ABSTRACT. Activation of the retinoic acid receptor (RAR) (32 promoter is known to be mediated by a RA response element located in the proximity of the ...
Nucleic Acids Research, 1992, Vol. 20, No. 23 6393 -6399
A cyclic AMP response element is involved in retinoic acid-dependent RARfl2 promoter activation Frank A.E.Kruyt, Gert Folkers, Christina E.van den Brink and Paul T.van der Saag* Hubrecht Laboratory, Netherlands Institute for Developmental Biology, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands Received July 2, 1992; Revised and Accepted November 9, 1992
ABSTRACT Activation of the retinoic acid receptor (RAR) (32 promoter is known to be mediated by a RA response element located in the proximity of the TATA-box. By deletion studies in P19 embryonal carcinoma cells we have analyzed the RAR(32 promoter for the presence of additional regulatory elements. We found that the cyclic AMP response element-related motif, TGATGTCA at position -99 to - 92, is able to enhance RAdependent RAR,B2 promoter activation. In addition we demonstrate that this element, designated CRE-i2, is functionally active as a CRE since it can bind members of the CREB/ATF transcription factor family and, moreover, mediates the stimulatory effect of cAMP on RA-dependent RAR(2 promoter activation in human foetal kidney 293 cells.
INTRODUCTION The vitamin A metabolite, retinoic acid (RA), is known to play a fundamental role in cellular growth and differentiation, as well as in vertebrate development (for reviews see refs. 1-4). Since RA appeared to be involved in specifying the antero-posterior axis of the central nervous system in Xenopus laevis (5) and is able to influence the development and regeneration of limbs (6-9), it is thought that RA could be a naturally occurring morphogen. In the embryonal carcinoma (EC) cell-system, which is used as a model-system for studying early embryonal development, the administration of varying concentrations RA in combination with different culture conditions can induce differentiation towards specific cell types such as muscle and neural cells (10, 11). The identification of two subfamilies of retinoid receptors, the Retinoic acid receptors (RARs) and Retinoid X receptors (RXRs), belonging to the superfamily of nuclear hormone receptors which function as ligand-inducible transcription factors and modulate gene expression via hormone response elements (12-14), has greatly enhanced our understanding of the way in which RA exerts its effects. Both types of retinoid receptors consist of several isoforms, designated RARai, ,B and -y (15 -24) and RXRa, (3and -y (25 -28). Recently, 9-cis RA has been identified as the natural ligand for RXRs, whereas RARs have a high *
To whom correspondence should be addressed
affinity for both all-trans and 9-cis RA (29, 30). In addition it has been demonstrated that heterodimers of RXRs with RARs and the thyroid hormone receptor bind much more efficiently to their corresponding response elements than homodimers, suggesting a convergence of the signalling pathways of these nuclear receptors (27, 28, 31, 32). RAR subtypes have found to be distinctly and spatio-temporally expressed in restricted patterns during mouse embryogenesis, which suggests a specific role for these receptors in vertebrate development (33-36). The RAR isoforms, which diverge only in their N-terminal parts, are generated by the usage of two promoters and alternative splicing (19, 21-24). For RAR(3 e.g., to data three mRNA species have been characterized, mRAR-(1, -,B2 and -(33, which expression is controlled by two promoters (24). The (31 and (3 transcripts are initiated from a promoter which is located approx. 20 kb upstream from the second promoter which regulates expression of the RAR(32 isoform. The high levels of mRNA(31 and -(33 transcripts found in fetal and adult brain suggest a possible role for these isoforms in the development of the central nervous system, while the mRAR-,B2 transcript which expression predominates in RA-treated EC and embryonal stem (ES) cells might be important during early stages of development (24). Transcriptional activation of both the human and mouse RAR,B2 promoter has been shown to be mediated by a RA response element (RARE) located in the proximity of the TATA box (37-39). In earlier studies we have found by transient transfection assays in murine P19 EC cells that besides the RAR(2 promoter fragment, comprising the RARE, also a more upstream positioned fragment in both the human and mouse promoter contributes to the activation of the promoter by RA (39, 40). In this report we have analyzed in more detail which sequences are involved in mediating this additional stimulatory effect in RA-dependent RAR(2 promoter activation. We found that the motif TGATGTCA, located at position -99 to -92 and closely resembling the consensus sequence of the cyclic AMP response element (CRE) TGACGTCA, is responsible for the observed enhancement. We demonstrate that this element, designated CRE-032, is functionally active as a CRE since it can bind members of the CREB/ATF transcription factor family and, moreover, mediates the observed stimulatory effect of CAMP on RA-dependent RAR(2 promoter activation in human foetal kidney 293 cells.
