JBC Papers in Press. Published on August 31, 2000 as Manuscript M002149200
The Immunologically Protective P-4 Antigen of Leishmania Amastigotes: A Developmentally Regulated Single-Strand Specific Nuclease Associated with the Endoplasmic Reticulum†
Sujata Kar*, Lynn Soong§*, Maria Colmenares, Karen Goldsmith-Pestana, and Diane McMahon-Pratt‡
Yale University School of Medicine, Department of Epidemiology and Public Health, P.O. Box 208034, 60 College Street, New Haven, CT 06510-8034, USA
§
Current address: The University of Texas Medical Branch, Departments of Microbiology &
Immunology and Pathology, 301 University Boulevard, Galveston, TX 77555-1070, USA
‡
Corresponding author:
Dr. Diane McMahon-Pratt,
Yale University School of Medicine Department of Epidemiology and Public Health, P.O. Box 208034 60 College Street, New Haven, CT 06510-8034 Tel: (203) 785-4481, Fax: (203) 737-2921, e-mail:
[email protected]
Running Title: P-4 Single Strand-Specific Nuclease of Leishmania Amastigote
1
Copyright 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Summary The purified membrane-associated Leishmania pifanoi amastigote protein P-4 has been shown to induce protective immunity against infection and to preferentially elicit a T helper 1like response in peripheral blood mononuclear cells of patients with American cutaneous leishmaniasis. As this molecule is potentially important for future vaccine studies, the L. 1 pifanoi gene encoding the P-4 membrane protein was cloned and sequenced. Southern blot analyses indicate the presence of 6 tandemly arrayed copies of the P-4 gene in L. pifanoi; homologues of the P-4 gene are found in all other species of the genus Leishmania examined. DNA derived protein sequence data indicated an identity to the P1 zinc-dependent nuclease of Penicillium citrinum [20.8%] and the COOH-terminal domain of the 3' nucleotidase of Leishmania donovani [33.7%]. Consistent with these sequence analyses, purified L. pifanoi P-4 protein possesses single-strand nuclease (DNA and RNA) and phosphomonoesterase activity, with a preference for UMP> TMP >AMP >>>CMP. Double-labeling immunofluorescence microscopic analyses employing anti-BiP antibodies revealed that the P-4 protein is localized in 2
the endoplasmic reticulum of the amastigote. Northern blot analyses indicated that the gene is selectively expressed in the intracellular amastigote stage (mammalian host) but not in the promastigote stage (insect) of the parasite. Based upon its subcellular localization and singlestranded specific nuclease activity, possible roles of the P-4 nuclease in the amastigote in RNA stability (gene expression) or DNA repair are discussed.
Introduction Leishmania sp. are dimorphic intracellular parasites that cause a wide spectrum of human diseases, ranging from self-limited cutaneous to the more severe diffuse cutaneous and visceral forms. The parasite exists as a flagellated promastigote within the alimentary tract of its insect vector, the phlebotomine sandfly; within the mammalian host, the parasite transforms into the amastigote stage and resides in the phagolysosomal vacuole of the macrophage. Leishmania pifanoi, a member of the L. mexicana complex, is associated with both simple and diffuse cutaneous leishmaniasis in the New World (1). The latter form of the disease is characterized by large histocytoma-like cutaneous nodules containing heavily parasitized macrophages and by a parasite-specific impairment of the cell-mediated immune response (2); patients with diffuse cutaneous leishmaniasis are generally resistant to current forms of chemotherapy (1). Over the past decade, leishmanial vaccine research has gained significant attention as clinical treatment failure is becoming increasingly common in many areas; further, drugs used for therapy can be associated with significant adverse effects. However, problems exist with standard live vaccines employing virulent organisms (3, 4); consequently, a focus in leishmanial vaccine development is the identification of defined protective immunogens (5-9). Antigens specific for the amastigote (intracellular-mammalian host) stage of the parasite have been of interest in the construction of a leishmanial vaccine, as such developmentally regulated molecules may be biologically important for the intracellular survival of the parasite. Furthermore, the amastigote is the parasite stage responsible for the pathology associated with disease. 3
Relatively little is known about the mechanisms of amastigote adaptation and survival within the degradative milieu of the macrophage phagolysosome (10). Metabolic differences are known to exist between the promastigote and amastigote stages (11-14); in addition, several leishmanial molecules have been demonstrated to be up regulated or specifically associated with the amastigote stage. These include: specific glycosphingolipids, parasite lysosomal enzymes (cysteine proteinase(s); arylsulphatase), the L.donovani A2 gene, superoxide dimutase, and the proteophosphoglycan molecule(s) (15-19). The biological functions of these stage-specific molecules are of interest in terms of their potential role(s) in parasite virulence, pathogenicity and intracellular survival. The leishmanial superoxide dismutase is considered to be involved in the detoxification of host cell radical oxygen intermediates known to be deleterious to the intracellular amastigote. The proteophosphoglycan molecule appears to have a role in parasite vacuole formation within the infected macrophage. Although not essential for survival, experimental studies of Leishmania genetically deficient in either the A2 or cysteine proteinase genes indicate that these molecules are important in parasite virulence. We have previously reported that three purified antigens [P-2, P-4, P-8], up regulated or selectively expressed in the amastigote stage, provide partial to complete protection in BALB/c mice against infection with L. pifanoi and L. amazonensis (20). The enhanced resistance to infection in mice immunized with the P-4 antigen correlates with an increased interferon- [Th1/Tc1] response. More recently, we have found that the P-4 antigen also can elicit a preferential Th1-like response in patients with American cutaneous leishmaniasis (21). For future vaccine studies of leishmaniasis and to better understand the potential biological function of the P-4 amastigote protein, we have cloned and sequenced the gene encoding the P-4 antigen from L. pifanoi. DNA-derived protein sequence data indicate that P-4 is a single strand-specific nuclease. Biochemical analyses have demonstrated that P-4 has both endo- and exo-nuclease activities and cleaves both RNA and single strand DNA substrates. The specific nuclease/ribonuclease activities, as well as developmental regulation of this molecule, suggest a potential role for P-4 in intracellular survival of these protozoan parasites.
