A eukaryotic nicotinate-inducible gene cluster ...

Downloaded from http://rsob.royalsocietypublishing.org/ on December 10, 2017

rsob.royalsocietypublishing.org

Research

A eukaryotic nicotinate-inducible gene cluster: convergent evolution in fungi and bacteria Judit A´mon1,†, Rafael Fernańdez-Martıń2,‡,†, Eszter Bokor1, Antonietta Cultrone2,§, Joan M. Kelly3,}, Michel Flipphi2,k, Claudio Scazzocchio2,3,4,5 and Zsuzsanna Hamari1,2 1

Cite this article: A´mon J, Fernańdez-Martıń R, Bokor E, Cultrone A, Kelly JM, Flipphi M, Scazzocchio C, Hamari Z. 2017 A eukaryotic nicotinate-inducible gene cluster: convergent evolution in fungi and bacteria. Open Biol. 7: 170199. http://dx.doi.org/10.1098/rsob.170199 Received: 23 August 2017 Accepted: 9 November 2017

Subject Area: microbiology Keywords: nicotinate catabolic gene cluster, convergent evolution, nicotinate hydroxylase, xanthine dehydrogenase, Cys2His2 transcription factor

Authors for correspondence: Claudio Scazzocchio e-mail: [email protected] Zsuzsanna Hamari e-mail: [email protected]

Department of Microbiology, University of Szeged Faculty of Science and Informatics, Szeged, Hungary (present address of ZH) 2 Institute de Geńe´tique et Microbiologie, Universite´ Paris-Sud, Orsay, France 3 Department of Biology, University of Essex, Colchester, UK 4 Department of Microbiology, Imperial College, London, UK (present address of CS) 5 Institute for Integrative Biology of the Cell (I2BC), Gif-sur-Yvette, France (present address of CS) ZH, 0000-0001-6374-5083 Nicotinate degradation has hitherto been elucidated only in bacteria. In the ascomycete Aspergillus nidulans, six loci, hxnS/AN9178 encoding the molybdenum cofactor-containing nicotinate hydroxylase, AN11197 encoding a Cys2/His2 zinc finger regulator HxnR, together with AN11196/hxnZ, AN11188/hxnY, AN11189/hxnP and AN9177/hxnT, are clustered and stringently co-induced by a nicotinate derivative and subject to nitrogen metabolite repression mediated by the GATA factor AreA. These genes are strictly co-regulated by HxnR. Within the hxnR gene, constitutive mutations map in two discrete regions. Aspergillus nidulans is capable of using nicotinate and its oxidation products 6-hydroxynicotinic acid and 2,5-dihydroxypyridine as sole nitrogen sources in an HxnR-dependent way. HxnS is highly similar to HxA, the canonical xanthine dehydrogenase (XDH), and has originated by gene duplication, preceding the origin of the Pezizomycotina. This cluster is conserved with some variations throughout the Aspergillaceae. Our results imply that a fungal pathway has arisen independently from bacterial ones. Significantly, the neo-functionalization of XDH into nicotinate hydroxylase has occurred independently from analogous events in bacteria. This work describes for the first time a gene cluster involved in nicotinate catabolism in a eukaryote and has relevance for the formation and evolution of co-regulated primary metabolic gene clusters and the microbial degradation of N-heterocyclic compounds.

†

These authors contributed equally to this work. Present address: Instituto de Investigaciones en Produccioń Animal, CONICET, Universidad de Buenos Aires, Argentina. § Present address: Enterome, Paris, France. } Present address: Department of Genetics and Evolution, University of Adelaide, Adelaide, Australia. k Present address: Department of Biochemical Engineering, University of Debrecen, Debrecen, Hungary. ‡

Electronic supplementary material is available online at https://dx.doi.org/10.6084/m9. figshare.c.3936937.

1. Introduction Filamentous ascomycetes comprise metabolically versatile saprophytes that can use a large variety of metabolites as nitrogen and/or carbon sources. The utilization of nicotinic acid has been studied in bacteria, but it has only been addressed in a eukaryotic microorganism by our early work in Aspergillus nidulans. An enzyme of the xanthine dehydrogenase (XDH) group [1 –3] is necessary for this process. Strains mutant in the cnx (cnxABC, cnxE, cnxF, cnxG and cnxH) or hxB genes cannot use nicotinate. The cnx genes are required for the synthesis of the molybdenum cofactor (MOCO) common to XDH and nitrate reductase [4,5]. The HxB protein catalyses the sulfuration of the Mo(VI), essential for the activity of the enzymes of the XDH group [5,6]. Two enzymes of the XDH family have been described in A. nidulans. Purine hydroxylase I (PHI, HxA encoded by the hxA gene) is a typical XDH [7– 9]. Purine hydroxylase II (PHII, HxnS; see below) has unprecedented substrate

& 2017 The Authors. Published by the Royal Society under the terms of the Creative Commons Attribution License http://creativecommons.org/licenses/by/4.0/, which permits unrestricted use, provided the original author and source are credited.


nicotinic acid

hypoxanthine

2

6-OH nicotinic acid


hxA PHI

hxnS PHII

xanthine hxA PHI

xanA

uric acid

Figure 1. Metabolic cross-talk between the purine and nicotinate utilization pathways. PHI is a conventional XDH able to catalyse the conversion of hypoxanthine to xanthine and xanthine to uric acid. XanA is an a-ketoglutarate-dependent xanthine dioxygenase, accepting xanthine but not hypoxanthine as a substrate. From there uric acid is converted into ammonium (NHþ 4 ) by the well-established purine utilization pathway ([21] for review). PHII is an unconventional MOCO carrying enzyme hydroxylating hypoxanthine to xanthine and nicotinic acid to presumably 6-OH nicotinic acid. As this latter compound is a nitrogen source, it is presumably converted into ammonium, which is indicated by a dashed blue connector. Note that unlike PHI, PHII cannot use xanthine as a substrate. In black: steps induced by uric acid, under the control of the UaY transcription factor. In blue: steps actually (hxnS, PHII) or presumably induced by nicotinic acid, 6-OH nicotinic acid or a further metabolite in the nicotinate utilization pathway and under the control of the HxnR/AplA transcription factor(s). Full references are given in the text. Table 1. A summary of the properties of PHI and PHII compiled from the literature. Data from Lewis et al. [7] for the properties of the enzymes in crude extracts and from Mehra and Coughland [8] (PHI) and [11] (PHII) for the purified enzymes. The reader is referred to the original articles for further details. R. rate, relative rate to hypoxanthine, given an arbitrary value of 1. The concentration of each substrate was 2.5 times its Km. PHI (HxA)

PHII (HxnS)

crude extract

substrate hypoxanthine (6-hydroxypurine)

a

pur. enzyme

crude extract

pur. enzyme

R. rate

R. rate

Km (mM)

R. rate

Km (mM)

R. rate

Km (mM)

Km (mM)

1.00

51.2

1.00

16.4

1.00

90.4

1.00

116

a

,0.02 0.42

— 37

xanthine (2,6-dihydroxypurine) 2-hydroxypurine

0.63 0.59

161.9 28.3

0.61 0.49

34.2 16.8

— 0.38

350 36.2

allopurinol (4-hydroxypyrazolo-

,0.005

—

0.007

—

0.006

0.5

0.007

1a

[3,4-d]pyrimidine) nicotinate

—

—

—

—

0.16

189

0.22

64

Kis of competitive inhibitors with hypoxanthine as a substrate.

specificity. Hypoxanthine, but not xanthine, serves as a substrate of PHII. It accepts nicotinate as a substrate and catalyses the first step of nicotinate catabolism [1,7,10]. Table 1 presents some kinetic parameters for PHI (HxA) and PHII (HxnS) summarized from the relevant literature. PHII is absent in mycelia grown on nitrogen sources generally considered non-repressive. It is apparently induced by nicotinate but it is also present in nitrogen-starved mycelia [1]. The physiological inducer is either 6-OH nicotinate and/ or a metabolite further along the nicotinate utilization pathway [12]. The expression of PHII is not under the control of UaY, the transcription factor specific for the expression of the genes in the purine utilization pathway including hxA [13–15]. Concentrations of nicotinate below those that can serve as sole nitrogen sources allow hypoxanthine utilization by hxA 2 strains [16,17]. Nicotinate induces PHII, which catalyses the hydroxylation of hypoxanthine to xanthine. Xanthine is further hydroxylated to uric acid by a xanthine dioxygenase encoded by the xanA gene [18–20]. This is schematized in

figure 1. The induction pattern implies that PHII belongs physiologically to the nicotinate utilization pathway and not to the purine utilization pathway. In the 1970s and 1980s, we attempted to characterize genetically the nicotinate utilization pathway in A. nidulans. The results have only been published schematically [1–3,22] and thus will be summarized below. We isolated mutants able to grow on hypoxanthine as a nitrogen source, but not on a medium that contains hypoxanthine, allopurinol and nicotinate (1 mM), which, at this concentration, does not serve as a nitrogen source but fully induces PHII [1]. The wild-type grows on this medium, as PHII (resistant to allopurinol inhibition [1,7]) hydroxylates hypoxanthine to xanthine, which is further hydroxylated to uric acid by the XanA protein (figure 1). Three groups of mutations, mapping in three different genes, were obtained. One group, hxnS, results in the inability to grow on the isolation medium and on nicotinic acid as the sole nitrogen source (10 mM) but maintains its ability to grow on 6-OH nicotinate. These

Open Biol. 7: 170199

NH4+


2.1. Identification and characterization of the hxnS gene We expected the hxnS gene to be a paralogue of hxA [7,16]. In the A. nidulans genomic sequences of the Cereon Aspergillus Sequencing Project (later incorporated into the Aspergillus Genome Database, AspGD [23]), we found an incomplete homologue of hxA [9]. We localized the sequence encoding this XDH paralogue to chromosome VI cosmid W31:H08 (see ‘Material and methods’ section), in line with the mapping of hxnS. This cosmid complements both the hxnS41 and the hxnR2 loss-of-function mutations. We sequenced the region comprising the putative hxnS gene to reveal a protein with very high (51%) identity to PHI encoded by the hxA gene and identical with the protein specified by the AN9178 locus in the AspGD genome database (GenBank accession number KY962010). The cognate full-length cDNA sequence was also obtained (GenBank accession number KX585438). The hxnS open reading frame is interrupted by three introns in different positions to those extant in hxA (figure 2). The hxnS gene encodes a protein of 1396 residues (HxA, 1363 residues). The molecular masses are compatible with those experimentally determined for PHI and PHII native dimers [7] and with the slower migration of HxnS seen in the electronic supplementary material, figure S1, in native polyacrylamide gels. We deleted the putative hxnS gene (see ‘Material and methods’ section). The deletion strain is able to grow on hypoxanthine, unable to use nicotinate as a nitrogen source and unable to grow on media containing hypoxanthine (N-source), allopurinol (inhibitor of PHI) and 100 mM nicotinate or 6-OH nicotinate (as inducer), which requires HxnS activity (figure 3;

2.2. A comparison of HxnS (PHII) with HxA (PHI) Figure 2 compares PHI (HxA) and PHII (HxnS) to the thoroughly chemically and structurally characterized Bos taurus XDH enzyme [24,27]. HxnS and HxA and their fungal orthologues (see below) differ less from each other than other eukaryotic XDH paralogues, such as so-called ‘aldehyde oxidases’ from genuine XDHs. Eukaryotic ‘aldehyde oxidases’, so denominated for historical reasons, are enzymes very similar to XDH, but with different substrate specificities [30,31]. Features that differentiate HxnS from HxA and those that are conserved in HxA and HxnS putative fungal orthologues are discussed below. The residues involved in the two amino-terminal 2Fe/2S clusters, and the FAD- and NAD-binding residues identified in the crystal structure of the B. taurus enzyme are strictly conserved in HxA and HxnS (figure 2). HxnS comprises several insertions when compared with HxA and other characterized XDHs (figure 2). The first insertion occurs between the second and the third Cys residues of the second 2Fe/2S cluster. The sequence between the 2Fe/2S cluster domain and the FAD/NAD-binding domain is longer in HxnS. Within the FAD/NAD domain, the residue corresponding to Phe417 of

3


2. Results

electronic supplementary material, figure S1, the latter showing enzyme activities with both hypoxanthine and nicotinic acid as substrates in native gels). hxnSD strains are able to use 6-OH nicotinic acid as a nitrogen source, albeit at a reduced level (figure 3; electronic supplementary material, figure S1). The significance of the latter is not clear as the cognate parent strain also uses 6-OH nicotinate badly, and an hxB20 strain (see sections ‘Introduction’ and ‘A tightly coregulated gene cluster in chromosome VI’, for HxB function) does not seem to be impaired in its utilization (figure 3). Previously isolated hxnS mutations result in the same phenotype as hxnSD on the N-source hypoxanthine supplemented with allopurinol or on nicotinate. However, they do not show any impairment in 6-OH nicotinate utilization (electronic supplementary material, figure S1). The three classical lossof-function mutations available were all isolated in an hxnR c7 background, which results in overexpression of other genes under HxnR control (see below) encoding other proteins putatively involved in 6-OH nicotinate utilization (figure 6a,b). The hxnS35 and hxnS41 alleles are nonsense mutations (electronic supplementary material, figure S1 shows the corresponding mutational changes), while hxnS29 results in a Phe1213Ser change in a conserved region (figure 2). The hxnS35 and hxnS41 mutations result in loss of PHII CRM, as assessed by immunoprecipitation, while hxnS29, a leaky mutation on allopurinol supplemented hypoxanthine medium (see electronic supplementary material, figure S1), fully retains CRM [22]. The above constitutes formal evidence that the locus AN9178 specifies the hxnS gene. Strains carrying the hxnS29 mutation have a clear phenotype in vivo, despite showing HxnS activity in vitro (electronic supplementary material, figure S1). The Phe1213Ser mutation may affect the stability rather than the activity of the enzyme. We have checked if 6-OH nicotinate (i.e. the product of nicotinate hydroxylase activity) could also be a substrate for HxnS. A very faint staining can be seen after 48 h incubation, a signal not stronger than the one obtained in the absence of substrate, incubating the gel in the presence of the tetrazolium salt (not shown).


mutations define the structural gene for PHII. Non-leaky hxnS mutations resulted in the loss of PHII enzyme activity but were heterogeneous regarding PHII cross-reacting material (CRM) [2,22]. Furthermore, mutations in hxnR result also in the complete inability to grow on 6-OH nicotinate. hxnR mutants are non-inducible for PHII activity or CRM [22]. The hxnR mutations are fully recessive and thus represent loss-of-function mutations. They define an activating transcription factor, necessary for the expression of hxnS and at least one other enzyme of the nicotinate utilization pathway, involved in the downstream conversion of 6-OH nicotinate. A number of mutants constitutive for PHII were called aplAc [1]. These represent regulatory gain-of-function mutations [1]. The aplA and hxnR mutations could represent two tightly linked genes or a single gene where the relatively frequent constitutive mutations define (a) negative-acting domain(s). The hxnS, hxnR and aplA mutations are tightly linked on chromosome VI (less than 1 centiMorgan for crosses involving several alleles of the three classes). One mutation isolated, described elsewhere, defines the xanA gene [18,19]. We report here that hxnS and hxnR are part of an extended gene cluster that includes four additional co-regulated genes. The aplAc mutations map in specific domains of the hxnR gene product. We discuss the evolutionary relationships between the structurally similar but functionally distinct HxA and HxnS paralogues, the domain structure of HxnR and the conservation of the nicotinate gene cluster in the Aspergillaceae.