6394 Nucleic Acids Research, 1992, Vol. 20, No. 23
MATERIALS AND METHODS Cells and plasmid constructions P19 EC cells were cultured on gelatin-coated dishes in a 1:1 mixture of Dulbecco's Eagle medium (DMEM) and Ham's F-12 containing 7.5% (v/v) fetal calf serum (FCS). Human foetal kidney (293) (41) cells were cultured on dishes in DMEM supplemented with 7.5% (v/v) FCS. Some of the chloramphenicol acetyl transferase (CAT) constructs used have been described earlier (40). Additional constructs were prepared by subcloning several portions of the human RARj32 promoter, a DdeI-BamHI (-335/+156)-, a HpaIl-BamHI (-180/ + 156) and a SmaI-BamHI (-63/ + 156) fragment, in the promoterless pKTCAT vector. RAR,32 CRE-TKCAT (CRE-,B2-TKCAT) and fibronectin CRE-TKCAT (CRE-f TKCAT) were constructed by subsequent subcloning of the following annealed synthetic oligodeoxynucleotides in pBLCAT2 (42): CRE-,2, sense 5'-agcttGAGTTGGTGATGTCAGACTAG-3' and anti-sense 5'-gatcCTAGTCTGACATCACCAAC TCa-3'; CRE-F, sense 5'-agcttCCCGTGACGTCACCG-3' and anti-sense 5'-gatcCGGTGACGTCACGGGa-3'. Added nucleotides, shown in lowercase letters, form after the annealing of the oligo's Hindu and BamHI complementary cohesive ends. Site-directed mutants of the RARI32 promoter were constructed by using the Altered Sites in vitro Mutagenesis System kit (Promega). The structure of these mutants is illustrated schematically in Fig. 3A. For mutagenesis, ssDNA derived from the vector pSELECT inserted with the HpaII-BamHI (-180/ + 156) promoter fragment functioned as a template. The ACRE-$ and ATRE-(3 constructs were made by using the synthetic oligodeoxynucleotides, 5'-ATCCTGGGAGTTGGaGATGTtAGACTAGTTGGGTC-3' and 5'-ATGTCAGACTAGTgtGGTCATTTGAAGG-3', respectively, with the altered bases shown in lowercase letters, abolishing the proper function of these elements (43, 44). The double mutant, ACRE/TRE-3, was constructed by deletion of the SpeI-BamHI fragment, with SpeI cutting between the CRE and TRE sequences at position -90, from the ACRE-$ mutant, followed by insertion of the corresponding fragment obtained from the ATRE-(8 mutant. After confirming the sequence of the mutant constructs by dsDNA sequencing, using the T7 sequencing kit (Pharmacia), the HpallBamHI fragments were ligated in pKTCAT. Transient transfection assays Transient transfections were performed as previously described (40). Briefly, cells grown on dishes (diameter 3.5 cm) were transfected with 10g CAT reporter construct DNA in combination with I tg DNA of a vector containing the SV40 early promoter driven LacZ gene (SV2-lacZ) in order to correct for possible differences in transfection efficiency. Sixteen hours after transfection fresh medium was added to the cells together with RA and/or forskolin (final concentrations 1 and 10AM, respectively), when appropriate. After 24 hours cells were harvested and CAT activity was determined. Quantification of the reaction products, separated by thin layer chromatography, was performed by using a Phospho Imager with Image Quant software (Molecular Dynamics Inc.), after which percentages conversion could be calculated. RNA isolation and Northern blotting Total cellular RNA was isolated using the acid-phenol single step method (45). Total RNA (15,tg) was denaturated for 10 min at
68°C in 50% (v/v) formamide, 2.2 M formaldehyde, 20 mM MOPS pH 7.0, 5 mM sodium acetate, 1 mM EDTA, separated through 0.8% agarose/2.2 M formaldehyde gels, and subsequently transferred to Hybond C-extra filters (Amersham) in 20xSSC. RNA was immobilized by baking at 80°C for 2 hr under vacuum. Hybridization was performed in 50% (v/v) formamide, 5 xSSC, 50 mM sodium phosphate pH 6.8, 10 mM EDTA, 0.1 % (w/v) NaDodSO4, 0.1 mg of sonicated salmon sperm DNA per ml, 2 x Denhardt solution at 42°C overnight. 32P-labeled probes, human RAR,8- and ,B-actin cDNAs, were generated using a multiprime DNA labeling kit (Amersham). After hybridization and washing, filters were exposed to Kodak XAR-5 film at -70°C using intensifying screens. The intensity of the RARjr specific bands was determined by using a Phospho Imager (Molecular Dynamics Inc.) and was related to the j3-actin signal to correct for possible differences in the amount of RNA loaded in each lane. Gel retardation assays Nuclear protein extracts were prepared by using the mini-scale method as described by Lee et al. (46). Protein concentrations were determined by the Biorad protein assay according to the manufacturers protocol. Sequences of the double stranded oligonucleotides used in the assay were: CRE-f and CRE-(3 as described above; the adenovirus 4 octamer motif (OCT) CACGCCT TA-TTTGCATATTACT; the RAR(32 retinoic acid response element (RARE-,82) CCGGGTAGGGTTCACCGAAAGTTCACTCG; the RAR(32 TPAlike response element (TRE-,B2) GTTGGGTGATT; human collagenase TRE (TRE-col.) AGCTT GATGAGTCAGCCG. Probes were generated by labelling the cohesive ends with cZ-32PdATP using Klenow fragment of DNA polymerase I. Labeled DNA fragments were separated from unincorporated nucleotides by gel filtration using Sephadex G-50 spin columns (Pharmacia) equilibrated in lOmM Tris-HCl (ph 8.0), 1 mM EDTA, 150mM sodium chloride. The electrophoretic mobility shift assay (EMSA) used is based on the procedures described by Fried and Crothers (47) with slight modifications. Nuclear extracts (4kg) were incubated in a reaction buffer containing lOmM Tris-HCl (pH 8.0), 0.1 mM EDTA, 75 mM KCG, 10% (v/v) glycerol, 1 mM DTT, 0. 1 mg/ml poly(dI-dC), 100 ng/ml pUC18 plasmid DNA, with 0.1 to 0.5 ng of 32P-labeled DNA fragment (specific activity 1-5 x 108 /jig) on ice for 20 min. Loading buffer, containing 0.2% (w/v) bromophenolblue, 0.2% (w/v) xylenexyanol-F, 20% (v/v) glycerol, was added and the mixture was immediately loaded onto a 5% polyacrylamide gel and electrophoresed in 0.5 xTBE (25 mM Tris pH 8.0, 25 mM boric acid, and 1 mM EDTA) for 4 hr. The gel was fixed in 10% (v/v) methanol/10% (v/v) acetic acid, dried and exposed to Kodak XAR or Fuji RX film for 1 -3 days. The level of binding activity was determined by using a Phospho Imager (Molecular Dynamics Inc.).