4
Experimental Procedures Parasite strains and in vitro cultivation L. pifanoi (MHOM/VE/60/Ltrod) amastigotes were maintained at 31 C in F-29 medium containing 20% heat-inactivated fetal bovine serum (FBS, GIBCO-BRL, Grand Island, NY), as previously reported (22). L. amazonensis (MHOM/BR/77/LTB0016), L. major (MHOM/IS/79/LRCL251) strain WR309, L. braziliensis (MHOM/BR/75/M2903), and L. donovani (MHOM/ET/67/L82) strain LV9 promastigotes were grown at 23 C in Schneider's Drosophila medium supplemented with 20% FBS. Amino acid sequencing The P-4 antigen was purified from detergent solubilized L. pifanoi amastigote membrane preparations by mAb affinity chromatography as previously described (20). Isolated P-4 protein was then concentrated and further separated by SDS-PAGE. After staining of the proteins with Coomassie blue, gel slices containing either the 33- or 35-kDa protein were excised and subjected to in-gel enzymatic digestion with either trypsin or chymotrypsin (Boehringer Mannheim, Indianapolis, IN). Peptides were isolated by HPLC on a Vydac C-18 column and subjected to amino acid sequence analysis at the Yale University School of Medicine Protein and Nucleic Acid Chemistry Facility. For N-terminal sequence analysis of the 33 kDa protein, proteins separated by SDS-PAGE were electrophoretically transferred onto PVDF membranes (Millipore, Bedford, MA), stained with Coomassie blue, and subjected to gas phase sequence analysis. Amplification of cDNA by PCR and genomic library screening L. pifanoi amastigote cDNA was generated from isolated total mRNA and oligo dT primers using a cDNA cycle kit (Invitrogen, San Diego, CA). The cDNA was immediately amplified via PCR using a GeneAmp kit (Perkin Elmer, Foster City, CA) in the presence of pairs of primers specific for P-4, oligo dT, or SL. Based upon the protein/peptide amino acid sequences obtained (Table 1), and the codon usage (G/C bias in the third codon position) reported for other Leishmania genes (22), degenerate sense and anti-sense oligonucleotide primers were synthesized. Mixed nucleotides are indicated in parentheses; inosines (I) were used to minimize degeneracy. The sequences of primers used in RT-PCR to amplify the P-4 cDNA were as following: A1 (sense), 5'-CAGCTIGA(T/C)CTIG A(A/G)AACGA(A/G)GA-3'; A4 5
(antisense), 5'-TAIGT(T/C)TCIACIAGCTT(A/G)TCIGC-3'; A5 (sense), 5'-GA(A/G)AACA AGGA(A/G)GTIAT(T/C/A)CAGAAGATGG-3'. Cycling conditions were 95 C for 3 min, followed by 35 cycles at 95 C for 1 min, 50 C for 1 min, and 72 C for 1 min. Amplification products were examined by electrophoresis in ethidium bromide-agarose gels. Isolated DNAs were ligated into a pCRTM II vector provided in a TA cloning kit (Invitrogen) and then transformed into E. coli. Positive colonies were selected for plasmid isolation, restriction endonuclease analysis, and DNA sequencing. To obtain a complete P-4 gene copy, a genomic library constructed with partially Sau3A digested L. pifanoi genomic DNA ligated into the BamHI site of EMBL3cos was screened 32 employing a P-labeled EcoR I fragment from clone TA6.2. This 540-bp DNA fragment was 32 isolated and random prime labeled with [- P]dCTP in 1% low melt agarose using a random primer DNA labeling system (Life Technologies, Rockville, MD), and used as a probe for colony hybridization, Northern and Southern blots. After 4 rounds of isolation and hybridization, four phage were chosen for further analysis. The DNAs from two of these phage clones, when digested with various restriction endonucleases [Bam HI, Pst I, Eco RV, Sph I, Hind III, Hinc II; alone and in double digest combinations], revealed after Southern blot hybridization a similar fragment pattern to that observed for total genomic L. pifanoi DNA. The resulting 2.4 kbp PstI fragments of each of these phage DNAs were cloned into pUC 19 and further restriction mapped with Eco RV, Hind III and Sph I; the Pst I subclones, based upon restriction mapping, appeared to be similar. DNA sequence analysis Plasmid DNAs derived from genomic clones or cDNA from TA clones were isolated using a Qiagen Qiaquick plasmid miniprep kit (QIAGEN, Chatsworth, CA). Both strands of each 35 DNA clone were sequenced using the dideoxy chain termination method employing [ S]dATP and a Sequenase 2.0 DNA sequencing kit (US Biochemicals, Cleveland, OH) or the Fidelity Sequencing Kit from Oncor [Gaithersberg, MD]; alternately, clones were sequenced using automated sequencing [Keck Sequencing Facility, Yale University] using an Applied Biosystems 377 Gel Sequencers and Capillary ABI 3700 DNA Analyzers. Multiple colonies for each clone were sequenced; each colony was sequenced in both directions at least 3 times. Analyses of the derived nucleotide and amino acid sequences were performed using the Swiss Institute of Bioinformatics ExPASy Proteomics Server. Gel electrophoresis and molecular karyotype analysis
6
Northern blot analysis was performed using total mRNA isolated from cultured parasites using a micro RNA isolation kit (Stratagene). The mRNA was fractionated electrophoretically on 1.2% agarose gels containing 2.2 M formaldehyde (23) and transferred to Nytran filters (Schleicher & Schuell, Keene, NH). Blots were hybridized with the TA6.2 probe at 42 C in 2 x SSC/0.5% SDS/50% formamide and washed at 42 C with 2 x SSC/0.5% SDS. The filters were exposed to Kodak X-Omat AR film at -70 C with a Cronex Lighting Plus intensifier screen. For Southern blot analysis, genomic DNA of L. pifanoi amastigotes was digested with endonuclease as indicated, subjected to electrophoresis in 0.8% agarose gels, and transferred onto Nytran filters. Filters were hybridized with the TA6.2 probe at 65 C in 5 x SSC/0.5% SDS, washed at 65 C, and processed for radioautography. For molecular karyotype analysis, Leishmania chromosomes were prepared in 1% agarose plugs as described (24) and stored at 4 C in lysis buffer (0.5 mM EDTA/1% Sarkosyl/0.25 mg/ml proteinase K, pH 9.5). Pulsed field gel electrophoresis (25) was performed in a Bio-Rad CHEF-DR II apparatus, using 0.5 x TBE buffer (45 mM Tris/45 mM boric acid/1 mM EDTA, pH 8.3) at 175 V employing a 60-150s ramp for 30 h. The gels were transferred onto Nytran, hybridized with the TA6.2 probe at 60 C in 5 x SSC/0.5% SDS, washed at 60 C, and processed for autoradiography. Phosphomonoesterase, nuclease and endonuclease assays The P-4 protein was isolated as indicated above and assessed for purity by SDS-PAGE analysis using Coomassie blue staining as previously described (20). Phosphomonoesterase activity of purified P-4 protein was assayed by measuring the inorganic phosphate liberated following the hydrolysis of the indicated substrates. As previously described (26), the enzymatic activity was assessed using reaction mixtures (0.1 ml) that were composed of 50 mM TrisMaleate, pH 8.5, 100 mM KCl, 1 mM CoCl2, 2.5 mM substrate (e.g., 3'-AMP), and varying amounts of the protein fraction being tested. Nuclease P1 from Pennicillin citrinum (Sigma) was used as a positive control. After incubation at 42 C for 30 min, liberated Pi was measured using a detection buffer containing 0.045% malachite green hydrochloride and 4.2% ammonium molybdate (27), as described by Zlotnick and Gottlieb (28). The reaction was terminated by the addition of 34% sodium citrate; the absorbances at 660 nm were immediately determined spectrophotometrically. Appropriate dilutions of KH2PO4 were used as standards. Results are expressed as M of inorganic phosphate (Pi) released per 30 min. Single-strand nuclease activity of purified P-4 protein was assayed by measuring the release of acid-soluble nucleotides at 260 nm, following the hydrolysis of either heat-denatured DNA or RNA. As previously described (29, 30), the standard reaction consisted of 30 g singlestrand salmon sperm DNA (sonicated and then boiled for 15 min before use; Sigma) or yeast 7