4

XDH Bos taurus HxA (PHI) HxnS (PHII)

rsob.royalsocietypublishing.org Open Biol. 7: 170199 Figure 2. A comparison of PHI (HxA) and PHII (HxnS). An alignment of the two A. nidulans open reading frames with the structurally characterized XDH from B. taurus [24] is shown. Underlying the sequences: yellow, 2Fe/2S clusters; blue, FAD/NAD-binding domain; red, MOCO/substrate-binding subdomains I and II (as in [25]). Red arrows underlying the sequences indicate intron positions in the hxA gene, while green arrows indicate intron positions in hxnS. Boxed residues: yellow, conserved Cys in the 2Fe/2S clusters, also indicated the Glu45 and Gly46 (in B. taurus) residues belonging to the 2Fe/2S-binding loop, and separating this cluster from the flavin-binding ring; orange, FAD-binding residues [24]; blue, NADþ/NADH-interacting residues [26]; green, residues interacting with MOCO [25]; red, residues where HxnS and its putative orthologues differ from both HxA and typical XDHs represented by the B. taurus enzyme. Red asterisks mark residues involved in substrate binding of B. taurus XDH [24,27,28]. Blue asterisks mark residues lining the substrate access channel of B. taurus XDH [28]. Green asterisks mark residues hydrogen-bonding a molybdenum-bound oxygen [27]. Red downward arrows indicate mutational changes leading to complete loss of function in HxA; blue downward arrows indicate mutations leading to changes of substrate and inhibitor specificity in HxA [29]; the downward green arrow indicates the only extant missense mutation sequenced for HxnS. Alignment with MAFFT E-INS-i, visualized with BOXSHADE. the B. taurus XDH is almost universally an aromatic residue in XDHs (Tyr454 in HxA) but it is Ile (Ile478) in HxnS and always an aliphatic hydrophobic residue in HxnS orthologues (figure 2). The carboxy-terminal MOCO/substrate-binding domain (starting from residue 590 in the B. taurus XDH) shows an almost complete conservation of both the residues interacting with MOCO [25] and those interacting with substrates, including most of the residues that line the substrate access channel. His954 of the B. taurus enzyme, a residue not involved in the enzyme active site, is conserved in HxA (His985) and in most of its orthologues. However, it is Pro (Pro1008) in HxnS (figure 2) and in all its putative orthologues. This change does not affect the modelled secondary structure (not shown, but see below). Other amino acid residues, which differ systematically among HxA and HxnS orthologues (see section below), correspond to some of the residues involved in MOCO binding; the Val1081 and Ser1082 of the B. taurus enzyme are Ala1112 and Ser1113 in HxA but Ser1137 and Gly1138 in HxnS (figure 2). Conserved residues include Arg880 of B. taurus XDH (Arg911 of HxA and Arg934 of HxnS), a residue that is never conserved in XDH-like aldehyde oxidases [9,29 –31]. Mutations affecting this residue in hxA result in altered substrate specificity including a

PHII-like resistance to allopurinol inhibition and the inability to accept xanthine as a substrate [18,29]. Glu803 of the B. taurus enzyme is conserved in HxA (Glu833) and HxnS (Glu856). This key residue is never conserved in XDH-like aldehyde oxidases [30]. Within the HxA MOCO/substrate-binding domain, several mutations result in either loss-of-function or altered substrate specificity phenotypes [29]. All the corresponding residues involved are conserved in HxnS (figure 2). The pair of aromatic amino acids that sandwich the purine ring and orient the substrate towards the MOCO are conserved (Phe914 and 1009 in the B. taurus enzyme, 954 and 1040 in HxA, 968 and 1064 in HxnS). A striking exception to the sequence conservation is the insertion of an Ala (Ala1065 in HxnS) between the almost universally conserved Phe1009 and Thr1010 (numeration as in the B. taurus enzyme, Phe1040 and Thr1041 in HxA, Phe1064 and Thr1066 in HxnS; conserved in all characterized XDHs but not in the eukaryotic XDH-like aldehyde oxidases [30], figure 2). The Phe/Thr pair is also conserved in bacterial XDHs (residues 459 and 460 in subunit B of the Rhodobacter capsulatus XDH [32]). An Ala insertion at this position is an almost absolute feature of HxnS orthologues (FATAL in HxnS orthologues, FSTAL in Choiromyces venosus putative

2 hx nS D hx B2 0 hx nR D hx nR 80 hx nR 7c

tro l

co n

Hx Hx, AIIp Hx, AIIp, 100 mM NA Hx, AIIp, 100 mM 6-NA Hx, AIIp, 100 mM 2,5-DP*

10 mM 6-NA* 10 mM 2,5-DP* no N-source

Figure 3. Utilization of different nitrogen sources by mutants described in this article. Above each column we indicate the relevant mutation carried by each tested strain. Hx indicates 1 mM hypoxanthine as the sole nitrogen source. Hx, Allp, as above including 5.5 mM allopurinol, which fully inhibits PHI (HxA) but not PHII (HxnS). NA, 6-NA and 2,5-DP indicate, respectively, nicotinic acid and 6-OH nicotinic acid added as the sodium salts (see ‘Material and methods’ section) and 2,5-dihydroxypyridine added as powder. Other relevant concentrations are indicated in the figure. Plates were incubated for 3 days at 378C except those marked by asterisk (*), which were incubated for 4 days. Strains used: control 1 (HZS.120, parent of hxnSD), control 2 (TN02 A21) are wt for all hxn genes. Mutant strains: hxnSD (HZS.599), hxB20 (HZS.135), hxnRD (HZS.136), hxnR80 (HZS.220) and hxnRc7 (FGSC A872). The complete genotypes are given in the electronic supplementary material, table S5.

HxnS, compared with FTAL in all Pezizomycotina HxA orthologues). Phe1013 is universally conserved in XDHs (Phe1044 in HxA), but it is a His (His1069) in HxnS (figure 2) and its putative orthologues. HxA and HxnS can be modelled to and superimposed on the structure of the B. taurus XDH (electronic supplementary material, figure S2). While modelling the active site, no obvious differences can be seen in the orientation of the relevant active-site residues with the obvious exception of the orientation of Thr1066 of HxnS compared with Thr1041 (HxA) and Thr1010 (B. taurus XDH). This residue participates in the active site by interacting with the carbonyl group of Phe1009 [33]. The hydroxyl group of Thr1010 is involved in the binding of several inhibitors [33–35], but more importantly, either the N1 or the N7 of hypoxanthine [36]. The corresponding Thr460 (within an FTLTH motif) of the B subunit of the Rhodobacter capsulatus XDH has been shown to hydrogen-bind the N7 of hypoxanthine but the O6 of xanthine [34]. Further work should show whether the change of orientation of the Thr residue is the key feature that allows presentation of the nicotinate molecule to the MOCO centre.

2.3. Phylogeny of fungal purine hydroxylases

2.4. Identification and characterization of the hxnR/aplA gene

The hxnS gene probably resulted from duplication and divergence of an ancestral hxA gene [7]. We searched all available fungal genomes for homologues of XDH (see electronic supplementary material, figure S3 and table S1). Enzymes

Closely linked to, but separated by locus AN9177 (to be called hxnT; see below), there is an open reading frame of 2673 nt (interrupted by a single 75 nt intron) encoding a protein of 865 residues comprising two typical Cys2His2

5


10 mM NA*

of this group are absent from Rozella allomycis (Cryptomycota), the Microsporidia, the Neocallimastigomycota and the Mucoromycotina. Figure 4 and the electronic supplementary material, figure S3 show the distribution of XDH-like enzymes among all fungal taxa. XDH-like enzymes are present in all classes of the Pezizomycotina, basal species of the Taphrinomycotina and Saccharomycotina, and some members of the Basidiomycota (see below). The peptidic sequence of the outgroups strongly suggests that the basal enzyme was a typical XDH. No hxnS-like gene is present outside the Pezizomycotina. Both hxA and hxnS orthologous genes are present in the basal class Pezizomycetes, while hxnS orthologues are absent from the sequenced species of Orbiliomycetes and Lecanoromycetes. With the exceptions of Oidiodendron maius and Rhytidhysteron rufulum (see electronic supplementary material, figure S3 legend), all species of the Pezizomycotina, where a putative orthologue of HxnS is present, also carry an orthologue of HxA. Loss of hxnS orthologues has occurred within the Eurotiomycetes: orthologues of HxA are present in all species available, but the presence of HxnS is patchy, i.e. present in the nidulantes group and the black aspergilli, but not, for example, in A. flavus. With the exception of Penicillium paxilli and P. citrinum, which contain hxnS orthologues (unlinked to hxnR; see below), the hxnS orthologues are missing from species of Penicillium. Within the Sordariomycetes, a similar pattern of loss occurs, with hxnS orthologues present in the Nectriaceae (order Hypocreales), but not in the Sordariales (such as Neurospora crassa, Sordaria macrospora and Podospora anserina). The only PH-like enzyme present in O. maius (Leotiomycetes) could represent a second neofunctionalization, in which an enzyme phylogenetically related to HxnS would have reacquired HxA substrate specificity (see comments to electronic supplementary material, figure S3). The phylogeny (figure 4; electronic supplementary material, figure S3) strongly suggests a duplication of an HxA ancestral gene occurring at the root of the Dikarya. This duplication would have been followed by either neo-functionalization, leading to HxnS (in the Pezizomycotina) or loss of one of the two ancestral paralogues with HxA function (elsewhere in Dikarya). This discrepancy between the timing of duplication and neo-functionalization would account for the two separated clades of the XDHs of the Basidiomycota (one of them clustering with HxnS orthologues), the divergence of Saitoella complicata and the Taphrina spp., and the position of both the Saccharomycotina and Taphrinomycotina as outgroups of HxA orthologues rather than as an outgroup of all the Pezizomycotina PHs (see electronic supplementary material, figure S3 legend). The hxnS orthologues, which have been included in figure 4 and the electronic supplementary material, figure S3, show a highly variable exon/intron structure, as discussed in the supplementary material (comments on the exon–intron structure of hxnS orthologues).


co n

tro l

1



Saitoella complicata (Taphrinomycotina)

6

1

Orbiliomycetes

1

Dothideomycetes

0.97 0.47 1 0.95

0.97

Xylonomycetes

1

Lecanoromycetes

0.81

HxA orthologues

0.83 0.76

1

Eurotiomycetes (inc. Aspergillus nidulans HxA)

0.64


0.58

Sordariomycetes (inc. Neurospora crassa XDH)

1 0.99

Leotiomycetes

0.36 0.14

Pezizomycetes

0.92

Saccharomycotina inc. Blastobotrys (Arxula) adeninovorans XDH

1

Taphrinomycotina (Taphrina)

1 1

Basidiomycota (Pucciniomycotina, Agaricomycetes)

1

Sarcoscypha coccinea (Pezizomycetes)

Symbiotaphrina kochii (Xylonomycetes)

1

Dothideomycetes (Botryosphaeriales)

0.87

0.95

0.2

Sordariomycetes

0.95

gene duplication?

0.99

1

0.99

HxnS function

Dothideomycetes (Pleosporales)

1 1

Eurotiomycetes (inc. Aspergillus nidulans HxnS)

1

HxnS orthologues

0.92

Mixed clade (inc. Oidiodendron maius)

1 0.99

0.49

1

Xylonomycetes

0.85

0.9

Leotiomycetes (Helotiales)

1

Pezizomycetes

1

Basidiomycota (Ustilaginomycotina, Tremellomycetes)

1

0.56

1

Enthomophtoromycotina (Conidiobolus)

Glomeromycotina (Rhizophagus irregularis) 1 0.96

Mortierellomycotina

1

Non-dikarya

Kickxellomycotina

0.96

1 0.86

1

0.67

Entomophtoromycotina (Basidiobolus)

Chytridiomycota

0.95

0.85

Ichthyosporea, Filasterea

0.97

Metazoa (Inc. Bos taurus and Drosophila melanogaster XDHs)

0.76


Pezizomycetes

0.62

0.3

Figure 4. A simplified phylogeny of the fungal purine hydroxylases, HxA (PHI)-like and HxnS (PHII)-like. This tree in cartoon form was extracted from the more complete tree shown in the electronic supplementary material, figure S3, where all species used are indicated. Outgroups are the nearest non-fungal taxa of the Opisthokonta. Values at nodes are aLRTs (approximate likelihood ratio tests). The arrows indicate the putative nodes where the gene duplication and the PHII neo-functionalization occurred.