RESULTS Sequences between -180 and -63 enhance RA-dependent RARj32 promoter activation In previous studies (39, 40) we have identified upstream sequences in both the human- and mouse RAR,62 promoter which enhance the RA-dependent activation of the promoter mediated by the RARE located at position -57 to -36 (37, 38). In transient transfection assays in P19 EC cells it appeared that
Nucleic Acids Research, 1992, Vol. 20, No. 23 6395 20 consensus
16
0
10
-1470 -745
-335
-180
-63
constructs
Figure 1. Deletion analyses of the human RAR,82 promoter. Different CAT constructs, containing 5' progressive deletions of the RAR,B2 promoter, were tested for RA-induced transactivation in P19 EC cells. The mean + SEM of four independent experiments is shown.
TRE TGAGTCA
hRAR#2 -108 mRAR#2 -109
GG GAGTTGG TGATGTCA
GAC
TAGT TGGGTCA TTTGAAGGTTAGCAGCCC -60
TCATGTCA
---
-G-- TGGGTC
mRARa2
-119
- -C------ TGATGTCA
hRARW2
-118
._
I-
CRE
TGACGTCA
-
------
------------------
-60
C- -- G -63 CGG-C-GCGGTGGC TGGGTCA G-C--G - - - G-GC - -C------ TGATGTCA CGG-C-GCGGTGGG TGGGTCA C-C-G- - --G- -- - -G -62
Figure 2. Sequence comparison of upstream promoter regions of the murine and human RARa and RAR,8 genes. Depicted are the consensus cyclic AMP-(CRE) and TPA-response elements (TRE) and related motifs in the RARct and RARB3 promoters are underlined. RARa2 and RARj32 promoter sequences were derived from Leroy et al. (23) and Shen et al. (39), respectively.
A
CRE-062
TRE-,2
-180
-/-----TGATGTCA------TGGGTCA---/-RARE---TATA--/-
AC
-/--&GATGTIA-TGGGTCA-/-RARE--TATA-/-/-TGATGTCA---IGGTCA-/-RARE-TATA-/-
AT
+ 156
AC/r -/--&GATGTIA------QIGGTCA-/-RAtE-TATA-/-
sequences between -563 to -63 in the mouse- and -745 to -63 in the human RAR32 promoter are able to enhance RAdependent promoter activation approximately 3-fold. To determine more precisely the position of these enhancer sequences we performed a deletion analysis on CAT reporter constructs containing 5' progressive deletions of the hRARj32 promoter and measured their activation by RA in transient transfection assays in P19 EC cells. All constructs were devoid of promoter activity in the absence of RA. Upon RA-treatment, comparable levels of activation were detected with the reporter constructs containing the RAR,B2 promoter fragments - 1470/ -745/, -335/and - 180/+156, while an approximately 2.5 fold lower level of activation was found with the -63/ + 156 CAT construct (Fig. 1). These results suggest the presence of (a) cis-acting element(s) in the - 180/-63 promoter region, which enhance(s) RAdependent activation of the RAR,32 promoter.
A cAMP response element-related sequence in the - 180/-63 fragment enhances RA-dependent RARI32 activation To identify putative regulatory elements in the -180/-63 RARI32 promoter region we performed a DNA sequence comparison between the - 180/-63 region and the DNA binding motifs of known transcription factors. In this way two putative cis-acting elements were found; a cyclic AMP response element (CRE) related sequence at position -99 to -92 and a TPA response element (TRE) or API binding site at position -84 to -78, which were designated CRE-f2 and TRE-f2, respectively. As depicted in Figure 2, the CRE-42 sequence, TGATGTCA, differs from the eight-base consensus CRE sequence, TGACGTCA (for reviews see refs 48, 49), by one base substitution (C-T) at position four. A group of leucine zipper containing proteins has been found to bind the CRE and has been referred to as CRE-binding protein (CREB) or activating transcription factor (ATF) (48-50). The TRE-j2 sequence, TGGGTCA, is identical to the oestrogen response element identified in the chicken ovalbumin gene promoter (51) and is closely related to the TRE consensus sequence, TGACTCA, which is known to bind the transcription factor AP1 (43, 52). Interestingly, as shown in Figure 2, these elements are conserved in both the mouse and human RAR(32 promoter, and also in the recently characterized RARc2 promoter (23). This implicated
B
125
(C>, 100
.2
is
0
a
U0 U
z
-180
AC/IT
AC
AT
construct
Figure 3. Effect of mutation of the putative cyclic AMP- and TPA-response elements in the RAR,32 promoter upon its activation by RA in P19 EC cells. (A) Schematic representation of the - 180/+156 RAR,62 promoter region and the mutated derivatives in which either the CRE (AC), TRE (AT) or both motifs (AC/T) were disrupted. Depicted are the relative positions of the putative CRE and TRE, the RARE and TATA-box. Altered nucleotides are underlined. (B) The fragments in (A) were fused to the CAT gene and RA-dependent activation was determined. The level of activation is depicted as a percentage of the level found on the wild-type construct (100%). The mean SEM of four independent experiments is shown.