tRNA (GIBCO-BRL) in 0.2 ml of buffer containing 30 mM sodium acetate, pH 5.0, 100 mM NaCl, 2 mM ZnCl2, and varying amounts of the protein fraction being tested. Penicillium citrinum P1 or Mung-bean nuclease (New England Biolabs, Beverly, MA) was used as a positive control. Incubation was carried out at 37 C for 30 min and terminated by chilling and addition of 0.4 ml ice-cold 10% trichloracetic acid. The sample was clarified by centrifugation and the absorbance at 260 nm was determined. Result are expressed as nmol of nucleotide released per 30 min. The endonuclease activity of the P-4 protein was assessed using covalently closed singlestranded M13mp DNA, a ‘bubble’ DNA substrate and single strand oligonucleotides. Briefly, covalently closed single-stranded M13mp DNA (0.5 g) was incubated with different concentrations of P-4 protein at 25 C in 30 l buffer containing 50 mM sodium acetate, 30mM NaCl and 1mM ZnSO4 for 2 hours. The reaction was stopped, followed by electrophoresis in 1% agarose gel; DNA was stained with ethidium bromide and then photographed using Polaroid type 55 film. The P-4 protein was tested for it’s ability to cleave ‘bubble’ structured DNA consisting of a central unpaired region of 29 nucleotide in one strand and 30 nucleotide in the other strand flanked by 30 base pairs in both side. Substrate was formed by annealing one 90mer oligonucleotide and one 89-mer oligonucleotide (as indicated below); one of the strands (89mer or 90-mer) was labelled with [ -32P] ATP at the 5’ end. The bubble substrate was gel purified after annealing the oligonucleotide 5’-CCAGTGATCACATACGCTTTGCTAGGAC ATCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCAGTGCCACGTTGTATGCCCACGTTGA CCG-3’ to the oligonucleotide 5’-CGGTCAACGTGGGCATACAACGTGGCACTGTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTATGTCCTAGCAAAGCGTATGTGATCACTGG-3’(31). The bubble structured DNA [ 2 ng] was incubated with different concentrations of P-4 at 25 C for different time periods. Reactions were stopped by adding equal volume of denaturing solution [95% (v/v) formamide, 10mM EDTA(pH 8.0), 0.1% bromophenol blue and 0.1% xylene cyanol] and samples were heated to 95 C for 3 min. Products were separated on a denaturing 12% polyacrylamide gel and visualized by autoradiography and photographed using a DC 220 ZOOM camera. Size markers were made by labeling of the 10bp DNA Ladder with [ 32
P] ATP. To determine the nucleotide preference of the P-4 nuclease, 5’endlabelled oligonucleotide 5’CGGTCAACGTGGGCATACAACGTGGCACTGTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTATGTCCTAGCAAAGCGTATGTGATCACTGG 3’ or 5’CCAGTGATCACATACGCTTT GCTAGGACATCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCAGTGCCACGTTGTATGC CCACGTTGACCG 3’ was used as substrate. P-4 digestion was conducted as indicated above
8
and the products were visualized by autoradiography after resolution in denaturing 12% polyacrylamide gel. Subcellular localization of the P-4 single strand-specific nuclease All incubations were carried out on ice. After washing 3 times in PBS, L. pifanoi amastigotes were incubated in PBS containing 4% paraformaldehyde for 15 min and then washed once in PBS. Fixed cells were then permeabilized by incubation for 5 min, in PBS containing 0.05% Triton X-100, washed once in PBS and then incubated in PBS containing 5%FBS and 5% normal goat serum. After washing twice with PBS, amastigotes were then either incubated for 45 min with either normal rabbit serum, or anti-P-4 monoclonal antibody and rabbit anti-T. brucei binding protein (BiP; generously provided by Dr. J. Bangs, University of Wisconsin) diluted in PBS-5%FBS. The parasites were then washed 3 times with PBS containing 5% FBS and 0.05% Tween 20. Washed amastigotes were then incubated for 45 min with fluorescein-conjugated goat anti-rabbit IgG (1:100; Molecular Probes), rhodamineconjugated goat anti-mouse IgG (1:100; Jackson Laboratories, Inc.) and DAPI (1:1000; Sigma). Organisms were then washed, air-dried onto poly-L-lysine coated slides and mounted in aqueous mounting medium (Biomeda Corp., Foster City, CA). Fluorescence was visualized using either a Nikon Microphot-FXA microscope; images were digitalized with a film scanner equipped with the microscope. Alternately, the localization of P-4 and/or BiP proteins were examined using confocal microscopy employing a Zeiss axiovert 100 and LSM 510 software.
9
Results Cloning of the P-4 gene We have previously shown that on SDS-PAGE, affinity purified P-4 appears as a doublet of proteins with estimated molecular masses of 33 and 35 kDa (20). Pulse-chase immunoprecipitation studies, examining the in vivo biochemical processing of these proteins 2 indicated that the 35 kDa protein is the precursor of the 33 kDa protein . In agreement with this, the alignment of HPLC elution profiles of trypsin-digested 33- and 35-kDa proteins indicated that these two proteins were closely related, if not identical (data not shown). The amino acid sequences of the N-terminus and 8 internal tryptic and/or chymotryptic peptides (Table 1) from the 33 kDa P-4 protein were obtained (see Experimental Procedures Section). Based on amino acid sequences of peptides II, III, and VII, degenerate oligonucleotides A1, A4, and A5, respectively, were synthesized (see Experimental Procedures Section) using a mixed-primer strategy (32, 33). RT-PCR amplification of L. pifanoi amastigote RNA employing either A1/A4 or A5/A4 primer sets each yielded a single fragment of approximately 540 bp or 520 bp, respectively. These PCR products were cloned into pCRTM II vectors; the DNA sequences obtained encoded a polypeptide that included 5 peptides of trypsin/chymotrypsindigested P-4 (peptides I to IV, VI and VII), clearly indicating that these PCR products represented a segment of a cDNA encoding the P-4 protein. To obtain a complete copy of the P-4 gene, a L. pifanoi EMBL3cos genomic library was screened using a radiolabelled TA6.2 cDNA clone as probe. Two separate phage clones containing genomic P-4 gene copies were isolated; subfragments containing the P-4 genes were subcloned and sequenced from each phage clone. The two cloned copies of the P-4 gene were found to have identical sequences. The sequence of the cDNA clone TA6.2 was contained within the genomic clones; some differences in the derived protein sequence appeared to exist between the TA6.2 cDNA clone and genomic sequences. These difference did not involve residues involved in either Zn-binding sites nor hypothetically involved in the active site of the enzyme. Furthermore, the complete derived P-4 protein sequence included the chymotryptic peptides V, and VIII [Table 1], not found within derived protein sequence of the TA6.2 cDNA clone.