(a)

G76D

7

W578STOP

constitutive mutations patch 1 mutation P219A P219L Y226D

constitutive mutations patch 2

Y226N Y226S N227D W228R W228S F230I F230S D237Y, A238P F239S

mutation F565S K603N K603E K603T T607P R639C

C2H2

mutant 305, 309 7, 108, 151 203 103 304 48

putative NLS putative NES pfam04082

, hx AD

hxA

18

R c7 hxn

R +,

hxA D

hxn

R +, hxn

, hx + A

, hx A18 304

R+ hxn

, hx + A 203

hxn Rc

, hx AD hxn Rc

, hx AD 103

108 hxn Rc

305

, hx A18 hxn Rc

Rc

, hx A18 hxn

, hx AD 150

308 Rc hxn

302

, hx A18 hxn Rc

, hx A18 hxn Rc

, hx A18 307

310 hxn Rc

101

, hx AD Rc hxn

Rc

, hx A18 hxn

, hx A18 306

311 hxn Rc

, hx AD hxn Rc

, hx AD

100

109 Rc hxn

300

, hx A18 Rc hxn

102 hxn Rc

hxn Rc

, hx AD

(b)

HxnS

Hx NA

HxA c

Figure 5. A schematic representation of the HxnR transcription factor and verification of constitutivity of hxnR mutants. (a) A schematic of the HxnR transcription factor is shown, indicating the two Cys2His2 Zn-finger domains (C2H2, in purple), the putative nuclear localization signal (NLS, in orange), the putative nuclear export signal (NES, in yellow), the fungal transcription factor domain ( pfam04082, in blue) and the two regions where the constitutive mutations occur (in green). The three extant loss-of-function mutations are indicated in red letters in the scheme. All the amino acid changes leading to constitutivity are indicated, together with the cognate allele number (in green). (b) Enzyme activity staining for hypoxanthine hydroxylase (Hx) and nicotinate hydroxylase (NA) of the constitutive mutants is shown. Only HxnS (PHII), which has a lower mobility than HxA (PHI), stains with nicotinate as the substrate. Note its complete absence in the wt strain hxnRþ hxAþ grown under non-inducing conditions, while HxA shows substantial basal levels as reported previously [1,38]. As the constitutive mutations were isolated in different hxA backgrounds (hxA18, hxAD, hxAþ; see ‘Material and methods’ section and electronic supplementary material, table S2), this is also indicated. All mycelia were grown in non-inducing conditions (for either HxA or HxnS) on 1 mM acetamide as the nitrogen source for 15 h at 378C. Zn fingers near its amino terminus (AN11197). We have resequenced this region (GenBank accession number KX669266). In the A. nidulans open reading frame, there are two possible in-phase initiation codons separated by three residues (MKAKM; electronic supplementary material, figure S4). In other aspergilli available in the databases, only the second Met codon is present. As the first codon is within the transcribed sequences (RNAseq data, J-Browse module at http://www.aspgd.org/), we have assumed that this is the genuine start codon in A. nidulans (in accordance with Kozak [37]). Between residues 394 and 668, a PFAM domain ‘Fungal transcription specific domain’ PF04082 was detected (figure 5a). A nuclear localization signal from residue 77 to 87 (NLS, VLETRKRMRRA) downstream from the Zn fingers is strongly predicted by CNLS MAPPER, while a nuclear export signal (NES, LDIDL) is predicted for residues 285–289 by NETNES (figure 5a). We deleted the whole AN11197 coding region. The resulting phenotype is identical to that reported previously for hxnR loss-of-function mutations [1,3,22] (figure 3; electronic supplementary material, figure S1 and transcriptional phenotypes in section ‘A tightly co-regulated gene cluster in chromosome VI’): inability to use nicotinate and 6-OH nicotinic acid as sole nitrogen sources, to which we can add now the inability to use 2,5-dihydroxypyridine, an intermediate in the

catabolism of nicotinate in bacterial species [39,40]. Figure 3 confirms that 2,5-dihydroxypyridine is an inducing intermediate in A. nidulans as this metabolite allows strong growth on hypoxanthine in the presence of allopurinol, which necessitates induction of hxnS. Extant loss of function, as well as constitutive mutations (alpAc mutations; see ‘Introduction’ section) map within the hxnR open reading frame (figure 5a). We have thus renamed the constitutive regulatory mutations, hxnR c. We attempted to define the domain(s) comprising residues mutable to constitutivity by selecting and sequencing additional hxnRc mutations (see ‘Material and methods’ section). All sequenced mutations are shown schematically in figure 5, while the mutational changes are detailed in the electronic supplementary material, table S2. As some mutational changes were detected several times, in separate mutation runs, we have probably near-saturated the hxnR gene with constitutive mutations. We constructed a CONSURF profile of the HxnR protein, using putative orthologues from 123 species of the Pezizomycotina subphylum (electronic supplementary material, figure S4 and table S3). All missense mutations, either constitutive or loss-of-function, map in highly conserved regions (figure 5). Constitutive mutations map in two patches, one well-defined patch between residues 219 and 239, the other,


mutant 102 300 100, 104-107, 202 109, 152 306 311 101, 110, 201 301, 303 307 310 200, 302 150 308

domains:


LDIDL

VLETRK 82 RMRRA E


In A. nidulans, the hxnR and hxnS genes are within a cluster of co-regulated genes. This is shown in figures 6 and 7. Six neighbouring genes, inducible by nicotinate and 6-OH nicotinate, are non-inducible in strains carrying either the hxnR2 or hxnRD mutations and show strong constitutive expression in the hxnRc7 background. The genes in the cluster are: hxnS (AN9178), hxnT (AN9177), hxnR (AN11197), hxnP (AN11189), hxnY (AN11188) and hxnZ (AN11196) (figure 6d). The flanking genes AN9179 (adjacent to hxnS) and AN9174 (adjacent to hxnZ and transcribed convergently) are not induced by nicotinate and they are not affected by hxnR constitutive or loss-of-function mutations (not shown). The hxnP and hxnZ genes encode transmembrane proteins of the Major Facilitator superfamily (PF07690.13). hxnT encodes a flavin oxidoreductase (Oxidored_FMN, PF00724), while hxnY encodes a typical a-ketoglutarate-dependent dioxygenase (PF14226.5 and PF03171.19). The role of each gene in nicotinate utilization and their phylogenetic relationships will be discussed elsewhere, HxnP and HxnZ being involved in the uptake of nicotinate-derived metabolites, and HxnT and HxnY in the further metabolism of 6-OH nicotinic acid (E Bokor, M Flip´ mon, C Scazzocchio and Z Hamari, unpublished phi, J A results). We can however state that, for each of these genes, the nearest homologue is a fungal and not a bacterial gene (not shown). hxnR is itself an inducible gene (figure 6a,b). There is a clearly detectable level of hxnR transcript under non-induced conditions, at variance with the other genes of the cluster. RNAseq data [23,42], available in J Browse (http://www.aspgd.org/), confirm the co-regulation of the cluster, where all genes in this cluster are non-expressed in conditions of nitrogen sufficiency and derepressed by nitrogen starvation. Under our experimental conditions, with the exception of hxnR, genes in the cluster are virtually nonexpressed in media that contain good nitrogen sources but are expressed under nitrogen-starved conditions (figure 6c). All genes in the cluster are drastically repressed by ammonium (figures 6b and 7a). HxnR is necessary for expression under nitrogen-starved conditions (figure 6c).

2.6. Conservation of the hxn gene cluster in the Aspergillaceae The evolution of the whole nicotinate utilization pathway in fungi will be dealt with in another publication (E Bokor, ´ mon, C Scazzocchio and Z Hamari, unpublished M Flipphi, J A results), but we discuss here the conservation of the hxn cluster in the Aspergillaceae family. Examples of the organization of the cluster are shown in figure 8. Episodes of gene gain and loss are shown, including the duplication of hxnY or hxnT as well as the loss of hxnT and hxnS. In A. ochraceoroseus, only hxnS is present, a mirror image of the situation in A. flavus (and other species in section Flavi) and P. digitatum (and all other Penicillium species but two), where the genome includes all hxn genes with the exception of hxnS. The absence of hxnS may imply that, in these species, the cluster deals with the utilization of nicotinate derivatives (such as 6-OH nicotinic acid) rather than that of nicotinate per se. The situation in P. citrinum (and P. paxilli) implies a secondary reconstitution of the pathway by horizontal transmission, as an unlinked orthologue of hxnS is present, seemingly reacquired from a member of the Hypocreales (order of Sordariomycetes; see Phylogeny section, electronic supplementary material, figure S3). In A. niger, and related black aspergilli albeit not in A. carbonarius or A. aculeatus, a new, intronless gene, encoding a putative nitroreductase is inserted in the cluster, between hxnR and hxnT (see ‘Discussion’ section).

8


2.5. A tightly co-regulated gene cluster in chromosome VI

The strong constitutivity of hxnRc7 strains is clear in the presence of a non-repressive nitrogen source (acetamide) or under conditions of nitrogen starvation. The transcript of hxB, which had previously been found to be independently regulated by HxnR and UaY (and thus independently induced by nicotinate and uric acid [41]) behaves qualitatively as the five structural genes in the cluster (figure 6b). The role of AreA, the GATA factor mediating nitrogen metabolite derepression [43–45], is shown for hxnS and hxnP in figure 7a. Transcription of both hxnS and hxnP is abolished in a strain carrying a null areA mutation (areA600) under all conditions, including nitrogen starvation. Surprisingly, the transcription of both hxnS and hxnP is diminished in a strain carrying an xprD1 mutation (considered to be the most extremely derepressed allele of areA, ([46] and references therein)); the allele is called xprD1 for historical reasons [43,47]. By contrast with the genes of the nitrate and purine assimilation pathways [48 – 50], the glutamate – aspartate transporter gene agtA [51] and also hxB [41], the hxnS and hxnP genes are fully repressed by 10 mM ammonium in an xprD1 strain. A similar atypical effect has been reported for the main urea transporter ureA gene [52]. A downstream metabolite of nicotinate is the physiological inducer of the HxnS protein [12]. Figure 7b shows this to be the case at the level of mRNA steady-state levels for both hxnS and hxnP. In an hxB null mutant lacking HxnS activity, nicotinate does not behave as an inducer but 6-OH nicotinate does. Thus the effector of HxnR is not nicotinate but 6-OH nicotinate or a metabolite further downstream the nicotinate utilization pathway. The in vivo test shown in figure 3, where 2,5-dihydroxypyridine acts as inducer, suggests the latter to be the case.


a larger domain between residues 565 and 639. For a number of residues we have obtained several different amino acid changes. Accessible aromatic residues at positions 226 and 228 and a basic residue at position 605 seem necessary for HxnR to be in its default, inactive state, in the absence of its physiological inducer. We detected putative HxnR orthologues only among the Pezizomycotina (electronic supplementary material, table S3). We would expect a strong correlation between the presence of hxnR and hxnS orthologues. Out of 139 species of the Pezizomycotina screened, 40 have only hxnR and 14 only hxnS (electronic supplementary material, table S4). Among the 85 species where both genes are extant, tight clustering is evident in most of them (see the section ‘Conservation of the hxn gene cluster in the Aspergillaceae’). The absence of clustering is common among the Sordariomycetes, with the exception of the Xylariales order where the clustering is maintained. These 85 species include all classes of the Pezizomycotina subphylum with the exception of the Orbiliomycetes and the Lecanoromycetes.


9 hxnZ


hxnY 4

hxnP hxnR hxnT

3

hxnS 2


mRNA levels relative to actin

(a) 5

1

0 I

IR

hxnR+ (b)

NI

I

NI

hxnR2 hxnR+ hxnRc7 N I IR N I IR N I IR

hxnS hxnR hxnT hxnZ hxnY hxnP hxB

I

hxnRc7

hxnRD (c) mRNA levels relative to actin

NI

5

hxnS hxnP

4 3 2 1 0

actA

U

St I hxnR+

U

St I hxnRD

U

St I hxnRc7

(d) hxnZ

hxnY

hxnP

hxnR

hxnT

hxnS

14 373 bp region of chromosome VI

Figure 6. Co-regulation of the genes in the hxn cluster. (a) mRNA levels measured by qRT-PCR for all the genes in the hxn cluster. Mycelia were grown on 1 mM acetamide as the sole nitrogen source for 8 h at 378C. They were either maintained on the same medium for a further 2 h (non-induced, NI) or induced with 1 mM nicotinic acid (as the sodium salt, I) or induced as above together with 5 mM of L-(þ)diammonium-tartrate (induced repressed, IR). Strains used: hxnRþ (FGSC A26), hxnRD (HZS.136) and hxnRc7 (FGSC A872). (b) Northern blot showing qualitatively the co-regulation of all the genes in the cluster under different growth conditions. Mycelia were grown on 500 mM urea for 8 h, and then transferred to 1 mM acetamide for an additional 2 h (non-induced, NI) or to the same plus 1 mM nicotinic acid (as above, I) or to the latter together with 5 mM L-(þ)diammonium-tartrate (induced repressed, IR). Together with hxnS, hxnR, hxnT, hxnP, hxnY and hxnZ transcripts we also monitored the expression of hxB, an unlinked gene, which was previously shown to be under the control of HxnR [41]. As a loading control, the expression of acnA (actin) was monitored. Strains used are indicated by the relevant mutation: hxnRþ (FGSC A26), hxnR2 (CS302), a missense unleaky mutation (Gly76Asp) and hxnRc7 (FGSC A872), our standard constitutive mutation (figure 5; electronic supplementary material figure S4 and table S2). (c) Expression of hxnS and hxnP under conditions of nitrogen starvation. Mycelia were grown on 5 mM urea as the sole nitrogen source for 8 h, and then transferred to the same medium for two additional hours (U, which is non-inducing and actually partially repressed conditions; see text) or to a medium without any nitrogen source (starvation media, St) or to a medium with 10 mM nicotinic acid as the nitrogen source (inducing media, I). Strains as in panel (a). In all qRT-PCR experiments, data were processed according to the standard curve method with acnA as the control mRNA. Standard errors of three independent experiments are shown in all qRT-PCR. Gene probe primers are detailed in the electronic supplementary material, table S6. (d ) Cluster arrangement of the hxn genes on chromosome VI.

3. Discussion 3.1. A nicotinate-inducible eukaryotic cluster With the exception of some of our own old work (see ‘Introduction’ section) no genes or enzymes involved in the degradation of nicotinate have been described in any eukaryote. Degradation of nicotinic acid has been studied in plant cell cultures and tea plant material fed with carboxylC14-nicotinic acid and C14-6-nicotinic acid, monitoring the formation of 14CO2 [53–55]. No enzymes involved in these processes were identified and inspection of relevant genomes

only revealed one typical XDH. Thus, the A. nidulans HxnS is the hitherto only eukaryotic nicotinate hydroxylase studied, and the hxn gene cluster we have identified is the first co-regulated eukaryotic gene cluster involved in the utilization of nicotinate ever described.

