listeriosis: a resurgent foodborne infection. Clin. Microbiol. Infect. 16:16–23. 2. Anonymous. 2009. The community summary report on trends and sources of zoonoses and zoonotic agents in the European Union in 2007. EFSA J. 223:136–158. 3. Cossart, P., et al. 1989. Listeriolysin O is essential for virulence of Listeria monocytogenes: direct evidence obtained by gene complementation. Infect. Immun. 57:3629–3636. 4. Denny, J., and J. McLauchlin. 2008. Human Listeria monocytogenes infections in Europe—an opportunity for improved European surveillance. Euro. Surveill. 13:pii⫽8082. 5. Domann, E., et al. 1993. Detection of a prfA-independent promoter responsible for listeriolysin gene expression in mutant Listeria monocytogenes strains lacking the PrfA regulator. Infect. Immun. 61:3073–3075. 6. Goulet, V., C. Hedberg, A. Le Monnier, and H. de Valk. 2008. Increasing incidence of listeriosis in France and other European countries. Emerg. Infect. Dis. 14:734–740. 7. Gracieux, P., S. M. Roche, P. Pardon, and P. Velge. 2003. Hypovirulent Listeria monocytogenes strains are less frequently recovered than virulent strains on PALCAM and Rapid⬘ L. mono media. Int. J. Food Microbiol. 83:133–145. 8. Graves, L. M., and B. Swaminathan. 2001. PulseNet standardized protocol for subtyping Listeria monocytogenes by macrorestriction and pulsed-field gel electrophoresis. Int. J. Food Microbiol. 65:55–62. 9. Henderson, I. R., P. Owen, and J. P. Nataro. 1999. Molecular switches—the ON and OFF of bacterial phase variation. Mol. Microbiol. 33:919–932. 10. Kearns, D. B., F. Chu, R. Rudner, and R. Losick. 2004. Genes governing swarming in Bacillus subtilis and evidence for a phase variation mechanism controlling surface motility. Mol. Microbiol. 52:357–369.
3483
11. Kim, H., H. Marquis, and K. J. Boor. 2005. SigmaB contributes to Listeria monocytogenes invasion by controlling expression of inlA and inlB. Microbiology 151:3215–3222. 12. Lane, D. J., et al. 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci. U. S. A. 82:6955– 6959. 13. Levinson, G., and G. A. Gutman. 1987. Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol. Biol. Evol. 4:203–221. 14. Lindba ¨ck, T., M. E. Rottenberg, S. M. Roche, and L. M. Rorvik. 2010. The ability to enter into an avirulent viable but non-culturable (VBNC) form is widespread among Listeria monocytogenes isolates from salmon, patients and environment. Vet. Res. 41:8. 15. Lingnau, A., et al. 1995. Expression of the Listeria monocytogenes EGD inlA and inlB genes, whose products mediate bacterial entry into tissue culture cell lines, by PrfA-dependent and -independent mechanisms. Infect. Immun. 63:3896–3903. 16. Orsi, R. H., B. M. Bowen, and M. Wiedmann. 2010. Homopolymeric tracts represent a general regulatory mechanism in prokaryotes. BMC Genomics 11:102. 17. Pfaffl, M. W., G. W. Horgan, and L. Dempfle. 2002. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30:e36. 18. Pine, L., et al. 1987. Listeria monocytogenes ATCC 35152 and NCTC 7973 contain a nonhemolytic, nonvirulent variant. J. Clin. Microbiol. 25:2247– 2251. 19. Roche, S. M., et al. 2003. Experimental validation of low virulence in field strains of Listeria monocytogenes. Infect. Immun. 71:3429–3436. 20. Roche, S. M., et al. 2005. Investigation of specific substitutions in virulence genes characterizing phenotypic groups of low-virulence field strains of Listeria monocytogenes. Appl. Environ. Microbiol. 71:6039–6048. 21. Roche, S. M., et al. 2001. Assessment of the virulence of Listeria monocytogenes: agreement between a plaque-forming assay with HT-29 cells and infection of immunocompetent mice. Int. J. Food Microbiol. 68:33–44. 22. Sanabria-Valentin, E., M. T. Colbert, and M. J. Blaser. 2007. Role of futC slipped strand mispairing in Helicobacter pylori Lewisy phase variation. Microbes Infect. 9:1553–1560. 23. Torres-Cruz, J., and M. W. van der Woude. 2003. Slipped-strand mispairing can function as a phase variation mechanism in Escherichia coli. J. Bacteriol. 185:6990–6994. 24. van der Ende, A., et al. 1995. Variable expression of class 1 outer membrane protein in Neisseria meningitidis is caused by variation in the spacing between the ⫺10 and ⫺35 regions of the promoter. J. Bacteriol. 177:2475–2480. 25. Wichels, A., S. Wurtz, H. Dopke, C. Schutt, and G. Gerdts. 2006. Bacterial diversity in the breadcrumb sponge Halichondria panicea (Pallas). FEMS Microbiol. Ecol. 56:102–118. 26. Yndestad, M., and K. Hauge. 2006. Listeria monocytogenes i norskprodusert røkelaks. Norwegian Food Safety Authority, Oslo, Norway.