to us a possible function for these elements in transcriptional activation of these RA-inducible promoters. In order to investigate whether either one of these or both putative cis-acting elements are functional, -180/ +156 CAT reporter constructs were generated in which either the CRE (AC), the TRE (AT) or both motifs (AC/T) were disrupted by sitedirected mutagenesis (Figure 3A), and the response to RA was determined. As can be seen in Figure 3B, no significant decrease in RA-response was observed on the ATRE construct, while mutation of the CRE resulted in an approximately 2.5-fold lower level of RA-induced CAT activity as compared to the level found on the -180/ +156 construct. These results demonstrate that the
CRE-(32 is responsible for the enhancement on RA-dependent RAR,B2 promoter activation we observed on the - 180/-63 promoter region. We next examined whether CRE-32 could confer responsiveness to RA when fused to the heterologous thymidine kinase (TK) promoter of pBL2CAT, and moreover, we compared
6396 Nucleic Acids Research, 1992, Vol. 20, No. 23 ,
CRE-pA2
TGATGTCA
CRE-F
I TGACTCA IJ
p3L2CAT
30
_ 25
=
no RA
15.
=
+ RA
-010
iI
''
20
c,
5. CRE-F
pBL2
CRE-32
construct
Figure 4. CRE-,B2 and CRE-F mediated RA-responsiveness in P19 EC cells. Oligonucleotides containing the putative CRE from the RARj32 promoter (CRE,B2) and the CRE from the fibronectin promoter (CRE-F) (53) were inserted upstream from the herpes thymidine kinase promoter element of pBL2CAT (pBL2). The constructs were transfected in P19 EC cells and CAT activity was determined in untreated and RA-treated cells.
PROBE EXTRACT RA
hr-
-
CRE
OC1l
Pig EC
Plg FC
S 0
2
zump
none
144
..lX '4
4
8
24
-0 ne
LrC
Figure 6. The CRE from the fibronectin promoter competes for CRE-(32 binding activity. Gel retardation assay using CRE-,32 oligonucleotides as probe and nuclear exats from P19 EC cells treated for 24 hrs with RA. Competition was perfonred with an increasing molar excess of CRE-(32, CRE-F and RARE-,B2 oligonucleotides.
Jbbd&Jb
eimi~~4in . Figure 5. CRE-i32 binds nuclear proteins from P19 EC cells and binding activity increases upon RA-treatment. Gel retardation assays using a32P-labelled CRE,62 oligonucleotides and nuclear extracts derived from P19 EC cells treated for increasing periods of time with RA. The complexes formed are indicated with C. The same nuclear extracts were used in combination with an octamer (OCT) containing oligonucleotide of which the Oct-I binding activity served as an internal standard. Oct4 binding activity is also indicated. Competition was performed with a 200-fold molar excess of either CRE-32 (CR.) or Oct (OC.) oligonucleotides.
its response with a similar construct containing the (consensus) CRE as found in the promoter of the human fibronectin gene (53). Therefore, the two elements, synthetically obtained as oligonucleotides, were inserted into the same position in pBL2CAT (see Fig. 4) and their response to RA was determined in transient transfection assays in P19 EC cells. Interestingly, in the absence of RA CRE-f02/TKCAT mediated an approximately 3-fold higher level of basal activity than CREF/TKCAT and the empty vector pBL2CAT, which both had comparable levels of activity (Fig. 4). This result indicates that in untreated P19 EC cells a protein is expressed that specifically can transactivate through CRE-(32 but not through CRE-F. Upon RA treatment, we observed a 2- and 4-fold increase in levels of CAT activity in CRE-F- and CRE-(02/TKCAT transfected cells, respectively, compared to the situation found in cells
transfected with the control vector pBL2CAT in the presence of RA (Fig. 4). This finding demonstrates that the CRE-,B2-mediated enhancement of promoter activation is largely independent of RA since a similar increase in CAT activity is detected in the absence or presence of RA in this case (3- versus 4-fold) when compared to the activation of the control vector pBL2CAT alone. On the contrary, activation through CRE-F requires the presence of RA which indicates that CRE-32 and CRE-F have different transactivation properties in these cells. of CRE-,B2 binding in P19 EC cells treated with retinoic acid We next examined whether CRE-(2 is able to bind nuclear proteins from P19 EC cells and studied in addition the effect of RA-treatment on its binding activity. For this purpose electrophoretic mobility shift assays were performed with a 32p labeled synthetic oligonucleotide encompassing CRE-32 with nuclear extracts from P19 EC cells treated for increasing periods of time with RA. The level of CRE-,B2 binding activity was related to the level of Oct-I protein-DNA binding complex found in the same nuclear extracts obtained by using an octamer motif containing oligonucleotide as probe (Fig. 5). The level of Oct-l binding activity has been demonstrated to remain unaltered upon RA-treatment of P19 EC cells and therefore can be used as an internal standard. This is in contrast to the Oct-4 binding activity which decreases upon RA-treatment (54) as shown in Fig. 5. Specific and non-specific competition with a 200-fold molar excess using the Oct and CRE,B2 oligonucleotides, respectively, shows the specifity of the Oct binding complexes. As shown in Figure 5, CRE-,B2 binding activity was already observed in nuclear extracts from untreated P19 EC cells. Interestingly, treatment with RA resulted in a relative gradual increase in CRE-,B2 binding activity: 2-fold after 2 hrs and up to 4-fold after 24 hrs RA-treatment. Moreover, predominantly Enhancement
Nucleic Acids Research, 1992, Vol. 20, No. 23 6397 24h RA dbcAMP -
-± +
48h ±
+
-
+
+
-
72h ±
-+
+
+
+
+
-
'r
15
I-
[ +
10
RARO
i'
* W.