3.2. The hxA/hxnS duplication compared to other eukaryotic MOCO-enzyme duplications Neo-functionalization of enzymes of the XDH group arising from ascertained or presumed gene duplications occur in


hxnS hxnP

1.0

0.5

0 NI I IR R St NI I IR R St NI I IR R St xprD1 areA600 areA+


(b) 3

hxnS hxnP

2

3.3. Convergent evolution of bacterial and fungal nicotinate hydroxylases 1

0

NI

I

I

(NA) (6-NA)

hxnR+ hxB+

NI

I

I

(NA) (6-NA)

hxnR+ hxB20

NI

I

I

(NA) (6-NA)

hxnRD hxB+

NI

I

I

(NA) (6-NA)

hxnRc7 hxB+

Figure 7. Induction depends on the AreA GATA factor and on the metabolism of nicotinic acid. (a) The GATA factor AreA is essential for hxnP and hxnS expression. hxnP and hxnS mRNA levels in areAþ (FGSC A26) and an areA supposedly derepressed mutant (xprD1, HZS.216) and areA null mutant (areA600, CS3095) strains. Non-induced conditions (NI): Strains were grown on MM media with 5 mM L-(þ)diammonium-tartrate as the sole N-source for 8 h, and then the mycelia were transferred to MM with 1 mM acetamide for further 2 h. Induced conditions (I): as above but transferred to 10 mM nicotinic acid as the sole N-source. Induced repressed conditions (IR): transferred to 10 mM nicotinic acid and 5 mM diammonium-tartrate. N-starvation conditions (St): transferred to nitrogen-free medium. (b) Induction depends on metabolism of nicotinic acid via HxnS activity. mRNA levels of hxnP and hxnS in hxnRþ hxBþ (FGSC A26), hxnRþ hxB20 (HZS.135), hxnRD hxBþ (HZS.136) and hxnR constitutive, hxnRc7 hxBþ (FGSC A872) strains are shown. Non-induced (NI) and induced growth conditions were the same as detailed in (a). (NA): induced with 1 mM nicotinic acid; (6-NA): induced with 1 mM 6-OH nicotinic acid. The hxB20 mutation abolishes completely HxnS activity without affecting its expression as judged by measuring its CRM [12]. qRT-PCR data in both panels were processed according to the standard curve method; the housekeeping control transcript was actin (acnA). Standard deviations based on three biological replicates are shown. both prokaryotes and eukaryotes. Fetzner and co-workers have described the diversity of bacterial MOCO enzymes of the XDH group, even if the phylogeny of these enzymes with different specificities remains unstudied [39,56–59]. Duplication and neo-functionalization of genes encoding XDH-like enzymes are widespread in Metazoa, studied mainly in insects and vertebrates. In Metazoa, a close linkage of the neo-functionalized genes with strict conservation of

MOCO enzymes able to catalyse the hydroxylation of nicotinate to 6-OH nicotinate have been described in a variety of bacterial species [40,66 –68]. However, it can be excluded that the HxnS proteins have originated by horizontal transmission from bacteria. In all eukaryotes, XDH-like enzymes are dimers of chains of approximately 1500 amino acid residues comprising three discrete domains (figure 2). In bacteria, these domains are encoded by at least two genes, one specifying a small subunit carrying the 2Fe/2S centres and the FAD-binding sequences and a large subunit carrying the MOCO and substrate-binding centres. These genes, included in an operon, reflect the amino- to carboxy-terminus order of the domains in the eukaryotic XDH-like enzymes. A similar structure occurs in bacterial nicotinate hydroxylases [40,67], which makes improbable a direct bacterial origin of the fungal nicotinate hydroxylases. Figure 4 and the electronic supplementary material, figure S3 show that HxnS orthologues have originated by gene duplication within the fungal kingdom, possibly at the root of the Dikarya, with a neo-functionalization process occurring within the Pezizomycotina subphylum. BLASTP screening with the MOCO/ substrate-binding domains of both HxA and HxnS (figure 2) against all bacterial sequences available in the NCBI non-redundant protein (nr/nt) database yielded homologues of the MOCO-binding subunits of putative bacterial XDHs, but in no case (among the first 100 sequences) were MOCO subunits of known bacterial nicotinate hydroxylases found (not shown). Thus, fungal nicotinate dehydrogenases show more similarity to bacterial XDHs (and as a matter of course, to all genuine eukaryotic XDHs) than to bacterial nicotinate dehydrogenases. A comparison of the sequences of the MOCO and substrate-binding subunits of bacteria suggests that there are at least three classes of MOCO nicotinate hydroxylases, exemplified by Pseudomonas putida, Eubacterium barkeri and Bacillus niacini, respectively [40,66,67]. We have stated that the insertion of an Ala residue (HxnS Ala1065) between the conserved Phe and Thr in the active site is a signature of fungal HxnS orthologues (see §§2 and 3 of Results). Genuine

10


intron/exon structure is the rule [30,60–63]. The implication is that XDH gene duplication has occurred by different mechanisms in metazoans and fungi. In metazoans, duplication seems to occur at the DNA level by unequal crossover. In the fungi, the striking amino acid sequence conservation among the HxA/HxnS paralogues together with the variability of intron positions suggests that the duplication of an HxA ancestral gene occurred via retroposition, followed by a re-intronization either after or concurrent with re-functionalization of the duplicated gene. Notwithstanding the mechanism underlying this gene duplication, the hxA/hxnS duplication is quite ancient, occurring before the divergence of the Taphrinomycotina from other Ascomycota (greater than 400 Ma [64,65]), which allows the possibility of intron loss and reinsertion. The variation of intron –exon organization in both the hxA and hxnS clades (not shown) is also consistent with this possibility (figure 4 and electronic supplementary material, figure S3, for the relevant positions in the phylogenetic tree).



(a) 1.5


A. nidulans

hxnZ

hxnY

hxnP

hxnR

hxnT

hxnS


A. niger A. flavus A. ruber M. ruber *

A. sclerotiorum

*

A. ochraceoroseus

*

A. fumigatus P. citrinum P. digitatum

Figure 8. Hxn cluster organization in the Aspergillaceae family. Boxes indicate genes; arrowheads indicate orientation. Colour stands for the orthologues found in different species (Aspergillus nidulans, A. niger, A. flavus, A. ruber, Monascus ruber, A. wentii, A. sclerotiorum, A. ochraceoroseus, A. fumigatus, Penicillium citrinum, P. digitatum). Stars indicate putative pseudogenes ( putative non-functional alleles); hatched boxes indicate duplicated paralogues. Vertical lines symbolize physical unlinkage of genes on the same chromosomes. The blank box in A. niger stands for the orthologue of the A. nidulans gene at locus AN8360 (encoding a nitroreductase of bacterial origin), which is unlinked to the cluster in the latter fungus, while its expression is not regulated by nicotinate or the transcription factor HxnR. bacterial XDHs also carry an FT motif in the cognate place in the structure [32,34]; however, the divergence of bacterial nicotinate hydroxylases from bacterial XDHs is such that neither sequence alignments nor structural modelling (not shown) gave a clear inkling of which modifications resulted in, or at least correlate with the shift in substrate specificity. It seems that not only has there been convergent evolution of fungal and bacterial nicotinate hydroxylases, but that nicotinate hydroxylases evolved several times independently within bacteria. A hint to the shift in specificity towards hydroxylation of nicotinic acid is provided by the molecular structure of the nicotinate hydroxylase of E. barkeri [68,69]. In this enzyme, the substrate/MOCO-binding domain is split into two independent peptides (L and M). Strikingly, it carries a selenium rather than a sulfur atom as the terminal ligand to the Mo(VI). Selenium also occurs in the XDH of this organism [68,69], which is consistent with an independent evolution of the E. barkeri nicotinate hydroxylase from that of other bacterial enzymes of similar specificity (see above). Most active-site residues are conserved, with an interesting exception. Tyr13 of subunit M (Tyr13M) is modelled to hydrogen-bind the heterocyclic N atom of nicotinate by its hydroxyl group [68]. The corresponding residue in the B. taurus XDH is Phe1005, which has not been proposed to interact with the substrate [24,27]. This Phe residue, four residues upstream of Phe1009 (of B. taurus), is conserved in both HxA and HxnS (figure 2) and indeed in all HxA and HxnS-like fungal enzymes included in the electronic supplementary material, figure S3, with the exception of the putative XDH of the four divergent Taphrina species, where it is substituted by a His. Tyr13M is not conserved in several other characterized or putative nicotinic acid hydrolases such as those of Ps. putida and its putative orthologues, where the corresponding residue is an Arg or a His. No sequence similar to FTAL or FATAL is present in the enzyme of E. barkeri and its putative orthologues (see fig. S1 of [68]). It is tempting

to speculate that the change in orientation of Thr1066 in HxnS allows an interaction with nicotinate by its hydroxyl group similar to that seen for modelled Tyr13M in E. barkeri. Biochemical evidence indicates that the carboxyl group of nicotinate is essential for substrate binding of HxnS [11]; the hydroxyl of Thr1006 could potentially hydrogen-bind the carboxyl group of nicotinic acid. Differently from HxnS, the enzyme of E. barkeri does not accept hypoxanthine as substrate [68]. It can be proposed that the bacterial enzymes (at least the E. barkeri one) have fully evolved into dedicated nicotinate hydroxylases, while the HxnS orthologues conserve properties of XDH. The specific situation discussed for the homologue of O. maius, which can be proposed to have reverted to a typical XDH activity from an HxnS-like enzyme (see electronic supplementary material, figure S3 legend), would be in line with this speculation.

3.4. An unusual specific transcription factor Fungal transcription factors regulating specific metabolic primary or secondary pathways are generally of the Zn2Cys6 (zinc cluster) class, while Cys2His2 (zinc finger) factors are usually, with very few recorded possible exceptions [70,71], broad domain regulators of either metabolism and/or morphology. The closest characterized transcription factor that shares architecture and has sequence similarity with HxnR is Klf1p of Schizosaccharomyces pombe. This factor is necessary for maintenance of long-term quiescence and its absence results in abnormal cell morphology in the quiescent state [72]. The nearest homologue and possible orthologue of Klf1p in A. nidulans is the protein of unknown function encoded by AN6733. The latter is strictly conserved in a syntenic position in all aspergilli included in the AspGD database and putative orthologues are present in all sequenced members of the Pezizomycotina (not shown). As hxnR is only present in the Pezizomycotina, it is tempting


A. wentii

11


Old genetic and newly acquired data, which will be reported ´ mon, C Scazzocchio and elsewhere (E Bokor, M Flipphi, J A Z Hamari, unpublished data), established that not all the genes involved in nicotinate catabolism are within the hxnZ –hxnS gene cluster. We have described the conservation of this cluster within the Aspergillaceae. We discussed the origin of both hxnS and hxnR within the Pezizomycotina subphylum. While the selective pressures that led to the conservation of clustering of genes of a specific metabolic pathway have been the subject of animated discussion [76 –78], we have no inkling of the recombination processes that led to clustering of the hxn genes in the first place. A model of recent local gene duplication can be excluded for the origin of all genes in the cluster, each nearest paralogue in the same organism being in every case unlinked and actually on a different chromosome (not shown). Within the Aspergillaceae, A. nidulans represents the possible primeval situation, with a pattern of both loss and duplication for other members of this family (figure 8). Recent duplication has occurred for some of the genes in the cluster. In Monascus sp. (exemplified by M. ruber in figure 8) an unlinked paralogue of hxnT is extant, showing 58% amino acid identity with the copy within the cluster and a strict conservation of intron positions. Duplicated paralogues of hxnY occur in the flavii/ nomius group and in species of the section Aspergillus. The fact that these duplicated genes are unlinked to the cluster excludes a model of duplication by unequal crossover.

4. Material and methods 4.1. Strains, media and growth conditions The A. nidulans strains used and/or constructed in this work are listed in the electronic supplementary material, table S5. Standard genetic markers are described in http://www. fgsc.net/Aspergillus/gene_list/. Complete (CM) and

12


3.5. The evolution of clustering

It is noteworthy that instances of duplications are coupled with instances of loss. Duplication of hxnY in the section Aspergillus (exemplified by A. ruber, figure 8) is coupled with the loss of hxnT, while that of hxnT in section Flavi (exemplified by A. flavus, figure 8) is coupled with the loss of hxnS. This coupling may result from just one single recombination event. Note that in M. ruber, where there is no gene loss, duplication of hxnT coincides with the separation of hxnS from the cluster. The duplication of hxnY, with conservation of (some) intron positions, seems to have occurred before the divergence of the flavi and the fumigati groups. Remarkably, only the duplicated hxnY paralogue is retained in A. fumigatus and Neosartorya fischeri. Horizontal transmission from pre-existent clusters has been established for both primary and secondary metabolism pathways. It has been proposed that nitrate assimilation gene cluster of fungi was horizontally transmitted from oomycetes [79]. We can exclude such horizontal transmission as the origin of the hxn cluster. The nearest paralogue of all the genes comprising the cluster is another fungal gene, usually in the same organism (data to be presented elsewhere, E ´ mon, C Scazzocchio and Z Hamari, Bokor, M Flipphi, J A unpublished results). One exception to this is the incorporation of an intronless nitroreductase gene into the hxn cluster of most aspergilli of the section nigri and its presence outside the cluster in four other aspergilli including A. nidulans. A phylogenetic analysis (not shown) establishes that this gene originates from a horizontal transfer from a cyanobacterium to an ancestral member of the Leotiomyceta (42% and 41% identity shared by the enzymes from A. niger and A. nidulans, respectively, with nfsA product from Anabaena variabilis; see [80] for a comparison of fungal and bacterial nitroreductases). Its incorporation within the hxn cluster of some aspergilli is quite intriguing. It may be relevant that many nitroreductases are involved in the degradation of N-heterocyclic compounds [81]. We have only presented a detailed phylogenetic analysis for HxA/HxnS, but work to be detailed elsewhere (E Bokor, ´ mon, C Scazzocchio and Z Hamari, unpubM Flipphi, J A lished results) suggests that, with the one exception mentioned, all genes in the hxn cluster have originated from duplications within the Pezizomycotina, and that clustering followed or was synchronous with duplication. Similar evolutionary patterns for the clusters were described in fungi. A pattern of gene duplication and clustering underlies the origin and variable arrangement of the alc (ethanol utilization) gene cluster in the aspergilli [82]. These patterns of gene clustering resemble those described in plants, where genes organized in clusters involved in secondary metabolism originate from duplication of non-clustered genes of primary metabolism ([83 –85] and references therein).


to speculate that it originated from a duplication of the possibly essential ancestral orthologue of AN6733, the duplicated gene being then recruited into the nicotinate utilization pathway. The apparent high frequency of constitutive, gain-of-function mutations, and their mapping indicate that the HxnR protein is, in the absence of inducer, in a default state noncompetent to elicit transcription, and that the domains where constitutive mutations map are instrumental in maintaining HxnR in this ‘closed’, inactive state. The aminoterminal cluster of constitutive mutations maps outside the PF04082 domain, in sequences that are conserved only among HxnR orthologues. The carboxy-terminal mutations map within the PF04082 domain conserved in Klf1, AN6733 and NCU05242 (the N. crassa orthologue of AN6733). Note, for example, mutations affecting Lys603 in HxnR, a residue conserved in these four proteins (figure 5; electronic supplementary material, figure S4). The PF04082 domain of Gal4p (244– 537) coincides with the central regulatory domain of similarity proposed by Poch [73]; see also Stone & Sadowski [74]. The cognate domain of the A. nidulans NirA ( pathway-specific regulation of nitrate assimilation) spans residues 230 –487 [75]. Within this region maps a cryo-sensitive, non-inducible mutation (Arg347Ser) as well as its intragenic suppressors, some of which result in constitutivity. This domain possibly interacts with both the NES and the C-terminal transcription activation domain [75]. The evidence from different systems indicates that PF04082 is an intramolecular interaction domain. Thus, the proposed neo-functionalization of HxnR would have involved the modification of the sequence between residues 208 and 239 (electronic supplementary material, figure S4), as a module interacting with PF04082.