10
The final DNA sequence encoding the P-4 protein is shown in Figure 1A. The gene encoding P-4 is 948 nt in length (Fig. 1A); the open reading frame encodes a polypeptide of 316 amino acids with a predicted MW of 35.1 kDa and predicted pI of 8.9. Based upon the structural features signal peptide, a putative signal peptidase recognition site (34) is predicted between Gly30 (amino acid residue 30), and Trp-31 (Fig. 1A, marked with ). This is consistent with the known N-terminal sequence of the 33-kDa protein (Table 1). The deduced protein sequence contains two putative N-linked glycosylation sites (Asn-Ile-Thr; Asn-Thr-Ser; Fig.1B) at amino acid residues 108-110 and 251-253, as well as potential casein kinase II phosphorylation sites and protein kinase C phosphorylation sites. The existence of such post-translational modifications, however, needs to be confirmed experimentally. The P-4 proteins have been demonstrated to be membrane associated (20). Based on the prediction of Gerber et al. (35), it is not likely that P-4 is a GPI-anchored protein. Sequence analyses, however, predicted three putative transmembrane domains from residues 1-38, 134-151, and 286-299. However, based upon the enzymatic activity (see below) of the protein, which is dependent upon Zn-binding site included in residues 138-151, it is unlikely that these residues represent a membrane spanning region of the protein. To define the biological function of the P-4 protein(s), the nucleotide and amino acid sequences of P-4 were compared with those in the data banks. These analyses indicated similarities in amino acid sequences among the mature P-4 protein (amino acid residues 31-316), and the C-terminal region of L. donovani 3'-nucleotidase/nuclease (3'-NT/Nu; GenBank accession No. L35078, with an ORF of a 477 amino acids), and the zinc-dependent Penicillium citrinum nuclease P1 (GenBank accession No. P24289, with an ORF of a 270 amino acids). Within these regions, P-4 shared a 33.7% identity with 3'-NT/Nu and a 20.8% identity with nuclease P1. Further, it was evident that the residues implicated in zinc binding and/or the enzyme active site (Fig. 1B, marked with *) were conserved among these three proteins (36), suggesting that the levels of identity found were significant. Subsequent biochemical analyses (see below) demonstrated that the P-4 nuclease has phosphomonoesterase and both endo- and exonuclease activities. However, it should be noted that P-4 is biochemically distinct from 3'NT/Nu. The 3'NT/Nu has a predicted 100 amino acid N-terminal domain that is not present in the P-4 nuclease. In addition, there are 4 Cys residues in deduced P-4 amino acid sequence (Fig. 1B). In contrast, no Cys residue is contained within the related domain of L. donovani 3'-NT/Nu (Fig. 1B). Finally, while the 3'-nucleotidase activities of L. donovani can be renatured following SDS-PAGE gel electrophoresis (37), this is not the case for the purified P-4 nuclease (data not shown), suggesting potential differences in stability/secondary structure between the two enzymes. 11
Identification of the P-4 genes in L. pifanoi and other Leishmania species To assess the distribution of the P-4 genes among different species of Leishmania, chromosomes of L. pifanoi axenic amastigotes, as well as promastigotes of L. amazonensis, L. braziliensis, L. major, and L. donovani, were separated by CHEF electrophoresis. Southern blots of chromosomal gels were probed with a labeled TA6.2 probe. The P-4 genes were localized to two chromosomes of approximately 1800 kb and 1400 kb in amastigotes of L. pifanoi (Fig. 2). In L. amazonensis, L. braziliensis, L. major, and L. donovani, the P-4 gene was identified on one chromosome of approximately 1400-1500 kb; the hybridization signals for these species were at least 10-fold weaker than that observed for L. pifanoi. Although it is still unclear whether the weaker hybridization observed for these species is due to a difference in gene copy number and/or the sequence divergence, these results nevertheless indicate that the homologues of the P4 gene are present in all other major species complexes of the genus Leishmania. To understand the general organization of the L. pifanoi P-4 genes, chromosomes were digested with the restriction endonucleases BamH I, EcoR I, and Spe I, prior to CHEF electrophoresis and then hybridized with a labeled TA6.2 probe. These restriction endonucleases yielded single 240 kb fragments (data not shown), suggesting that the P-4 genes are located on two homologous chromosomes in L. pifanoi. The existence of homologous chromosomes differing in size have been previously reported in Leishmania (38,39). To assess the copy number of the P-4 genes in L. pifanoi, genomic DNAs were digested with various restriction endonucleases and probed with the labeled cDNA clone, TA6.2. Using enzymes that cut once (EcoR V, Xho I, Pst I) within the sequence of the probe, a strong hybridizing band of 2.4 kb was observed in each digest plus one or two weakly hybridizing bands (Fig. 3A); whereas, digests with EcoR I (which does not cut the P-4 gene) gave a single large band (>23 kb). These results suggested the possibility of tandemly repeated copies of P-4 gene. To verify this possibility, partial digestions of L. pifanoi DNAs with EcoR V or Pst I were performed. A clear repetition of 5 copies of a band of 2.4 kb is evident after digestion with both enzymes (Fig. 3B). These Southern blot analyses indicate that at least 6 copies of the P-4 gene, arranged as a tandem repeat, are present in the L. pifanoi genome. These results indicate that P-4 is a member of a gene family of proteins; these findings are of importance for further genetic studies examining the function of the P-4 genes. Functional analysis of the P-4 molecule: phosphomonoesterase, exonuclease, and endonuclease activities
12