_
0 0
Sbo
RA
+ RA/Forsk.
2
4-
0-actin
0 W
j j
.~~~~~~~~~~~~~~~~~~~.~~~~~~~~,
-180
ACRE
construct 1
1
4 8
0.6 4 6
1
5 6
Figure 7. cAMP enhances RA-induced RAR,8 expression in human foetal kidney 293 cells. Northern blot analyses on total RNA isolated from 293 cells treated for increasing periods with dibutyryl cAMP (0.5 mM), RA (1 MM) or both. Depicted are the relative levels of RAR,8 expression when corrected for the level of j3-actin expression.
protein -DNA complex is detected in nuclear extracts obtained from untreated P19 EC cells while multiple complexes are formed after RA-treatment (see also Fig. 6) suggesting that RA either modifies pre-existing CRE-,B2 binding protein and/or induces the synthesis of other CRE-32 binding proteins. A TRE-,B2 oligonucleotide probe failed to bind nuclear proteins of either untreated or RA-treated P19 EC cells, again indicating that this putative element is not involved in early RA-dependent RARf.2 promoter activation (not shown). one
CRE-,B2 binds ATF/CREB As mentioned earlier, CREs bind members of the CREB/ATF family of transcription factors, which form homodimers or heterodimers through interactions involving their leucine repeats. (48-50). Therefore, in order to determine whether the CRE(2 binding complex contains CREB/ATF, competition experiments were performed with increasing amounts of CRE,32 or CRE-F containing oligonucleotides in a band shift assays with CRE-,32 as probe and using nuclear extracts derived from P19 EC cells treated for 24 hours with RA. As can be seen in Figure 6, CRE-F was able to compete for binding to CRE-,B2 indicating that CRE-,B2 is able to bind members of the ATF/CREB transcription factor family. However, CRE-,B2 oligonucleotides appear to compete more efficiently for CRE(32 binding activity than CRE-F oligonucleotides, which suggests that among the ATFs present in the nuclear extracts some might have a higher binding affinity for CRE-,B2, while others might bind preferentially to CRE-F. As a control, non-specific competition with a RARE-,B2-containing oligonucleotide did not significantly reduce CRE-(2 binding activity. The same results were obtained using an octamer binding site (data not shown). cAMP enhances RA-dependent RARI activation in 293 cells Members of the ATF/CREB family are known to mediate signal transduction through the adenylate cyclase/cAMP system which involves activation of cAMP-dependent protein kinase A (PKA) (for review see refs 55, 56). The finding that CRE-f32 binds ATF/CREB suggests the possibility that cAMP might be able to modulate RA-dependent RAR,B activation. To address this possibility we investigated the effect of cAMP on RA-dependent RAR,B activation in P19 EC and human foetal kidney 293 cells, since in both cell lines RAR(8 expression can be strongly induced
Figure 8. CRE-132 mediates the cAMP-induced enhancement on RA-dependent RAR,B2 promoter activation in 293 cells. The reporter plasmids - 1801+156 CAT and ACRE CAT were transfected in 293 cells and trans-activation by RA was determined in the absence or presence of forskolin for 24 hrs.
with RA. Therefore these cells were grown in the presence of RA, dibutyryl (db) cAMP or both agents for different periods of time and RAR,B mRNA levels were determined by Northern blot analysis. In 293 cells, which already contain RAR,B transcripts in the absence of RA, a 4-fold increase in the level of RAR,3 transcripts was observed after 24 hrs RA-treatment (Fig. 7). However, dbcAMP was able to enhance this level 2-fold more, while dbcAMP-treatment alone had no effect on RAR,B transcript levels. The enhancement of RA-induced RAR4B expression by dbcAMP was also seen after 48 and 72 hrs treatment; however, the stimulatory effect of dbcAMP on this induction appeared to decrease during time, suggesting that stimulation of the PKA signal transduction pathway has its most profound effect during the early RA-mediated phase. In P19 EC cells no alterations in the level of RARj3 transcripts upon dbcAMP treatment alone or in combination with RA were observed (not shown), which suggests that the enhancing effect of cAMP on RA-dependent RAR,3 induction requires the presence of cell specific proteins, which are absent or inactive in P19 EC cells. CRE-(32 mediates responsiveness to cAMP Finally, we examined whether CRE-32 is also involved in mediating the enhancement on RA-induced RAR43 activation found upon cAMP-treatment in 293 cells. Therefore 293 cells were transfected with the -180/+156 CAT and AC CAT constructs and CAT activity was determined after treatment with RA alone or in combination with forskolin. In the absence of RA or in the presence of forskolin alone, no promoter activity was detected on both constructs (not shown). Since in untreated 293 cells also reporter constructs containing larger RAR,B2 promoter fragments are not active in the absence of RA (unpublished results FK) the RAR46 transcripts detected in untreated 293 cells (Fig. 7) probably reflect the presence of other RAR,8 isoforms. When using the -180/+156 construct, treatment with both RA and forskolin resulted in a 2-fold increase in CAT activity compared to the level found with RA alone, which was not observed on the AC CAT construct (Fig. 8). In addition, mutation of CRE-,B2 resulted in a 2.5-fold lower level of RA-induced CAT activity which is similar to the situation observed in P19 EC cells. In transient transfection assays in P19 EC cells (not shown), forskolin was not able to enhance RA-dependent RARB32
6398 Nucleic Acids Research, 1992, Vol. 20, No. 23 promoter activation indicating that this cAMP-mediated enhancement is probably dependent on the presence of cell type specific proteins able to bind to CRE-,B2.