For UV mutagenesis, 109 conidia of A. nidulans strains HZS.98, HZS.248 and HZS.418 in 20 ml 0.01% Tween (in a Petri dish with a 14.5 cm diameter) were exposed to UV light (Philips TUV15 W 9L1, 254 nm) with gentle shaking (50 r.p.m.) for 20 min, resulting in 95% kill. For 4-nitroquinoline 1-oxide (4-NQO) mutagenesis, conidia of HZS.248 were mutagenized as previously described [87]. Spores were plated on MM with hypoxanthine as the sole nitrogen source supplemented with 5.5 mM allopurinol and 12.5 mM cesium chloride. Strains able to grow on this medium were expected to be hxnR constitutive (hxnRc) mutants. The presence of allopurinol resulted in the complete inhibition of purine hydroxylase I (encoded by hxA) in a recipient hxAþ strain (HZS.98), therefore the hypoxanthine utilization must result from the activity of purine hydroxylase II (encoded by hxnS), which requires either induction by nicotinate or 6-OH nicotinate or the presence of a constitutive mutation in the hxnR gene. In the hxAþ strain HZS.98, gain-of-function allopurinol-resistant mutations at the hxA locus also may occur. The hxnRþ hxA-linked allopurinol-resistant mutants, however, show reduced growth on hypoxanthine compared to hxAþ hxnRc mutants [1,29].

4.3. Staining for enzyme activity in gels Crude protein samples of mycelia were obtained from 300 ml liquid cultures incubated at 378C with 180 r.p.m. agitation for 20 h, and induced after 15 h of growth with inducers where

4.4. DNA and RNA manipulations Total DNA was prepared from A. nidulans as described by Specht et al. [92]. For Southern blots [93] hybond-N membranes (Amersham/GE Healthcare) were used and hybridizations were done by DIG DNA Labeling and Detection Kit (Roche) according to the manufacturer’s instructions. Transformations of A. nidulans protoplasts were done as described by Karacsony et al. [88] using a 4% solution of Glucanex (Novozymes, Switzerland) in 0.7 M KCl. For cloning procedures, Escherichia coli JM109 [94] and KS272 [95] were used and transformation of Es. coli was performed according to Hanahan [96]. Plasmid extraction from Es. coli and other DNA manipulations were done as described by Sambrook et al. [93]. Total RNA was isolated using a NucleoSpin RNA Plant Kit (Macherey-Nagel) and RNase-Free DNase (Qiagen) according to the manufacturer’s instructions. cDNA synthesis was carried out with a mixture of oligo-dT and random primers using a RevertAid First Strand cDNA Synthesis Kit (Fermentas). Quantitative PCR (qPCR) and quantitative RT-PCR (qRT-PCR) were carried out in a CFX96 Real Time PCR System (BioRad) with SYBR Green/ Fluorescein qPCR Master Mix (Fermentas) reaction mixture (948C 3 min followed by 40 cycles of 948C 15 s and 608C 1 min). Specific primers are listed in the electronic supplementary material, table S6. Data processing was done by the standard curve method [97]. Northern blot analysis was performed using the glyoxal method [93]. In northern blots, equal RNA loading was calculated by optical density measurements (260/280 nm). [32P]-dCTP labelled genespecific DNA molecules were used as gene probes using the random hexanucleotide-primer kit following the supplier’s instructions (Roche Applied Science). DNA sequencing was done by the Sanger sequencing service of LGC (http:// www.lgcgroup.com). Primers used are listed in the electronic supplementary material, table S6.

4.5. Gene deletions Deletion of hxnR and hxnS was obtained by Chaveroce’s method [95], which uses phage l Red expressing Es. coli strain KS272 for obtaining the gene replacement by introducing a plasmid carrying the candidate gene and a PCR product of a transformation marker gene flanked with 50 bp regions of homology with the target DNA into the Es. coli strain (for details see the electronic supplementary material, Supplementary materials and methods). The obtained recombinant plasmid is then used for A. nidulans transformation in order to obtain an allelic exchange between the mutant allele on the plasmid and the wild-type locus. The detailed procedure is written in the electronic supplementary

13


4.2. Mutagenesis

appropriate. Protein extraction was carried out as previously described [88]. The concentrations of crude protein samples were determined by the Bradford assay [89]. Native 10% PAGE using 0.025 M Tris, 0.19 M glycine cathode buffer (pH 8.3) according to Laemmli [90] was used to fractionate the crude extracts, containing 50 mg of protein/well. HxAand HxnS-specific activities were detected by staining with hypoxanthine-tetrazolium [1], nicotinate-tetrazolium (100 mM pyrophosphate (pH 9.4), 1.27 mg ml21 iodonitrotetrazolium chloride and 0.5 mg ml21 nicotinic acid), while the diaphorase activity was detected with NADH-tetrazolium [16,91].


minimal media (MM) contained glucose as the carbon source; MMs supplemented with different N-sources were used [13,86]. The media were supplemented according to the requirements of each auxotrophic strain (www.fgsc.net). Nitrogen sources, inducers, repressors and inhibitors were used at the following concentrations: 10 mM sodium nitrate, 10 mM nicotinate (1 : 100 dilution from 1 M nicotinic acid dissolved in 1 M sodium hydroxide), 10 mM 6-OH nicotinic acid (1 : 100 dilution from 1 M 6-OH nicotinic acid dissolved in 1 M sodium hydroxide), 10 mM 2,5-dihydroxypyridine, 1 mM hypoxanthine, 5 mM L-(þ)diammonium-tartrate, 5 mM urea, 1 mM acetamide as sole N-sources; 1 mM or 100 mM nicotinic acid sodium salt, 1 mM or 100 mM 6-OH nicotinic acid, 100 mM 2,5-dihydroxypyridine and 0.6 mM uric acid as inducers; 5 mM L-(þ)diammonium-tartrate as repressor; 5.5 mM allopurinol as inhibitor of purine hydroxylase I (encoded by hxA) enzyme activity. Cesium chloride at a 12.5 mM final concentration was used in mutagenesis experiments to reduce the background growth of the nitrogen-source non-utilizer strains (http://www.fgsc.net/Aspergillus/gene_list/supplement.html# other). The strains were maintained on CM; otherwise MM with various N-sources were used in the experiments supplemented with the required vitamins. The mycelia for protein extraction were grown for 14 h at 378C shaken at 150 r.p.m. in MM with acetamide or urea as nitrogen sources and induced when appropriate after 12 h of growth with 6-OH nicotinate. For mRNA extraction, mycelia was grown on acetamide, or urea N-sources were used for growth for 10 h at 378C with 150 r.p.m. and after 8 h of growth, nicotinic acid, 6-OH nicotinic acid or uric acid was added to the medium as inducer and ammonium as repressor. For total DNA extraction, mycelia were grown in MM with nitrate as a N-source.


4.7. Statistical analysis The significance of differences between datasets was determined by an unpaired t-test using the GraphPad PRISM 6 software. Data accessibility. The datasets supporting this article are included in the

Sequence searches were carried out in both general (http:// blast.ncbi.nlm.nih.gov/Blast.cgi) and specialized databases (http://www.aspgd.org/, http://genome.jgi-psf.org/programs/fungi/index.jsf ). We used (with permission) 59 unpublished DNA sequences from the JGI databases; the species involved are tagged with ‘*’ in the electronic supplementary material, tables S1 and S3 (see the electronic supplementary material, table S1 footnote for further details). In every case, the gene models were manually derived by ourselves. Alignments were carried out with MAFFT (MAFFT E-INS-i and MAFFT G-INS-i); colour labelling of alignments was done with BOXSHADE (http://www.ch. embnet.org/software/BOX_form.html). Alignment curation for phylogeny was carried out with BMGE 1.0 (http:// mobyle.pasteur.fr/cgi-bin/portal.py#forms::BMGE) [99] and maximum-likelihood phylogeny with PHYML 3.0 with automatic model selection (LG substitution model selected) [100,101] indicating approximate likelihood ratio tests [102]. Tree drawing was done with FIGTREE (http://tree.bio.ed.ac. uk/software/figtree/, http://mafft.cbrc.jp/alignment/ server/) and localization signals were searched for at http://www.cbs.dtu.dk/services/TargetP/ [103], http:// www.peroxisomedb.org/ [104], http://nls-mapper.iab.keio. ac.jp/cgi-bin/NLS_Mapper_form.cgi [105], http://wolfpsort. org/ [106], http://genome.unmc.edu/ngLOC/cite.html [107]. Structural analysis and modelling was carried out with SWISS-PDBVIEWER [108] and I-TASSER, (http://zhanglab.

paper and detailed in the electronic supplementary material tables. Sequences determined by us are available on GenBank (KY962010, KX585438, KX669266). Authors’ contributions. Z.H. and C.S. conceived the project. J.M.K. and C.S. did the early genetic work. Z.H., J.A., R.F.-M., E.B. and A.C. carried out the molecular laboratory work. C.S. and M.F. did the phylogenetic analysis. Z.H., C.S. and M.F. wrote the manuscript. All the authors analysed the results and gave their final approval for publication.

Competing interests. We have no competing interests. Funding. Work at Szeged was supported by the Hungarian National Office for Research and Technology (OTKA-K 101218), the Hungarian National Research, Development and Innovation Office (NKFIK16 119516) and by the project GINOP-2.3.2-15-2016-00012. Work at Colchester was supported by the Science Research Council; work at Orsay was supported by the European Union HPRN-CT-199900084 (XONET), which also provided a studentship to A.C. and a fellowship to R.F.-M.; and Z.H. R.F.-M. and Z.H. at Orsay were supported by a Marie Curie Fellowship of the European Union (MCFI-2001-01084 and QLK4-CT-2002-51496). Acknowledgements. C.S. thanks Ce´sar Millan-Pacheco for insights on the use of VMD. JGI sequences used in the construction of the phylogenetic tree and the Consurf alignment were from the US Department of Energy Joint Genome Institute (http://www.jgi.doe.gov/) in collaboration with the user community. We thank I. V. Grigoriev, F. Martin and J. Spatafora for permitting the use of genome sequences included in the 1000 Fungal Genomes project, the Metagenomics of soil fungi and the Mycorrhizal Initiatives. We thank J. Spatafora, F. Lutzoni, K. H. Wolfe, L. Connell, D. Armaleo, P. Dyer, S. Goodwin, A. Tsang, D. L. Nuss and A. Grum Grzhimaylo for allowing access to the genomes of some individual species prior to publication.

References 1.

2.

3.

4.

Scazzocchio C, Holl FB, Foguelman AI. 1973 The genetic control of molybdoflavoproteins in Aspergillus nidulans. Allopurinol-resistant mutants constitutive for xanthine-dehydrogenase. Eur. J. Biochem. 36, 428 –445. (doi:10.1111/j.14321033.1973.tb02928.x) Scazzocchio C. 1980 The genetics of the molybdenum containing enzymes. In Molybdenum and molybdenum-containing enzymes (ed. MP Coughlan), pp. 487–515. Oxford, UK: Pergamon Press. Scazzocchio C. 1994 The purine degradation pathway, genetics, biochemistry and regulation. Prog. Ind. Microbiol. 29, 221–257. Pateman JA, Cove DJ, Rever BM, Roberts DB. 1964 A common co-factor for nitrate reductase and xanthine dehydrogenase which also regulates the synthesis of nitrate reductase. Nature 201, 58– 60. (doi:10.1038/201058a0)

5.

6.

7.

Schwarz G, Mendel RR, Ribbe MW. 2009 Molybdenum cofactors, enzymes and pathways. Nature 460, 839–847. (doi:10.1038/nature08302) Amrani L, Primus J, Glatigny A, Arcangeli L, Scazzocchio C, Finnerty V. 2000 Comparison of the sequences of the Aspergillus nidulans hxB and Drosophila melanogaster ma-l genes with nifS from Azotobacter vinelandii suggests a mechanism for the insertion of the terminal sulphur atom in the molybdopterin cofactor. Mol. Microbiol. 38, 114 – 125. (doi:10.1046/j.1365-2958.2000. 02119.x) Lewis NJ, Hurt P, Sealy-Lewis HM, Scazzocchio C. 1978 The genetic control of the molybdoflavoproteins in Aspergillus nidulans. IV. A comparison between purine hydroxylase I and II. Eur. J. Biochem. 91, 311–316. (doi:10.1111/j.14321033.1978.tb20967.x)

8.