As sequence data indicated that the P-4 protein was potentially related to single strand specific nucleases, the enzymatic activities of purified P-4 was studied with respect to the specificity of hydrolyzing ribo- and deoxyribonucleotide substrates. It was evident that P-4 protein(s) displayed phosphomonoesterase activities, with the following substrate preference: 3'UMP >3'TMP > 3'-AMP >>> 3'-CMP (Table 2); no activity was detected with 5'-AMP (data not shown). In addition, the P-4 protein contained nuclease activities, with the following substrate preference: ssDNA RNA >> dsDNA. These data clearly indicate that P-4 is preferentially a single strand nuclease, with exonuclease activity. In comparison to Mung Bean nuclease, P-4 has comparable activity towards ssDNA; however, P-4 nuclease appears to be relatively more active towards RNA. The endonuclease activity of the P-4 nuclease was examined using single stranded circular M13 DNA. As seen in Figure 4, when single-stranded circular (SSC) DNA, M13mp was incubated with purified P-4 protein, the DNA was degraded; the level of degradation (partial to complete) correlated with the concentration of the P-4 protein. These results reveal that the P4 protein has an associated endonuclease as well as exonuclease function because it acts on covalently closed SSC DNA. The apparent reaction of the P-4 nuclease with dsDNA and ssDNA was examined further using a bubble DNA substrate (Figures 5 and 6). The bubble DNA substrate was preferentially cleaved within the single stranded areas when incubated with P-4 (Fig. 6A, lane 2); there results further confirm the protein’s endonucleolytic activity and suggest that P-4 is a single-strand specific nuclease. In addition, it was evident that the P-4 nuclease preferentially digested the poly-T (90 nt; Fig. 6A) strand of the bubble substrate and not the poly-C (89 nt) strand (Fig. 6B). These data are consistent with the phosphomonoesterase specificities found for the P-4 nuclease. Further analyses of the digestion (Fig. 6C) of either the monomeric 89-mer or 90-mer oligonucleotides indicated a strong preference of the P-4 nuclease for thymidine. The various fragments generated were consistently found to selectively represent cleavages at thymidine residues. This is of interest and undoubtedly reflects the lower level of P4 employed for these digestion (10 ng). Activity towards the phosphomonoesterase substrates suggested that the specificity for thymidine monophosphate > adenosine monophosphate at low P-4 levels; whereas the P-4 nuclease had relatively comparable activities towards both substrates at higher enzyme concentrations. Developmental expression of the P-4 gene We have previously shown that the P-4 mAb recognizes antigenic components selectively expressed by axenic and macrophage-derived amastigotes of L. pifanoi and L. amazonensis but not by the respective promastigote forms (40, 41). To establish that P-4, in fact, 13
was developmentally regulated, we isolated total RNAs from amastigotes and promastigotes of L. pifanoi and performed Northern blot analyses using labeled TA6.2 as a probe. Results of these analyses indicated that L. pifanoi amastigotes displayed high levels of P-4 RNA and that at least four transcripts, 2.48, 4.96, 7.44, and 9.1 kb, could be identified (Fig. 7A, lane 1). Weaker hybridization signals, only evident upon longer exposure, were detected in L. pifanoi promastigotes (Fig. 7A, lane 2). These results are consistent with Northern blot analysis of L. amazonensis organisms, in which specific P-4 mRNAs of 2.48, 4.96 and 7.4 kb were expressed only in the amastigote, but not in promastigote developmental stage (35; Fig. 7B). Reprobing of the filter with a labeled probe for the Ldp23 gene (23) which is expressed in both the promastigote and amastigote stage of the parasite, indicated that equal amounts of L. amazonensis promastigote and amastigote RNA were present (Fig. 7C). Consequently, P-4 mRNA does not appear to be expressed by the promastigote stage of L. amazonensis. The weak signal in the case of L. pifanoi promastigotes is likely due to low number of axenic amastigotes 2 that are generally present in the promastigote cultures . Together, these studies indicate that the P-4 nuclease is predominately, if not exclusively, expressed by the amastigote stage of the parasite. Indirect immunofluorescent microscopic studies Preliminary immunofluorescence studies suggested that, although occasional nuclear staining was observed, the P-4 nuclease was predominately located internally in the perinuclear area of the Leishmania amastigotes. To determine if the P-4 protein was associated with the endoplasmic reticulum of the parasite, studies examined the co-localization of P-4 with the binding protein (BiP), a major peptide binding chaperone found in the endoplasmic reticulum. Co-localization experiments employing an anti-P-4 monoclonal antibody, a polyclonal antibinding protein (BiP) antibody (against Trypanosoma brucei BiP, provided by Dr. J. Bangs (42)) and DAPI (DNA staining) were performed. As shown in Figure 8, the P-4 molecule is predominately found perinuclearly in the amastigote; the staining pattern for P-4 consistently overlapped with that found for BiP. It was noticable though, that the localization of the BiP protein within the amastigote appeared more diffuse than that observed for P-4; this localization, however, appears to be characteristic of the BiP protein in kinetoplastids (42). Therefore, confocal microscopic analyses were performed to further evaluate the co-localization of BiP and P-4 (Figures 8D and 8E). The graphical representation of the subcellular localization indicates that P-4 (Fig. 8E; red line) was consistently found to co-localize with that of the BiP protein (Fig. 8E; green line). These results suggest that the P-4 single strand-specific nuclease mainly resides and potentially may function within the ER of the Leishmania amastigote stage. 14