DISCUSSION Cyclic AMP-response elements have been identified in many viral and cellular genes and have been shown to mediate transcriptional activation by cAMP and a number of other stimuli such as increased intracellular Ca2+-concentrations and adenoviral ElA (48-50, 57, 58). These cis-acting elements are known to bind members of the ATF/CREB transcription factor family which can form homodimers or heterodimers through interactions mediated by their leucine repeats. (48, 49). Distinct ATF/CREB binding activities with specific sequence requirements have been found in F9 EC cells which are regulated during differentiation (59). In addition, it has been demonstrated that different CREBs do not respond equally well to inducers (44, 48, 60). In this study, we identified a CRE-related element in the RAR(32 promoter which contributes to the trans-activation of the promoter by RA, which is known to be mediated by a RAresponse element located in the proximity of the TATA-box (37,38). This CRE-like element, designated CRE-,.2, is located at position -99 to -92 in the human RARi32 promoter and consists of the motif TGATGTCA, which differs in only one base (underlined) from the consensus CRE, TGACGTCA. In transient transfection experiments we demonstrate that forskolin is able to enhance RA-dependent RAR,B2 promoter activation via CRE-,B2 in human foetal kidney 293 cells (Fig. 8), which shows that CRE-(32 can mediate transactivation upon activation of the cAMP signal transduction pathway. Interestingly, recent experiments in our laboratory have shown that in both stably transfected cells and in transient transfection assays adenoviral EIA can function as a co-activator of RAdependent RAR,B2 promoter activation (Kruyt et al., submitted). In addition, we showed that the strong RA-dependent RAR(32 promoter activation in P19 EC cells is likely to be due to the presence of an endogenous ElA-like activity in these cells. Recently, similar findings have been reported by Berkenstam et al. (61). Furthermore we demonstrated in deletion studies that besides the RARE and TATA-box also CRE-j32 is involved in mediating the stimulatory effect of ElA on RA-dependent RARI32 promoter activation, again indicating the functionality of this element. Besides conservation of the CRE-,B2 motif in both the human and mouse RARf32 promoter this element is also conserved in the recently characterized RARa2 promoter (23) (see also Fig. 2). Moreover, the same CRE motif has been identified in a cAMP-responsive region of the P450scc gene (62) and in the promoter of the glycoprotein ca-subunit gene of several species including bovine and rat (63, 64). Binding studies with the asubunit gene variant CRE indicated that this element binds CREBs, but with a lower affmnity than the consensus CRE, and in addition it has been suggested that the variant CRE preferentially binds heterodiners of CREBs associated with other proteins yet to be identified (65). Different results were obtained with respect to the CAMP-mediating properties of the a-subunit gene CRE, which is thought to be due to cell-specific CREBs present and the promoter context used for testing the CREmediated CAMP response (63, 65). Our results also showed that the ability of CRE-,B2 to mediate transcriptional activation induced by CAMP is dependent on the
cell lines used. The enhancement by CAMP on RA-dependent RAR,32 promoter activation was found to be cell-specific since, in contrast to the situation found in 293 cells, it was not observed in the P19 EC cell line (not shown). This suggests that the cellspecific composition of the expressed CREBs determines the response mediated by CRE-(32. CRE-,B2 was also found to be involved in RA-dependent activation of the RAR,B2 promoter activation. We demonstrated in transient transfection experiments in P19 EC and 293 cells that mutation of CRE-,B2 in a reporter construct containing RARi32 promoter sequences from -180 to +156, resulted in a 2.5-fold decrease in RA-dependent activation as compared to the wild-type construct (Fig. 3 and 8). Determination of RAresponsiveness of CRE-,B2 when fused to the heterologous tk promoter of pBL2CAT revealed that CRE-,B2 mediated an approximately 3-fold higher level of basal transcription than the control plasmid pBL2CAT (Fig. 4), suggesting the presence of proteins in P19 EC cells able to transactivate through CRE-,B2. In addition, the finding of a similar stimulation of CRE-,B2 mediated activation upon RA-treatment (approximately 4-fold, see Fig. 4) indicates that the contribution of CRE-(32 in RAR(.2 promoter activation is for the major part independent of RA. We therefore propose that proteins bound to CRE-,B2 in untreated P19 EC cells are able to act in concert with ligand-activated RARs in the transactivation of the RAR432 promoter. However, despite the fact that CRE-(32 mediated transactivation itself is largely independent of RA we observed a 4-fold increase in CRE-(32 binding activity in gel retardation assays with nuclear extracts derived from P19 EC cells treated with RA for 24 hrs (Fig. 5), which indicates that the increase in binding activity does not correspondingly result in stronger CRE-j32-mediated transactivation. Nonetheless, the finding that the expression of proteins present in the CRE-432 binding complex is upregulated during RA-induced differentiation of P19 EC cells suggests that these proteins, probably CREBs, may be involved in modulating the expression of RAR,82 at later stages of RA-induced differentiation. Furthermore, our results show that CRE-,B2 has some distinct properties when compared to the consensus CRE as found in the fibronectin promoter (53). Whereas CRE-f,2-mediated transactivation in P19 EC cells is RA-independent, activation through CRE-F appeared to be dependent on the presence of RA (Fig. 4), which suggests that these elements bind different proteins. This notion is supported by our results obtained in gel retardation assays using nuclear extracts from P19 EC cells, which showed that CRE-F is less efficient in competing for CRE(32 binding activity than CRE-,2 itself (Fig. 6), indicating that these CREs may have different binding affinities for distinct members of the ATF/CREB transcription factor family. This notion was further confirmed by competition experiments with radiolabeled CRE-F showing that in this case CRE-F is a more effective competitor than CRE-,B2 (data not shown). Presently, we are studying in more detail the protein composition of the CRE-(32 binding activity in different cell lines, in relation to CRE/32 mediated effects on RA-dependent RAR,r2 promoter activation involved in cAMP responsiveness.