Mehra RK, Coughlan MP. 1989 Characterization of purine hydroxylase I from Aspergillus nidulans. J. Gen. Microbiol. 135, 273–278. (doi:10.1099/ 00221287-135-2-273) 9. Glatigny A, Scazzocchio C. 1995 Cloning and molecular characterization of hxA, the gene coding for the xanthine dehydrogenase ( purine hydroxylase I) of Aspergillus nidulans. J. Biol. Chem. 270, 3534– 3550. (doi:10.1074/jbc.270.8.3534) 10. Coughlan MP, Mehra RK, Barber MJ, Siegel LM. 1984 Optical and electron paramagnetic resonance spectroscopic studies on purine hydroxylase II from Aspergillus nidulans. Arch. Biochem. Biophys. 229, 596–603. (doi:10.1016/0003-9861(84)90192-9) 11. Mehra RK, Coughlan MP. 1984 Purification and properties of purine hydroxylase II from Aspergillus nidulans. Arch. Biochem. Biophys. 229, 585– 595. (doi:10.1016/0003-9861(84)90191-7)

14


4.6. In silico analysis

ccmb.med.umich.edu/I-TASSER/ [109,110], and model rendering with VMD 1.9. (http://www.ks.uiuc.edu/Research/ vmd/) [111]. Structure superposition was done with the MultiSeq version integrated in VMD [112].


material, Supplementary materials and methods. The first available hxnSD strain (HZS.106 and its progeny HZS.254 used in the enzyme assays) was unfortunately found to carry additional ectopic copies of the recombinant plasmid, therefore a new hxnSD strain (HZS.599) was obtained by the gene substitution method using the double-joint PCR [98] for constructing the gene substitution cassette (see electronic supplementary material, Supplementary materials and methods). All the genetic work and growth tests were done with the new hxnSD strain.


24.

25.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

hypoxanthine to uric acid. J. Biol. Chem. 285, 28 044 –28 053. (doi:10.1074/jbc.M110.128561) Kozak M. 1978 How do eucaryotic ribosomes select initiation regions in messenger RNA? Cell 15, 1109– 1123. (doi:10.1016/0092-8674(78)90039-9) Scazzocchio C, Darlington AJ. 1968 The induction and repression of the enzymes of purine breakdown in Aspergillus nidulans. Biochim. Biophys. Acta 166, 557–568. (doi:10.1016/0005-2787(68)90243-8) Andreesen JR, Fetzner S. 2002 The molybdenumcontaining hydroxylases of nicotinate, isonicotinate, and nicotine. Met. Ions Biol. Syst. 39, 405–430. Jimenez JI, Canales A, Jimenez-Barbero J, Ginalski K, Rychlewski L, Garcia JL, Diaz E. 2008 Deciphering the genetic determinants for aerobic nicotinic acid degradation: the nic cluster from Pseudomonas putida KT2440. Proc. Natl Acad. Sci. USA 105, 11 329 –11 334. (doi:10.1073/pnas.0802273105) Amrani L, Cecchetto G, Scazzocchio C, Glatigny A. 1999 The hxB gene, necessary for the posttranslational activation of purine hydroxylases in Aspergillus nidulans, is independently controlled by the purine utilization and the nicotinate utilization transcriptional activating systems. Mol. Microbiol. 31, 1065 –1073. (doi:10.1046/j.1365-2958.1999. 01242.x) Sibthorp C, Wu H, Cowley G, Wong PW, Palaima P, Morozov IY, Weedall GD, Caddick MX. 2013 Transcriptome analysis of the filamentous fungus Aspergillus nidulans directed to the global identification of promoters. BMC Genomics 14, 847. (doi:10.1186/1471-2164-14-847) Arst Jr HN, Cove DJ. 1973 Nitrogen metabolite repression in Aspergillus nidulans. Mol. Gen. Genet. 126, 111–141. (doi:10.1007/BF00330988) Wilson RA, Arst Jr HN. 1998 Mutational analysis of AREA, a transcriptional activator mediating nitrogen metabolite repression in Aspergillus nidulans and a member of the ‘streetwise’ GATA family of transcription factors. Microbiol. Mol. Biol. Rev. 62, 586–596. Scazzocchio C. 2000 The fungal GATA factors. Curr. Opin. Microbiol. 3, 126–131. (doi:10.1016/S13695274(00)00063-1) Platt A, Langdon T, Arst Jr HN, Kirk D, Tollervey D, Sanchez JM, Caddick MX. 1996 Nitrogen metabolite signalling involves the C-terminus and the GATA domain of the Aspergillus transcription factor AREA and the 30 untranslated region of its mRNA. EMBO J. 15, 2791–2801. Cohen BL. 1973 Regulation of intracellular and extracellular neutral and alkaline proteases in Aspergillus nidulans. J. Gen. Microbiol. 79, 311–320. (doi:10.1099/00221287-79-2-311) Platt A, Ravagnani A, Arst Jr H, Kirk D, Langdon T, Caddick MX. 1996 Mutational analysis of the Cterminal region of AREA, the transcription factor mediating nitrogen metabolite repression in Aspergillus nidulans. Mol. Gen. Genet. 250, 106 – 114. Punt PJ, Strauss J, Smit R, Kinghorn JR, van den Hondel CA, Scazzocchio C. 1995 The intergenic region between the divergently transcribed niiA and

15


26.

annotations. Nucleic Acids Res. 42, D705 –D710. (doi:10.1093/nar/gkt1029) Enroth C, Eger BT, Okamoto K, Nishino T, Pai EF. 2000 Crystal structures of bovine milk xanthine dehydrogenase and xanthine oxidase: structurebased mechanism of conversion. Proc. Natl Acad. Sci. USA 97, 10 723 –10 728. (doi:10.1073/pnas.97. 20.10723) Hille R. 2005 Molybdenum-containing hydroxylases. Arch. Biochem. Biophys. 433, 107–116. (doi:10. 1016/j.abb.2004.08.012) Ishikita H, Eger BT, Okamoto K, Nishino T, Pai EF. 2012 Protein conformational gating of enzymatic activity in xanthine oxidoreductase. J. Am. Chem. Soc. 134, 999 –1009. (doi:10.1021/ja207173p) Okamoto K, Kusano T, Nishino T. 2013 Chemical nature and reaction mechanisms of the molybdenum cofactor of xanthine oxidoreductase. Curr. Pharm. Des. 19, 2606 –2614. (doi:10.2174/ 1381612811319140010) Coelho C, Mahro M, Trincao J, Carvalho AT, Ramos MJ, Terao M, Garattini E, Leimkuhler S, Romao MJ. 2012 The first mammalian aldehyde oxidase crystal structure: insights into substrate specificity. J. Biol. Chem. 287, 40 690–40 702. (doi:10.1074/jbc.M112. 390419) Glatigny A, Hof P, Romao MJ, Huber R, Scazzocchio C. 1998 Altered specificity mutations define residues essential for substrate positioning in xanthine dehydrogenase. J. Mol. Biol. 278, 431 –438. (doi:10.1006/jmbi.1998.1707) Garattini E, Fratelli M, Terao M. 2008 Mammalian aldehyde oxidases: genetics, evolution and biochemistry. Cell Mol. Life Sci. 65, 1019–1048. (doi:10.1007/s00018-007-7398-y) Mahro M, Bras NF, Cerqueira NM, Teutloff C, Coelho C, Romao MJ, Leimkuhler S. 2013 Identification of crucial amino acids in mouse aldehyde oxidase 3 that determine substrate specificity. PLoS ONE 8, e82285. (doi:10.1371/journal.pone.0082285) Truglio JJ, Theis K, Leimkuhler S, Rappa R, Rajagopalan KV, Kisker C. 2002 Crystal structures of the active and alloxanthine-inhibited forms of xanthine dehydrogenase from Rhodobacter capsulatus. Structure 10, 115–125. (doi:10.1016/ S0969-2126(01)00697-9) Nishino T, Okamoto K, Pai EF. 2001 High-resolution structure of bovine milk xanthine oxidoreductase and inhibitor complex. Spring-8 Res. Front. 27, 11 –13. Dietzel U, Kuper J, Doebbler JA, Schulte A, Truglio JJ, Leimkuhler S, Kisker C. 2009 Mechanism of substrate and inhibitor binding of Rhodobacter capsulatus xanthine dehydrogenase. J. Biol. Chem. 284, 8768 – 8776. (doi:10.1074/jbc. M808114200) Cao H, Pauff JM, Hille R. 2014 X-ray crystal structure of a xanthine oxidase complex with the flavonoid inhibitor quercetin. J. Nat. Prod. 77, 1693–1699. (doi:10.1021/np500320g) Cao H, Pauff JM, Hille R. 2010 Substrate orientation and catalytic specificity in the action of xanthine oxidase: the sequential hydroxylation of


12. Sealy-Lewis HM, Lycan D, Scazzocchio C. 1979 Product induction of purine hydroxylase II in Asperigillus nidulans. Mol. Gen. Genet. 174, 105– 106. (doi:10.1007/BF00433311) 13. Scazzocchio C, Sdrin N, Ong G. 1982 Positive regulation in a eukaryote, a study of the uaY gene of Aspergillus nidulans: I. Characterization of alleles, dominance and complementation studies, and a fine structure map of the uaY–oxpA cluster. Genetics 100, 185–208. 14. Suarez T, de Queiroz MV, Oestreicher N, Scazzocchio C. 1995 The sequence and binding specificity of UaY, the specific regulator of the purine utilization pathway in Aspergillus nidulans, suggest an evolutionary relationship with the PPR1 protein of Saccharomyces cerevisiae. EMBO J. 14, 1453 –1467. 15. Galanopoulou K et al. 2014 Purine utilization proteins in the Eurotiales: cellular compartmentalization, phylogenetic conservation and divergence. Fungal Genet. Biol. 69, 96 –108. (doi:10.1016/j.fgb.2014.06.005) 16. Scazzocchio C. 1973 The genetic control of molybdoflavoproteins in Aspergillus nidulans. II. Use of NADH dehydrogenase activity associated with xanthine dehydrogenase to investigate substrate and product inductions. Mol. Gen. Genet. 125, 147 – 155. (doi:10.1007/ BF00268868) 17. Darlington AJ. 1966 Genetic and biochemical studies of purine breakdown in Aspergillus. Cambridge, UK: University of Cambridge. 18. Sealy-Lewis HM, Scazzocchio C, Lee S. 1978 A mutation defective in the xanthine alternative pathway of Aspergillus nidulans: its use to investigate the specificity of uaY mediated induction. Mol. Gen. Genet. 164, 303–308. (doi:10. 1007/BF00333161) 19. Cultrone A, Scazzocchio C, Rochet M, MonteroMoran G, Drevet C, Fernandez-Martin R. 2005 Convergent evolution of hydroxylation mechanisms in the fungal kingdom: molybdenum cofactorindependent hydroxylation of xanthine via alphaketoglutarate-dependent dioxygenases. Mol. Microbiol. 57, 276 –290. (doi:10.1111/j.1365-2958. 2005.04686.x) 20. Montero-Moran GM, Li M, Rendon-Huerta E, Jourdan F, Lowe DJ, Stumpff-Kane AW, Feig M, Scazzocchio C, Hausinger RP. 2007 Purification and characterization of the FeII- and alphaketoglutarate-dependent xanthine hydroxylase from Aspergillus nidulans. Biochemistry 46, 5293 –5304. (doi:10.1021/bi700065h) 21. Gournas C, Oestreicher N, Amillis S, Diallinas G, Scazzocchio C. 2011 Completing the purine utilisation pathway of Aspergillus nidulans. Fungal Genet. Biol. 48, 840– 848. (doi:10.1016/j.fgb.2011. 03.004) 22. Hanselman F. 1985 Studies on the expression of the purine hydroxylase genes of Aspergillus nidulans. PhD thesis, University of Essex, Essex. 23. Cerqueira GC et al. 2014 The Aspergillus Genome Database: multispecies curation and incorporation of RNA-Seq data to improve structural gene


51.

53.

54.

55.

56.

57.

58.

59.

60.

74. Stone G, Sadowski I. 1993 GAL4 is regulated by a glucose-responsive functional domain. EMBO J. 12, 1375– 1385. 75. Gallmetzer A et al. 2015 Reversible oxidation of a conserved methionine in the nuclear export sequence determines subcellular distribution and activity of the fungal nitrate regulator NirA. PLoS Genet. 11, e1005297. (doi:10.1371/journal.pgen. 1005297) 76. McGary KL, Slot JC, Rokas A. 2013 Physical linkage of metabolic genes in fungi is an adaptation against the accumulation of toxic intermediate compounds. Proc. Natl Acad. Sci. USA 110, 11 481–11 486. (doi:10.1073/pnas.1304461110) 77. Scazzocchio C. 2014 Fungal biology in the postgenomic era. Fungal Biol. Biotechnol. 1, 7–24. (doi:10.1186/s40694-014-0007-6) 78. Wisecaver JH, Slot JC, Rokas A. 2014 The evolution of fungal metabolic pathways. PLoS Genet. 10, e1004816. (doi:10.1371/journal.pgen.1004816) 79. Slot JC, Hibbett DS. 2007 Horizontal transfer of a nitrate assimilation gene cluster and ecological transitions in fungi: a phylogenetic study. PLoS ONE 2, e1097. (doi:10.1371/journal.pone.0001097) 80. de Oliveira IM, Henriques JA, Bonatto D. 2007 In silico identification of a new group of specific bacterial and fungal nitroreductases-like proteins. Biochem. Biophys. Res. Commun. 355, 919–925. (doi:10.1016/j.bbrc.2007.02.049) 81. Roldan MD, Perez-Reinado E, Castillo F, MorenoVivian C. 2008 Reduction of polynitroaromatic compounds: the bacterial nitroreductases. FEMS Microbiol. Rev. 32, 474–500. (doi:10.1111/j.15746976.2008.00107.x) 82. Flipphi M, Sun J, Robellet X, Karaffa L, Fekete E, Zeng AP, Kubicek CP. 2009 Biodiversity and evolution of primary carbon metabolism in Aspergillus nidulans and other Aspergillus spp. Fungal Genet. Biol. 46(Suppl 1), S19– S44. (doi:10. 1016/j.fgb.2008.07.018) 83. Boycheva S, Daviet L, Wolfender JL, Fitzpatrick TB. 2014 The rise of operon-like gene clusters in plants. Trends Plant Sci. 19, 447 –459. (doi:10.1016/j. tplants.2014.01.013) 84. Mugford ST et al. 2013 Modularity of plant metabolic gene clusters: a trio of linked genes that are collectively required for acylation of triterpenes in oat. Plant Cell 25, 1078– 1092. (doi:10.1105/tpc. 113.110551) 85. Nutzmann HW, Osbourn A. 2014 Gene clustering in plant specialized metabolism. Curr. Opin. Biotechnol. 26, 91 – 99. (doi:10.1016/j.copbio.2013.10.009) 86. Cove DJ. 1966 The induction and repression of nitrate reductase in the fungus Aspergillus nidulans. Biochim. Biophys. Acta 113, 51 –56. (doi:10.1016/ S0926-6593(66)80120-0) 87. Bal J, Kajtaniak EMJPN. 1977 4-Nitroquinoline-1oxide: a good mutagen for Aspergillus nidulans. Mutat. Res. Fundam. Mol. Mech. Mut. 56, 153 –156. (doi:10.1016/0027-5107(77)90203-2) 88. Karacsony Z, Gacser A, Vagvolgyi C, Scazzocchio C, Hamari Z. 2014 A dually located multi-HMG-box protein of Aspergillus nidulans has a crucial role in

16


52.