Discussion The leishmanial P-4 protein antigen has been demonstrated to be a single strand-specific nuclease associated with the endoplasmic reticulum of the amastigote (mammalian host) stage of the parasite. Although the phosphomonoesterase specificity found for the P-4 nuclease is similar (preferring 3'substrates) to that reported for the L. donovani 3'-NT/Nu (26, 43) and the two proteins share some homology, P-4 is biochemically distinct from 3'-NT/Nu in several aspects. The 3'-NT/Nu is an external surface membrane protein of Leishmania expressed by the promastigote stage and is encoded by a single copy gene. The P-4 nuclease is encoded by gene family with at least 6 copies/haploid genome and appears to be selectively expressed by the amastigote stage. The 3'NT/Nu is thought to be involved in purine salvage; the level of 3'NT/Nu expression is up regulated under conditions of purine-deprivation. These organisms are incapable of de novo purine synthesis; thus, enzymes devoted to the transport and metabolism of purines are critical for intracellular survival of the parasites (44). The difference in subcellular localization of the two enzymes undoubtedly reflects the distinction in the function of these two distantly related molecules/genes. The P-4 single strand-specific nuclease was found to localize perinuclearly and to colocalize with the BiP protein, a chaperone molecule and marker for the endoplasmic reticulum (42). Although P-4 sequence has a signal sequence for import into the endoplasmic reticulum, the protein is lacking a known/obvious ER retention sequence. ER retention sequences appear to be conserved (45, 46), even amongst the kinetoplastid protozoa (42). However, recent evidence suggests that targeting/import/retention in the ER can be complex (47-50) and may not be identical amongst various genera/species (51). Consequently, it will be of interest to determine the signals/areas of protein sequence involved ER targeting and/or retention of the P-4 nuclease. Nuclease activity has been reported in several systems to be associated with the endoplasmic reticulum; such enzymes appear to be important in RNA stability/expression during 15
development or stress. The mRNA stability/half-life within a cell can change dramatically in response to environment - e.g., cytokines, starvation, hormonal stimulation (52, 53). An estrogen-regulated Xenopus liver polysome nuclease has been shown to be involved in the selective destabilization of albumin mRNA (54); the enzyme has been demonstrated to selectively recognize 2 sites approximately 311nt from the 5' end of the albumin coding area. An endoribonuclease that degrades polysome associated MYC mRNA is tightly bound to polysomes; the mRNA is first deadenylated and then degraded 3' to 5' (55). Further, in the unfolded protein response, the Saccharomyces cerevisiae endoplasmic reticulum associated Ire1p endoribonuclease has been shown to be involved in the excision of the HAC1 mRNA intron (56, 57); this specialized RNA splicing allows the translation of the Hac1p transcription factor responsible for the increased expression of ER resident proteins, the chaperon BiP and protein disulfide isomerase. In the case of Leishmania, studies indicate that RNA stability contributes to gene regulation of both the promastigote and amastigote stages. Studies of the gp63 and GP46 gene families, as well as the amastigote specifically expressed A2 gene, indicate that RNA stability contributes to the preferential gene expression (58-61). In the case of the gp63/GP46 gene families, this is observed as the specific expression of various gene family members during log and stationary growth phases (58-60); these studies clearly indicate the existence of RNase activity in gene regulation in the promastigote stage of the parasite. Studies of mRNA regulation/stability indicate the importance of 3' area of non-coding sequence in conferring RNA stability (58, 61). It is possible that the ER-associated nuclease P-4 may play a role in gene regulation/expression in the amastigote stage. Alternately, it is possible that the P-4 nuclease is involved in nucleotide excision and repair (62, 63) in the amastigote. The specificity of the P-4 enzyme is not restricted to RNA; single strand DNA substrates are readily digested. The endonuclease activity of the P-4 nuclease might allow it to participate in the excision process preceding repair (63). The amastigote resides within the phagolysosome of the macrophage; within this milieu, the parasite is subjected to the oxidative (superoxide anion, H2O2, NO) onslaught of the cell. Consequently, DNA damage and repair are essential to the continued survival of the organism. The association of the ER with the nucleus could potentially allow for the transport of the nuclease as required. It may be that P-4 nuclease activity is only required in cases of parasite stress and DNA damage (e.g. oxidative metabolites of the macrophage); however, the enzyme resides proximal to the required site of action, hypothetically ready to be mobilized as required. At present the precise physiological role of the P-4 gene product in parasite differentiation and in the host-parasite interaction is unknown, but potentially may be involved in RNA stability and/or DNA excision/repair. Further 16
investigation, involving genetic (64) and/or biochemical approaches should prove useful to distinquish amongst these possibilities.
Acknowledgments We thank Drs. Christian Tschudi and Elisabetta Ullu for helpful discussions and critical reading of this manuscript; we thank Dr. Yara M. Traub-Cseko for helpful suggestions and Philippe M. Male (Yale Cell Imaging Facility) for help with confocal microscopic analyses. This work was supported by a grant from the National Institutes of Health to D. M.-P. (AI27811).
Footnotes: 17
* Contributed equally to this work. This work was supported in part by National Institutes of Health Grant, AI 27811(DMcP).
†
The nucleotide sequence data reported in this paper is available in the GenBankTM/EMBL database under accession number AF057351. 1
Abbreviations: L., Leishmania; bp, base pair; CHEF, contour-clamped homogeneous electric
field; kb, kilobase; kDa, kilodalton; MW, molecular weight; mAb, monoclonal antibody; 3'NT/Nu, 3'-nucleotidase/nuclease; RT-PCR, reverse transcriptase-polymerase chain reaction; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis. 2
S. M. Duboise. 1994. Developmentally regulated antigens of Leishmania pifanoi amastigotes:
Characterization, patterns of expression and immunoprophylatic potential. Thesis. Yale University.