ACKNOWLEDGEMENTS We thank Siegfried de Laat for critically reading the manuscript and Peter Verrijzer for providing the adenovirus 4 octamer motif containing oligonucleotide. This research was supported by the Center of Developmental Biology, Utrecht, The Netherlands.
Nucleic Acids Research, 1992, Vol. 20, No. 23 6399
REFERENCES 1. Roberts,A.B. and Sporn,M.B. (1984) In Sporn,M.B., Roberts,A.B. and Goodman,D.S. (eds), The Retinoids. Academic Press, New York, Vol. 2, pp. 209-286. 2. Brockes,J.P. (1990) Nature, 345, 766-768. 3. Eichele,G. (1989) Trends in Gen., 5, 246-251. 4. Summerbell,D. and Maden,M. (1990) Trends Neurosci., 13, 142-147. 5. Durston,A.J., Timmermans,J.P.M., Hage,W.J., Hendriks,H.F.J., de Vries,N.J., Heideveld,M. and Nieuwkoop,P.D. (1989) Nature, 340, 140- 144. 6. Tickle,C., Alberts,B., Wolpert,L. and Lee,J. (1982) Nature, 2%, 564-566. 7. Thaller,C. and Eichele,G. (1987) Nature, 327, 625-628. 8. Maden,M. (1982) Nature, 295, 672-675. 9. Ragsdale,C.W., Petkovich,M., Gates,P.B., Chambon,P. and Brockes,J.P. (1989) Nature, 341, 654-657. 10. Jones-Villeneuve,E.M.V., McBurney,M.W., Rogers,K.A. and Kalnins,V.I. (1982) J. Cell Biol., 94, 253-262. 11. Edwards, M.K.S. and McBurney,M.W. (1983) Dev. Biol., 98, 187-191. 12. Evans,R.M. (1988) Science, 240, 889-895. 13. Green,S. and Chambon,P. (1988) Trends in Genet., 4, 309-314. 14. Beato,M. (1989) Cell, 56, 335-344. 15. Petkovich,M., Brand,N.J., Krust,A. and Chambon,P. (1987) Nature, 330, 444-450. 16. Giguere,V., Ong,E.S., Segui,P. and Evans,R.M. (1987) Nature, 330, 624-629. 17. Benbrook,D., Lernhardt,E. and Pfahl,M. (1988) Nature, 333, 669-672. 18. Brand,N., Petkovich,M., Krust,A. Chambon,P., de The,H., Marchio,A., Tiollais,P. and Dejean,A. (1988) Nature, 332, 850-853. 19. Krust,A., Kastner,P., Petkovich,M., Zelent,A. and Chambon,P. (1989) Proc. Natl. Acad. Sci. USA, 86, 5310-5314. 20. Zelent,A., Krust,A., Petkovich,M., Kuster,P. and Chambon,P. (1989) Nature, 339, 714-717. 21. Giguere,V., Shago,M., Zirngibl,R., Tate,R., Rossant,J. and Varmuza,S. (1990) Mol. Cell. Biol., 10, 2335-2340. 22. Kastner,P., Krust,A., Mendelsohn,C., Garnier,J.-M., Zelent,A., Leroy,P., Staub,A. and Chambon,P. (1990) Proc. Natl. Acad. Sci. USA, 87, 2700-2704. 23. Leroy,P., Nakshatri,H. and Chambon,P. (1991) Proc. Natl. Acad. Sci. USA, 88, 10138-10142.. 24. Zelent,A., Mendelsohn,C., Kastner,P., Krust,A., Garnier,J.-M., Ruffenbach, F., Leroy, P. and Chambon, P. (1991) EMBO J., 10, 71-81. 25. Mangelsdorf,D.J., Ong,E.S., Dyck,J.A. and Evans,R.M. (1990) Nature, 345, 224-229. 26. Hamada,K., Gleason,S.L., Levi,B.-Z., Hirschfeld,S., Appela,E. and Ozato,K. (1989) Proc. Natl. Acad. Sci. USA, 86, 8289-8293. 27. Yu,V.C., Delsert,C., Andersen,B., Holloway,J.M., Devary,O.V., Naar,A.M., Kim,S.Y., Boutin,J.-M., Glass,C.K. and Rosenfeld,M.G. (1991) Cell, 67, 1251-1266. 28. Leid,M., Kastner,P., Lyons,R., Nakshatri,H., Saunders,M., Zacharewski,T., Chen,J.-Y., Staub,A., Garnier,J.-M., Mader,S. and Chambon,P. (1992) Cell, 68, 377-395. 29. Levin,A.A., Sturzenbecker,L.J., Kazmer,S., Bosakowski,T., Huselton,C., Allenby,G., Speck,J., Kratzeisen, Cl., Rosenberger,M., Lovey,A. and Grippo,J.F. (1992) Nature, 335, 359-361. 30. Heyman,R.A, Mangelsdorf,D.J., Dyck,J.A., Stein,R.B., Eichele,G., Evans,R.M. and Thaller,C. (1992) Cell, 68, 397-406. 