61. Komoto N, Yukuhiro K, Tamura T. 1999 Structure and expression of tandemly duplicated xanthine dehydrogenase genes of the silkworm (Bombyx mori). Insect. Mol. Biol. 8, 73 –83. (doi:10.1046/j. 1365-2583.1999.810073.x) 62. Kurosaki M, Bolis M, Fratelli M, Barzago MM, Pattini L, Perretta G, Terao M, Garattini E. 2013 Structure and evolution of vertebrate aldehyde oxidases: from gene duplication to gene suppression. Cell Mol. Life Sci. 70, 1807–1830. (doi:10.1007/s00018-012-1229-5) 63. Terao M, Kurosaki M, Demontis S, Zanotta S, Garattini E. 1998 Isolation and characterization of the human aldehyde oxidase gene: conservation of intron/exon boundaries with the xanthine oxidoreductase gene indicates a common origin. Biochem. J. 332, 383–393. (doi:10.1042/ bj3320383) 64. Lucking R, Huhndorf S, Pfister DH, Plata ER, Lumbsch HT. 2009 Fungi evolved right on track. Mycologia 101, 810–822. (doi:10.3852/09-016) 65. Stajich JE, Berbee ML, Blackwell M, Hibbett DS, James TY, Spatafora JW, Taylor JW. 2009 The fungi. Curr. Biol. 19, R840 –R845. (doi:10.1016/j.cub.2009. 07.004) 66. Nagel M, Andreesen JR. 1990 Purification and characterization of the molybdoenzymes nicotinate dehydrogenase and 6-hydroxynicotinate dehydrogenase from Bacillus niacini. Arch. Microbiol. 154, 605 –613. (doi:10.1007/BF00248844) 67. Alhapel A, Darley DJ, Wagener N, Eckel E, Elsner N, Pierik AJ. 2006 Molecular and functional analysis of nicotinate catabolism in Eubacterium barkeri. Proc. Natl Acad. Sci. USA 103, 12 341–12 346. (doi:10. 1073/pnas.0601635103) 68. Wagener N, Pierik AJ, Ibdah A, Hille R, Dobbek H. 2009 The Mo-Se active site of nicotinate dehydrogenase. Proc. Natl Acad. Sci. USA 106, 11 055– 11 060. (doi:10.1073/pnas.0902210106) 69. Schrader T, Rienhofer A, Andreesen JR. 1999 Selenium-containing xanthine dehydrogenase from Eubacterium barkeri. Eur. J. Biochem. 264, 862– 871. (doi:10.1046/j.1432-1327.1999.00678.x) 70. Andrianopoulos A, Brons J, Davis MA, Hynes MJ. 1997 The amdA regulatory gene of Aspergillus nidulans: characterization of gain-of-function mutations and identification of binding sites for the gene product. Fungal Genet. Biol. 21, 50 –63. (doi:10.1006/fgbi.1997.0968) 71. Murphy RL, Andrianopoulos A, Davis MA, Hynes MJ. 1997 Identification of amdX, a new Cys-2-His-2 (C2H2) zinc-finger gene involved in the regulation of the amdS gene of Aspergillus nidulans. Mol. Microbiol. 23, 591–602. (doi:10.1046/j.1365-2958. 1997.d01-1872.x) 72. Shimanuki M, Uehara L, Pluskal T, Yoshida T, Kokubu A, Kawasaki Y, Yanagida M. 2013 Klf1, a C2H2 zinc finger-transcription factor, is required for cell wall maintenance during long-term quiescence in differentiated G0 phase. PLoS ONE 8, e78545. (doi:10.1371/journal.pone.0078545) 73. Poch O. 1997 Conservation of a putative inhibitory domain in the GAL4 family members. Gene 184, 229 –235. (doi:10.1016/S0378-1119(96)00602-6)


50.

niaD genes of Aspergillus nidulans contains multiple NirA binding sites which act bidirectionally. Mol. Cell Biol. 15, 5688 –5699. (doi:10.1128/MCB.15.10. 5688) Cultrone A, Dominguez YR, Drevet C, Scazzocchio C, Fernandez-Martin R. 2007 The tightly regulated promoter of the xanA gene of Aspergillus nidulans is included in a helitron. Mol. Microbiol. 63, 1577– 1587. (doi:10.1111/j.1365-2958.2007.05609.x) Apostolaki A, Erpapazoglou Z, Harispe L, Billini M, Kafasla P, Kizis D, Penalva MA, Scazzocchio C, Sophianopoulou V. 2009 AgtA, the dicarboxylic amino acid transporter of Aspergillus nidulans, is concertedly down-regulated by exquisite sensitivity to nitrogen metabolite repression and ammoniumelicited endocytosis. Eukaryot. Cell 8, 339 –352. (doi:10.1128/EC.00270-08) Abreu C, Sanguinetti M, Amillis S, Ramon A. 2010 UreA, the major urea/Hþ symporter in Aspergillus nidulans. Fungal Genet. Biol. 47, 1023 –1033. (doi:10.1016/j.fgb.2010.07.004) Willeke U, Heeger V, Meise M, Neuhann H, Schindelmeiser I, Vordemfelde K, Barz W. 1979 Mutually exclusive occurrence and metabolism of trigonelline and nicotinic acid arabinoside in plant cell cultures. Phytochemistry 18, 105 –110. (doi:10. 1016/S0031-9422(00)90924-5) Komossa D, Barz W. 1988 Glutaric acid as a catabolite of nicotinic acid in parsley cell suspension cultures. Zeitschrift fu¨r Naturforschung C. 43, 843– 849. (doi:10.1515/znc-1988-11-1209) Ashihara H, Deng WW. 2012 Pyridine metabolism in tea plants: salvage, conjugate formation and catabolism. J. Plant Res. 125, 781 –791. (doi:10. 1007/s10265-012-0490-x) Fetzner S. 2000 Enzymes involved in the aerobic bacterial degradation of N-heteroaromatic compounds: molybdenum hydroxylases and ringopening 2,4-dioxygenases. Naturwissenschaften 87, 59 –69. (doi:10.1007/s001140050011) Kappl R, Sielker S, Ranguelova K, Wegner J, Parschat K, Huttermann J, Fetzner S. 2006 Spectroscopic and biochemical studies on protein variants of quinaldine 4-oxidase: Role of E736 in catalysis and effects of serine ligands on the FeSI and FeSII clusters. Biochemistry 45, 14 853–14 868. (doi:10.1021/bi061185a) Boer DR, Muller A, Fetzner S, Lowe DJ, Romao MJ. 2005 On the purification and preliminary crystallographic analysis of isoquinoline 1oxidoreductase from Brevundimonas diminuta 7. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 61, 137–140. (doi:10.1107/S1744309104032105) Kappl R, Huttermann J, Fetzner S. 2002 The molybdenum-containing hydroxylases of quinoline, isoquinoline, and quinaldine. Met. Ions Biol. Syst. 39, 481–537. Marelja Z, Dambowsky M, Bolis M, Georgiou ML, Garattini E, Missirlis F, Leimkuhler S. 2014 The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities. J. Exp. Biol. 217, 2201 –2211. (doi:10.1242/jeb.102129)


90.

91.

93.

94.

95.

96.

105.

106.

107.

108.

109.

110.

111.

112.

metabolome. Nucleic Acids Res. 38, D800–D805. (doi:10.1093/nar/gkp935) Kosugi S, Hasebe M, Tomita M, Yanagawa H. 2009 Systematic identification of cell cycle-dependent yeast nucleocytoplasmic shuttling proteins by prediction of composite motifs. Proc. Natl Acad. Sci. USA 106, 10 171–10 176. (doi:10.1073/pnas. 0900604106) Horton P, Park KJ, Obayashi T, Fujita N, Harada H, Adams-Collier CJ, Nakai K. 2007 WoLF PSORT: protein localization predictor. Nucleic Acids Res. 35, W585– W587. (doi:10.1093/nar/gkm259) King BR, Guda C. 2007 ngLOC: an n-gram-based Bayesian method for estimating the subcellular proteomes of eukaryotes. Genome Biol. 8, R68. (doi:10.1186/gb-2007-8-5-r68) Guex N, Peitsch MC. 1997 SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18, 2714–2723. (doi:10.1002/elps.1150181505) Zhang Y. 2008 I-TASSER server for protein 3D structure prediction. BMC Bioinformatics 9, 40. (doi:10.1186/1471-2105-9-40) Roy A, Kucukural A, Zhang Y. 2010 I-TASSER: a unified platform for automated protein structure and function prediction. Nat. Protoc. 5, 725 –738. (doi:10.1038/nprot.2010.5) Humphrey W, Dalke A, Schulten K. 1996 VMD: visual molecular dynamics. J. Mol. Graph. 14, 27– 38. (doi:10.1016/0263-7855(96)00018-5) Roberts E, Eargle J, Wright D, Luthey-Schulte Z. 2006 MultiSeq: unifying sequence and structure data for evolutionary analysis. BMC Bioinformatics 7, 382. (doi:10.1186/1471-2105-7-382)

17


92.

97. Larionov A, Krause A, Miller W. 2005 A standard curve based method for relative real time PCR data processing. BMC Bioinformatics 6, 62. (doi:10.1186/ 1471-2105-6-62) 98. Yu JH, Hamari Z, Han KH, Seo JA, Reyes-Dominguez Y, Scazzocchio C. 2004 Double-joint PCR: a PCRbased molecular tool for gene manipulations in filamentous fungi. Fungal Genet. Biol. 41, 973– 981. (doi:10.1016/j.fgb.2004.08.001) 99. Criscuolo A, Gribaldo S. 2010 BMGE (Block Mapping and Gathering with Entropy): a new software for selection of phylogenetic informative regions from multiple sequence alignments. BMC Evol. Biol. 10, 210. (doi:10.1186/1471-2148-10-210) 100. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. 2010 New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321. (doi:10.1093/sysbio/syq010) 101. Dereeper A et al. 2008 Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 36, W465–W469. (doi:10.1093/nar/ gkn180) 102. Anisimova M, Gascuel O. 2006 Approximate likelihood-ratio test for branches: a fast, accurate, and powerful alternative. Syst. Biol. 55, 539–552. (doi:10.1080/10635150600755453) 103. Emanuelsson O, Nielsen H, Brunak S, von Heijne G. 2000 Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300, 1005–1016. (doi:10.1006/jmbi.2000.3903) 104. Schluter A, Real-Chicharro A, Gabaldon T, SanchezJimenez F, Pujol A. 2010 PeroxisomeDB 2.0: an integrative view of the global peroxisomal


89.

conidial and ascospore germination. Mol. Microbiol. 94, 383–402. (doi:10.1111/mmi.12772) Bradford MM. 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248– 254. (doi:10. 1016/0003-2697(76)90527-3) Laemmli UK. 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680– 685. (doi:10.1038/227680a0) Lewis NJ, Scazzocchio C. 1977 The genetic control of molybdoflavoproteins in Aspergillus nidulans. A xanthine dehydrogenase I half-molecule in cnxmutant strains of Aspergillus nidulans. Eur. J. Biochem. 76, 441 –446. (doi:10.1111/j.14321033.1977.tb11613.x) Specht CA, DiRusso CC, Novotny CP, Ullrich RC. 1982 A method for extracting high-molecular-weight deoxyribonucleic acid from fungi. Anal. Biochem. 119, 158–163. (doi:10.1016/0003-2697(82)90680-7) Sambrook J, Fritsch EF, Maniatis T. 1989 Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Yanisch-Perron C, Vieira J, Messing J. 1985 Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103–119. (doi:10.1016/0378-1119(85)90120-9) Chaveroche MK, Ghigo JM, d’Enfert C. 2000 A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res. 28, E97. (doi:10.1093/nar/28.22.e97) Hanahan D. 1983 Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557–580. (doi:10.1016/S0022-2836(83)80284-8)

Figure S1. Phenotypes of hxnS- mutations. (A) HxnS is induced by 6-OH nicotinic acid and its inducibility depends on the HxnR protein. Enzyme activity staining (see Materials and Methods) with hypoxanthine (Hx) and nicotinate (NA) as substrates. The HxnS band has lower mobility than the HxA band and stains with nicotinate as substrate. Growth conditions 'acam' indicates 1 mM acetamide as the sole nitrogen source, strains were grown at 37° C for 15 hours after which they were, where indicated, induced with 6-NA (6-OH nicotinic acid as the sodium salt) and further incubated for 5 hours. 'Urea' indicates growth on 5mM urea, with or without induction with 600 μM uric acid, which induces only HxA (Urea+UA). (B) HxnS enzyme activity of three hxnS mutants: all strains grown under HxnS inducing conditions. Note that hxnS29 retains in vitro activity. (C) Growth phenotypes of hxnS- mutations. (D) Mutational changes of strains used in these experiments. hxnRΔ and hxnSΔ constructions are described in Materials and Methods. hxnS29, hxnS35 and hxnS41 were isolated as described in Scazzocchio et al. [1]. hxnS35 is a five base pair deletion between DNA positions 182 and 185 after the ATG, resulting in stop codon at residue 98, hxnS41 is a double mutant (G3064T plus a deletion of 3066) resulting in a chain termination at residue 1162, while hxnS29 (T3668C) results in a Phe1213Ser change in a conserved region (figure 2). Used strains in Panel A: hxnR+ parental (TN02 A21), hxnR80 (HZS.220), hxnR (HZS.136) and hxnR+ (HZS.145); Panel B: hxnS41 hxA+ (HZS.109), hxnS35 hxA+ (HZS.110), hxnS29 hxA+ (HZS.113), hxnS hxA (HZS.106), hxnS+ hxA (HZS.245) and hxnS hxA+ (HZS.254); Panel C: hxnS29 hxnRc7 (HZS.113), hxnS35 hxnRc7 (HZS.110), hxnS41 hxnRc7 (HZS.109), hxnS+ hxnR (HZS.136), hxnS hxnR+ (HZS.599), hxnS+ hxnR+ (A148) and hxnS+ hxnRc7 (FGSC A872).