References 1. Grimaldi, G. and Tesh, R.B. (1993) Clin. Microbiol. Rev. 6: 230-250. 2. Peterson, E., Neva, A.F., Barral, A., Correa-Coronas, R., Bogaertz-Diaz, H., Martinez, D., and Ward, F.E. (1984) J. Immunol. 132:2603-2606. 3. Modabber, F. (1990) Scand. J. Infect. Dis. Suppl. 76:72-78. 4. Handman, E. (1997) Parasitol. Today 13:236-238. 5. Russell, D.G., and Alexander, J. (1988) J. Immunol. 140:1273-1279. 6. Yang, D.M., N. Fairweather,N., Button, L.L., McMaster, W.R., Kahl, L.P. and Liew, F.Y. (1990) J. Immunol. 145:2281-2285. 7. McMahon-Pratt, D., Rodriguez, D., Rodriguez, J-R., Zhang, Y., Manson, K., Bergman, C., Rivas, L., Rodriguez, J.F., Lohman, K.L., Ruddle, N.H. and Esteban, M. (1993) Infect. Immun. 61:3351-3359. 8. Mougneau, E., Altare, F., Wakil, A.E., Zheng, S., Coppola, T., Wang, S.-Z., Waldmann, R., Locksley, R.M. and Glaichenhaus, N. (1995). Science (Wash. DC) 268:563-566. 9. Russell, D.G., and Talamas-Rohana, P. (1989 Immunol. Today 10:328-333. 18
10. Mosser, D.M., and Rosenthal, L.A. (1993) Sem. Cell Biol. 4:315-322. 11. Zilberstein, D. and Gepstein, A. (1993) Mol. Biochem. Parasitol. 61: 197-205. 12. Glaser, T.A., Baatz, J.E., Kreishman, G.P., and Mukkada, A.J. (1988)Proc. Natl. Acad. Sci USA 85: 7602-7606. 13 . Hart, D.T., and Coombs, G.H. (1982) Exp. Parasitol. 54: 397-409. 14 . Rainey, P.M., and MacKenzenie, N.E. (1991) Mol. Biochem. Parasitol. 45: 307-316. 15. Peters, C., Sierhof Y.D. and Ilg, T.(1997) Infect. Immun. 65: 783-786. 16. Zhang, W.W. and Matlashewski, G. (1997) Proc. Natl. Acad. Sci. (USA) 94: 8807-8811. 17. Paramchuk, W.J., Ismail, S.O., Bhatia, A., and Gedamu, L. (1997) Mol. Biochem. Parasitol. 90: 203-221. 18. Straus, A.H., Valero, V.B., Takizawa, C.M., Levery, S.B., Toledo, M.S., Suzuki, E., Salyan, M.E., Hakomori, S., Barnieri, C.L. and Takahashi, H.K. (1997) Braz. J. Med. Biol. Res. 30: 395-399. 19. Straus, A.H., Levery, S.B., Jasiulionis, M.G., Salyan, M.E., Steele, S.J., Travassos, L.R., Hakomori, S. And Takahashi, H.K. (1993) J. Biol. Chem. 268: 13723-13730. 20. Soong, L., Duboise, S.M., Kima, P., and McMahon-Pratt, D. (1995)Infect. Immun. 63:3559-3566. 21. Coutinho, S.G., Oliveira,M.P., DaCruz, A.M., De Luca, P.M., Mendonca, S.C.F., Bertho, A.L., Soong, L., and McMahon-Pratt, D. (1996) Exp. Parasitol. 84:144-155. 22. Landford, C.K., B. Ullman, B., and Landfear, S.M. (1992) Exp. Parasitol. 74: 360-361. 23. Campos-Neto, A., Soong, L., Cordova, J.L., Sant'Angelo, D., Skeiky, Y.A.W., Ruddle, N.H., Reed, S.G., Janeway, C., and McMahon-Pratt, D. (1995) J. Exp. Med. 182: 1423-1433. 24. Beverley, S.M. (1988) Nucleic Acids Res. 16: 925-938. 25. Chu, G., D. Vollrath, D., and Davis, R.W. (1986) Science 234:1582-1585. 26. Gottlieb, M., and Dwyer, D.M. (1983) Mol. Biochem. Parasitol. 7: 303-317. 27. Lanzetta, P.A., Alvarez, L.J., Reinach, P.S., and Candia, O.A. (1979) Anal. Biochem. 100: 95-97. 28. Zlotnick, G.W., and Gottlieb, M. (1986) Anal. Biochem. 153: 121-125. 29. Vogt, V.M. (1973) Eur. J. Biochem. 33:192-200. 30. Shishido, K., and Habuka, N. (1986) Biochem. Biophy. Acta 884:215-218. 31. O’Donovan,A., Davis,A.A., Moggs, J.G., West, S.C., and Wood, R.D. (1994) Nature 371: 432-435. 32. Sirakova, T.D., Markaryan, A., and Kolattukudy, P.E. (1994) Infect. Immun. 62:4208-4218. 33. Frohman, M.A. (1990) Amplifications 5:11-15. 19
34. 35. 36. 37.
Perlman, D., and Halvorson, H.O. (1983) J. Mol. Biol. 167:391-409. Gerber, L.D., Kodukula, K., and Udenfriend, S. (1992 J. Biol. Chem. 267:12168-12173. Volbeda, A., Lahm, A., Sakiyama, F., and Suck, D. (1991) EMBO J. 10: 1607-1618. Zlotnick, G.W., Mackow, M.C., and Gottlieb, M. (1987)Comp. Biochem. Physiol. 87
B:629-635. 38. Bishop, R.P. (1990) Mol. Biochem. Parasitol. 18: 127-140. 39. Blaineau, C., Bastien, P., Rioux, J.-A., Roizès, G., and Pagès, M. (1991) Mol. Biochem. Parasitol. 46: 293-302. 40. Pan, A.A., and McMahon-Pratt, D. (1988) J. Immunol. 140:2406-2414. 41. Hodgkinson, V.H., Soong, L., Duboise, S.M. and McManhon-Pratt, D. (1996) Exp. Parasitol. 83:94-105. 42. Bangs, J.D., Brouch, E.M., Ransom, D.M. and Roggy, J.L. (1996) J. Biol. Chem. 271: 18387-18393. 43. Debrabant, A., Gottlieb, M., and Dwyer, D.M. (1995) Mol. Biochem. Parasitol. 71:51-63. 44. Hammond, D.J. and Gutteridge, W.E. (1984) Mol. Biochem. Parasitol. 13: 2443-261. 45. Gomord V., Wee, E., and Faye, L. (1999) Biochimie 81: 607-618. 46. Teasdale, R.D. and Jackson, M.R. (1996) Ann. Rev. Cell Dev. Biol. 12: 27-54. 47. Mziautt H., Korza G., Hand A.R., Gerard, C., and Ozols, J. (1999) J.Biol. Chem. 274: 14122-14129. 48. Odermatt A., Arnold, P., Stauffer, A., Fry B.M., and Frey, F.J. (1999) J. Biol. Chem. 274: 28762-28770. 49. Kim, P.K., Hollerbach, C., Trimble, W.S., Leber, B., and Andrews D.W. (1999) J. Biol. Chem. 274: 36876-36882. 50. Ouzzine, M., Magdalou, J., Burchell, B., and Fournel-Gigleux, S. (1999) J. Biol. Chem. 274: 31401-31409. 51. Al-Qahtani, A., Teilhet, M., and Mensa-Wilmot, K. (1998) Biochem. J. 331: 521-529. 52. Ross, J. (1996) Trends in Genetics 12: 171-174. 53. Banyopadhyay, R., Coutts, M., Krowczynska, A., and Brawerman, G. (1990) Mol. Cell. Biol. 10: 2060-2069. 54. Dompenciel, R.E., Garnepudi, V.R., and Schoenberg, D.R. (1995) J. Biol. Chem. 270: 6108-6118. 55. Brewer, G. and Ross, J. (1988) Mol. Cell. Biol. 8: 1697-1708. 56. Kawahara, T., Yanagi, H., Yura, T., and Mori, K. (1997) Mol. Cell Biol. 8: 1845-1862. 57. Shamu, C.E. (1998) Current Biol. 8: R121-R123.
20
58. McCoy, J.J., Beetham, J.K., Ochs, D.E., Donelson, J.E., and Wilson, M.E. (1998) Mol. Biochem. Parasitol. 95: 251-265. 59. Ramamoorthy, R., Swihart, K.G., McCoy, J.J., Wilson, M.E., and Donelson, J.E. (1995) J. Biol. Chem. 270: 12133-12139. 60. Beetham, J.K., Myung, K.S., McCoy, J.J., Wilson, M.E., Donelson, J.E. (1997) J. Biol. Chem. 272: 17360-17366. 61. Charest, H., Zhang, W.W., and Matlashewski, G. (1996) J. Biol. Chem. 271: 17081-17090. 62. Parikh, S.S., Mol C.D., and Tainer, J.A. (1997) Structure 5: 1543-1550. 63. Sancar, A. (1996) Ann. Rev. Biochem. 65: 43-81. 64. Cruz, A.K., C.M. Coburn, C.M., and Beverley, S.M. (1991) Proc. Natl. Acad. Sci. USA 88:7170-7174.