31. Kliewer,S.A., Umesono,K., Mangelsdorf,D.J. and Evans,R.M. (1992) Nature, 355, 446-449. 32. Zhang,X.-K., Hoffmann,B., Tran,P.B-V., Graupner,G. and Pfahl,M. (1992) Nature, 355, 441-446. 33. Dolle,P., Ruberte,E., Kastner,P., Petkovich,M., Stoner,C.M., Gudas,L. and Chambon,P. (1989) Nature, 342, 702-705. 34. Dolle,P., Ruberte,E., Leroy,P., Morris-Kay,G. and Chambon,P. (1990) Development, 110, 1133-1151. 35. Ruberte,E., Dolle,P., Krust,A., Zelent,A., Morriss-Kay,G. and Chambon,P. (1990) Development, 108, 213-222. 36. Ruberte,E., Dolle,P., Chambon,P. and Morris-Kay,G. (1991) Development, 111, 45-60. 37. de The,H., Vivanco-Ruiz,M.D.M., Tiollais,P., Stunnenberg,H. and Dejean,A. (1990) Nature, 343, 177-180. 38. Sucov,H.M., Murakami,K.K. and Evans,R.M. (1990) Proc. Natl. Acad. Sci. USA, 87, 5392-5396. Kruyt,F.A.E., den Hertog,J., (1991) DNA Sequence, 2, 111-119.
39. Shen,S.,
van der Saag,P.T. and Kruijer,W.
40. Kruyt,F.A.E., van den Brink,C.E., Defize,L.H.K., Donath,M.-J., Kastner,P., Kruijer,W., Chambon,P. and van der Saag,P.T. (1991) Mech. of Devel., 33, 71-78. 41. Graham,F.L., Smiley,J., Russell,W.C. and Nairu,R. (1977) J. Gen. Virol., 36, 59-72. 42. Luckow,B. and Schutz,G. (1987) Nucl. Acids Res., 15, 5490. 43. Angel,P., Imagawa,M., Chiu,R., Stein,B., Imbra,R.J., Rahmsdorf,H.J., Jonat,C., Herlich,P. and Karin,M. (1987) Cell, 49, 729-739. 44. Foulkes,N.S., Borrelli,E. and Sassone-Corsi,P. (1991) Cell, 64, 739-749. 45. Chomczynski,P. and Sacchi,N. (1987) Anal. Biochem., 162, 156-159. 46. Lee,K.A.W., Bindereif,A.S. and Green,M.R. (1988) Gen. Anal. Techn., 5, 22-31. 47. Fried,M. and Crothers,D.M. (1981) Nucl. Acids Res., 9, 6505-6525. 48. Habener,J.F. (1990) Mol. Endocrinol., 4, 1087-1094. 49. Ziff,E.B. (1990) Trends Genet., 6, 69-72. 50. Hai,T., Liu,F., Coukos,W.J. and Green,M.R. (1989) Genes Dev., 3, 2083-2090. 51. Tora,L., Gaub,M.-P., Mader,S., Dierich,A., Bellard,M. and Chambon,P. (1988) EMBO J., 7, 3771-3778. 52. Lee,W., Mitchell,P. and Tjian,R. (1987) Cell, 49, 741-752. 53. Dean,D.C., Blakely,M.S., Newby,R.F., Ghazal,P., Hennighausen,L. and Bourgeois,S. (1989) Mol. Cell. Biol., 9, 1498-1506. 54. Meijer,D., Graus,A., Kraay,R., Langeveld,A., Mulder,M.P. and Grosveld,G. (1990) Nucl. Acids Res., 18, 7357-7365. 55. Roesler,W.J., Vanderbark,G.R. and Hanson,R.W. (1988) J. Biol. Chem., 263, 9063-9066. 56. Karin,M. (1989) Trends Genet., 5, 65-67. 57. Sheng,M., Thompson,M.A. and Greenberg,M.E. (1991) Science, 252, 1427-1430. 58. Flint,J. and Schenk,T. (1989) Annu. Rev. Genet., 23, 141-161. 59. Tassios,P.T. and La Thangue,N.B. (1990) New Biol., 2, 1123-1134. 60. Flint,K.J. and Jones,N.C. (1991) Oncogene, 6, 2019-2026. 61. Berkenstam,A., Ruiz,MDV., Barettino,D., Horikoshi,M. and Stunnenberg,H.G. (1992) Cell, 69, 401-412. 62. Moore,C.C.D., Brentano,S.T. and Miller,W.L. (1990) Mol. Cell. Biol., 10, 6013-6023. 63. Bokar,J.A., Keri,R.A., Farmerie,T.A., Fenstermaker,R.A., Andersen,B., Hamernik,D.L., Yun,J., Wagner, T. and Nilson,J.H. (1989) Mo. Cell. Biol., 9, 5113-5122. 64. Fenstermaker,R.A., Farmerie,T.A., Clay,C.M., Hamemik,D.L. and Nilson,J.H. (1990) Mol. Endocrinol., 4, 1480-1487. 65. Drust,D.S., Troccoli,N.M. and Jameson, J.L. (1991) Mol. Endocrinol., 5, 1541- 1551.