21
Figure Legends Figure 1.. (A) The complete genomic DNA sequence and derived protein sequence for the P-4 protein are shown. Nucleotides are numbered on the left. The deduced amino acid sequence is displayed above the DNA sequence. The putative cleavage site for the signal peptide is indicated (); the termination codon is indicated by a †. The sequence data are available from GenBank under the accession number (AF057351). (B) Comparative analysis of the sequences of the P-4 single strand-specific nuclease and the Penicillium citrinum P1 nuclease and the 3'nucleotidase of Leishmania donovani. The potential glycosylation sites of the P-4 nuclease are double underlined. Conserved areas of sequence between the 3 proteins are indicated with a using boldfaced type; residues implicated from crystallographic analyses (36) in either the Zn-binding sites and/or the active site of the Penicillium citrinum P1 nuclease are indicated with a *. The amino acid residues that match with the N-terminal and chymotryptic/tryptic peptides of the purified 33-kDa protein are underlined. Figure 2. Molecular karyotype analysis of the P-4 genes amongst the Leishmania. The experimental conditions are as indicated in Materials and Methods. Left Panel: The radioautographic results from Southern blot analyses following CHEF electrophoresis indicating the chromosome location for the P-4 genes in L. pifanoi (6 h exposure) and other species of Leishmania (120 h exposure). Right Panel: The ethidium bromide stained agarose gel. The yeast chromosome MW markers (Pharmacia BioTech) are as indicated (kb). Figure 3. Autoradiographic results from Southern blot analyses of restriction endonuclease digestion of L. pifanoi genomic DNA hybridized with a labeled TA6.2 probe. (A) Genomic DNA was digested with various restriction endonucleases for 60 min. (B) Genomic DNA was partially digested with EcoR V or Pst I at indicated time periods. After the 30 min point, an excess of enzymes were added to assure total digestion by 60 min. DNA digested with HindIII (Gibco RBL) were used as MW markers (kb).
Figure 4. Degradation of circular single stranded DNA by purified P-4 protein. Lane 1,M13mp SSC DNA incubated with 1X buffer only; lanes 2-5, SSC M13mp DNA incubated with 50, 250, 500 and 1000 ng of P-4, respectively.
22
Figure 5. Bubble Structured Substrate. Shown is the structure of the paired oligonucleotides (89mer and 90-mer) used to analyze the specificities of the P-4 nuclease. The conditions for annealing and isolation of the bubble structured substrate are given in the Experimental Procedures Section. Figure 6. Cleavage of bubble structured DNA by P-4. (A) lane 1, 0.2 ng bubble DNA only in which the 30 ‘T’s containing oligo is labeled with 32P at the 5’ end; lane 2,the same amount of bubble DNA as in lane 1 was incubated with 25 ng of purified P-4 for 2 hours; (B) lane 1, 0.2 ng of bubble DNA in which only the 30 ‘C’s containing oligo is labeled at the 5’end; lane 2, the same amount of bubble DNA as in lane 1 was incubated with 25 ng of purified P-4 for 2 hours. (C) Cleavage of synthetic single-stranded linear DNA by P-4. Lane 1, 0.2 ng oligonucleotide (90 mer) having a central region of 30 ‘T’s ; lanes 2-5, the same amount of oligo as in lane 1was incubated with 25 ng of purified P-4 for 2 hours,30 min, 15 min and 5 min respectively; lane 6, 0.2 ng oligonucleotide (89 mer) having a central region of 30 ‘C’s; lanes 7-10, the same amount of oligo as in lane 6 was incubated with 25 ng of purified P-4 for 2 hours, 30 min, 15 min and 5 min. Figure 7. Autoradiographic results from Northern blot experiments employing 10 g of isolated total RNA from either Leishmania pifanoi or L. amazonensis organisms. Radiolabeled TA6.2 (540 bp) was used as a probe. (A) L. pifanoi. Lane 1 shows axenically cultured amastigotes (31 C). Lane 2 indicates late-log promastigotes derived from amastigotes after transformation at 22 C . (B) L. amazonensis. Lane 1 shows tissue-derived amastigotes; Lane 2, cultured late-log phase promastigotes. (C) L. amazonensis. The same samples as in (B), but hybridized with a probe for Ldp23 (22). MW markers (RNA ladder, Gibco BRL) are as indicated (kb).
Figure 8. Evidence for the colocalization of BiP and P-4 protein. (A) L.pifanoi amastigotes stained with DAPI which stains the nuclei only; (B) localization of P-4 protein in the same cells as in (A); and (C) localization of BiP in the same cells as in A. (D) Confocal microscopic analyses of the localization of BiP protein and the P-4 nuclease. (E) A graphical representation of the level of BiP and P-4 proteins across an arbitrary linear area (in D - red arrowhead); the intensities of the BiP and P-4 proteins are indicated by the green and red lines, respectively.
23
Table 1. Amino Acid Sequences of the N-Terminal and Internal Peptides of the P4-33 kD Protein ________________________________________________________________ Peptides Sequence Designed Primers** ________________________________________________________________ N-terminal X* G X V G H M L L A E I A I
AQLDLENEEKIQK
II
XXRRQLDLENEEKIQK
A1
III
MLENKEVIQKMAAVW
A5
IV
HTISRY
V
XVXTSYPGVTPGGTL
VI
YTDLF
VII
XLSATADKLVETY
A4
VIII F S E E L E T L V D V M A I H E E (S) _________________________________________________________________ * X designates an undetermined residue. ** Degenerate oligonucleotide primers were synthesized based on underlined amino acids.
Table 2.
Nuclease/Ribonuclease and Phosphomonoesterase Activities of Affinity-Purified L. pifanoi P-4 ________________________________________________________________________ Enzyme
Substrate (nmol nucleotides released/30 min) Units/ng ssDNA yeast tRNA dsDNA _______________________________________________________________________ Purified P4 (ng) 10 4.38 0 0 50 29.75 19.17 1.64 100 38.93 25.60 3.45 200 46.12 28.00 6.08 400 46.88 28.41 8.65 Mung-bean nuclease I (Units)
1 4.97 0 0 5 28.52 0 0 10 37.70 0 0 20 46.76 5.55 0 40 50.09 11.69 4.09 80 57.52 20.17 4.79 ___________________________________________________________________________ Substrate (:M Pi released/30 min) 3'-AMP 3'-CMP 3'-UMP 3'-TMP ____________________________________________________________________________ Purified P-4 (ng) 50