Figure S2. Comparison of the modelled substrate binding site of HxA and HxnS with that of the Bos taurus Xanthine dehydrogenase. (A) A comparison of the modelled substrate binding site of HxA with that of the Bos taurus Xanthine dehydrogenase, shown in a complex with the inhibitor oxypurinol ([2] 3BDJ in the PDB database http://www.rcsb.org/pdb/explore.do?structureId=3BDJ). Active site residues of the B. taurus enzyme are shown solid and colour coded, the corresponding residues of HxA are shown in red in CPK format. The residue numbers of the B. taurus enzyme are indicated, and next to it in parenthesis the corresponding residue of HxA. MOCO indicates the Molybdenum co-factor and OXP the oxypurinol molecule. (B) The same comparison as in Panel A with the corresponding residues of modelled HxnS, shown in grey. (C) A superposition of the HxA and the HxnS modelled substrate binding sites, colour coded as in panels A and B. (D) A superposition of substrate binding residues of the B. taurus enzyme with that of HxA (red) and HxnS (grey), only Phe914 (HxA945, HxnS, 968) Phe1009 (HxA1040, HxnS 1064) and Thr 1010 (HxA1041, HxnS1066) are shown in an orientation such as to clearly visualise the

different positioning of Thr residue in relation to oxypurinol in HxA and HxnS. We note in panel A, but more clearly in panel D the changed orientation of Phe1040 of HxA while Phe1064 of HxnS has exactly the same orientation as Phe1009 of the B. taurus enzyme. If this is a genuine difference it cannot affect the specificity or functionality of the enzyme, which is a completely orthodox XDH, with some differences with the B. taurus XDH in the kinetics of allopurinol and oxypurinol inhibition [3, 4]. HxA and HxnS were modelled with I-Tasser (see Materials and Methods), the most probable models were chosen in each case. For HxA Cscore 0.63, Estimated TM-score 0.80±0.09, Estimated RMSD 8.1±4 Å. For HxnS C-score 0.83, Estimated TM-score 0.83±0.08, Estimated RMSD 7.7±4.4 Å. The two modelled proteins and the monomer of the 3BDJ structure were super-imposed with the multi-seq facility included in VMD, which was used to visualise the active site residues (see Materials and Methods).

Figure S3. A Maximum Likelihood rooted tree of all available fungal XDH-like enzymes with Eukaryotic out-groups. High quality readable figure is available as a separate supplementary file uploaded in PDF format. Colour keys for fungal clades, metazoans and Ichthyosporea (Opisthokonta) are those given in figure 4. Archaeplastida and Stramenopiles, including green algae and plants (Viridiplantae), red algae (Rhodophyta), Oomycetes and Diatoms are at the bottom of the tree, indicated with different shades of green. In black with no additional colouring, representative species from other taxa: Thecamonas trahens (Apusozoa, Bikonta), Guillardia theta (Cryptophyta, Chromista), Dictyostelium discoideum (Amoebozoa, Unikonta), Trichomonas vaginalis (Parabasalia, Excavata), Trimastix pyriformis (Metamonada, Excavata). In red lettering we indicate proteins where biochemical work is extant (comprising 3D structural work for Bos taurus XDH). In green lettering we indicate proteins that are in positions that do not correspond to the taxonomically appropriate position of the organism in question. Searches for genes encoding XDH-like proteins were carried out with both HxA and HxnS of A. nidulans as in silico probes. All fungal gene models and proteins were deduced manually. The auto-annotated accession numbers were curated as indicated in Supplementary Table S1 (a considerable number of them are miscalled). The proteins were aligned with MAFFT EINS-i (for sequences with multiple conserved domains and long gaps) with the default parameters. The alignment was curated with BMGE with a Blosum 30 similarity matrix. The Maximum Likelihood phylogeny was carried out with PhyML 3.0 with automatic model selection (LG substitution model selected). Numbers at nodes indicate aLRTs (approximate Likelihood Ratio test values).

Comments on the phylogeny of XDH-like enzymes in the fungi. The putative XDH from Galactomyces (Geotrichum) candidum (http://www.ncbi.nlm.nih.gov/bioproject/247755) clusters, as expected, with other Saccharomycotina. However there is another sequence at the NCBI database of a genome from a different strain of an identically named organism (http://www.ncbi.nlm.nih.gov/bioproject/243259). This strain shows an HxA orthologue clustering with the HxA orthologues of the Leotiomycetes, and an HxnS orthologue in a mixed clade, clustered (alTR 1.00) with the Leotiomycetes Oidiodendron maius, Hymenoscyphus repandus and Glarea lozoyensis (shown in grey). There seem to be no question that these sequences correspond to two different organisms, the former a genuine member of the Saccharomycotina, the latter of the Leotiomycetes. A few other Purine hydroxylase proteins have an unexpected position: three members of the Eurotiales (in green lettering) which include the only Penicillia to have an HxnS orthologue, cluster with the Hypocreales. The proteins of the basal members of the Taphrinomycotina, Saitoella complicata and species of genus Taphrina do not cluster together as would be expected. The Basidiomycota are separated into two discrete clades, one (comprising Ustilago maydis), which appear as an out-group of all the ascomycete sequences and a second, which clusters with the putative orthologues of HxnS. An interesting positioning is that of the Oidiodendron maius (Leotiomycetes, Helotiales) putative XDH. The cognate protein maps within the Pezizomycotina HxnS-like clade. It is one of the two species among all the sequenced Pezizomycotina to have a putative orthologue of HxnS, in the (apparent) absence of an orthologue of HxA. It shows both characteristic sequence insertions in the 2Fe/2S cluster and between the 2Fe/2S domain and the FAD/NAD binding domain. It carries a hydrophobic residue (Val533) where we have Tyr454 and Ile478 in HxA and HxnS, respectively. It has a His (His1124) where HxA has Phe1044 and HxnS has His1069. The ORF is interrupted by four introns, of which the first two are widely conserved among HxnS orthologues, the fourth is conserved in several other HxnS orthologues of the Helotiales, while the third is - within the limits of the genomes available - unique of O. maius. There is no question this protein is phylogenetically related to HxnS rather than to HxA. However, uniquely among all putative HxnS structural orthologues, it does not have the sequence FATALH (HxnS: 1064-1069) in its substrate binding site nor does it have FTALF, near universal among HxA Pezizomycotina orthologues (HxA: 1040-1044) and all biochemically characterised XDHs (with one exception, see below); instead it specifies FGALH, (1120-1124). This sequence change is identical to one occurring in the putative XDH of the four Taphrina species, while the characterised XDH of Blastobotrys (Arxula) adeninivorans [5] has FGATF. Indeed, a Gly residue replaces the Thr in all putative Saccharomycotina HxAs. While no biochemical work is extant in O. maius, we propose that this enzyme is not a Nicotinate hydroxylase but rather a XDH. O. maius has all the enzymes of purine breakdown (summarised in [6]), including an orthologue of UaY, the pathway specific regulatory gene characterised in A. nidulans [6, 7] and N. crassa [8]. On the contrary, it has none of the nicotinate specific clustered genes to be described below. There is no other hxA/hxnS paralogue present in the O. maius genome. A second species has in its genome an HxnS orthologue in the absence of an HxA orthologue. This is Rhytidhysteron rufulum (Dothideomycetes, Hysteriales). At variance with the situation in O. maius, the R. rufulum gene encodes a typical HxnS enzyme, included in a conserved hxn gene cluster. Other independent, probably genus or even species-specific duplications of XDH-like enzymes occurred in non-dikarya (Mortierella alpina, Conidiobolus incongruus, Basidiobolus

meristosporus, Gonapodya prolifera). None of these paralogues carry the diagnostic HxnS sequence FATAL(H). No biochemical work is extant in these fungal species.

Comments on the exon-intron structure of hxnS orthologues. The intron-exon organization is broadly class specific. Eurotiales and Onygenales (Eurotiomycetes) share multiple intron positions with Helotiales (Leotiomycetes) and Xylonomycetaceae (Xylonomycetes), including those of all three A. nidulans introns. Most Eurotiales (see below for outstanding exceptions in the Penicillum genus) have four conserved introns (in A. nidulans the second intron is absent) but only the most 5’ intron is present in species of the early divergent class of Pezizomycetes, whose hxnS genes usually have five introns. Potentially, this is the only intron that survived the re-functionalisation as it is present in the hxA orthologue genes of three of the dozen species of Basidiomycota (Heterobasidion annosum, Microbotryum violaceum, Septobasidium sp. strain PNB30-8B) that occur at the basis of the HxnS branch in the PHI/PHII phylogeny (figure 4 and figure S3). Nevertheless, none of the four hxnS introns conserved in the Eurotiales are present in Pleosporales or Botryosphaeriales (usually two introns, one conserved across these orders of Dothideomycetes), Hypocreales and Glomerellales (both Sordariomycetes, 8 and 9 introns, respectively) and Symbiotaphrina (recently assigned to Xylonomycetes, 3 introns, none corresponding to the 5 occupied intron positions found in Xylonomycetaceae). Intriguing is the exon-intron structure of the hxnS gene in some early divergent species in Penicillium, the sister genus of Aspergillus in the family of the Aspergillaceae. The genome sequences of P. paxilli, P. citrinum and the misnamed species Hymenoscyphus varicosporoides all specify 8 introns at exactly the same positions as those in hxnS genes of the Nectriaceae family, and share none with Aspergillus hxnS (the other sequenced Penicillium species have no hxnS orthologue). This exon-intron structure is completely coherent with the phylogeny of fungal Purine Hydroxylase paralogues (figure S4) that shows that the HxnS orthologues in these Penicillium are directly related to those of Hypocreales (Sordariomycetes) rather than to HxnS proteins from other Eurotiales, while the situation for the HxA orthologues is taxonomically completely orthodox: all Penicillium species (including P. citrinum, P. paxilli) clustered with Eurotiales and none with Sordariomycetes. These circumstantial evidence strongly suggests that these exceptional species of Penicillium have (re-)acquired an hxnS gene from a species of Hypocreales by horizontal gene transfer.

Figure S4. The results of a CONSURF alignment of HxnR with 123 putative orthologues. Alignment by MAFFT using the E-INS-i algorithm. Loss-offunction mutation changes indicated with red triangles, constitutive mutations indicated with green triangles. The 123 orthologue hxnR loci and – when extant – the accession numbers of the corresponding HxnR orthologues are listed in Table S3.

References: 1 Scazzocchio, C., Holl, F. B., Foguelman, A. I. 1973 The genetic control of molybdoflavoproteins in Aspergillus nidulans. Allopurinol-resistant mutants constitutive for xanthine-dehydrogenase. Eur J Biochem. 36, 428-445. 2 Okamoto, K., Eger, B. T., Nishino, T., Pai, E. F. 2008 Mechanism of inhibition of xanthine oxidoreductase by allopurinol: crystal structure of reduced bovine milk xanthine oxidoreductase bound with oxipurinol. Nucleosides Nucleotides Nucleic Acids. 27, 888-893. (10.1080/15257770802146577 794699692 [pii]) 3 Lewis, N. J., Hurt, P., Sealy-Lewis, H. M., Scazzocchio, C. 1978 The genetic control of the molybdoflavoproteins in Aspergillus nidulans. IV. A comparison between purine hydroxylase I and II. Eur J Biochem. 91, 311-316. 4 Mehra, R. K., Coughlan, M. P. 1989 Characterization of purine hydroxylase I from Aspergillus nidulans. J Gen Microbiol. 135, 273-278. (10.1099/00221287-135-2-273) 5 Jankowska, D. A., Trautwein-Schult, A., Cordes, A., Hoferichter, P., Klein, C., Bode, R., Baronian, K., Kunze, G. 2013 Arxula adeninivorans xanthine oxidoreductase and its application in the production of food with low purine content. J Appl Microbiol. 115, 796-807. (10.1111/jam.12284) 6 Galanopoulou, K., Scazzocchio, C., Galinou, M. E., Liu, W., Borbolis, F., Karachaliou, M., Oestreicher, N., Hatzinikolaou, D. G., Diallinas, G., Amillis, S. 2014 Purine utilization proteins in the Eurotiales: cellular compartmentalization, phylogenetic conservation and divergence. Fungal genetics and biology : FG & B. 69, 96-108. (10.1016/j.fgb.2014.06.005 S1087-1845(14)00108-X [pii]) 7 Suarez, T., de Queiroz, M. V., Oestreicher, N., Scazzocchio, C. 1995 The sequence and binding specificity of UaY, the specific regulator of the purine utilization pathway in Aspergillus nidulans, suggest an evolutionary relationship with the PPR1 protein of Saccharomyces cerevisiae. The EMBO journal. 14, 1453-1467. 8 Liu, T. D., Marzluf, G. A. 2004 Characterization of pco-1, a newly identified gene which regulates purine catabolism in Neurospora. Current genetics. 46, 213-227. (10.1007/s00294004-0530-8)

Thecamonas_trahens

0.84

Guillardia_theta Dictyostelium_discoideum

0.78

Saitoella_complicata Ascobolus_immersus Terfezia_boudieri Drechslerella_stenobrocha 1 Arthrobotrys_oligospora Dactylellina_haptotyla

0.62

Patellaria_atrata_1 Hysterium_pulicare_1 Zopfia_rhizophila_1 Sporormia_fimetaria Lophiostoma_macrostomum_1 Melanomma_pulvis_pyrius_1 Pleomassaria_siparia_1 Didymella_exigua_1 Dothidotthia_symphoricarpi_1 Pleosporales_UM_1110_1 Leptosphaeria_maculans_1 Shiraia_Slf14_1 Hymenoscyphus_laetus_1 Phaeosphaeria_nodorum_1_Corr Setosphaeria_turcica_1 Cochliobolus_lunatus_1 Cochliobolus_miyabeanus_1 Cochliobolus_sativus_1 Cochliobolus_heterostrophus_C5_1 Cochliobolus_victoriae_1 Cochliobolus_carbonum_1 Alternaria_brassicicola_1 Alternaria_arborescens_1 Pyrenophora_seminiperda_1 Pyrenophora_teres_1 Pyrenophora_tritici_repentis_1 Pyrenochaeta_UM_256_1 Cucurbitaria_berberidis_1 Helminthosporium_solani_1 Lentithecium_fluviatile_1 Cenococcum_geophilum_1 Lepidopterella_palustris_1 Aulographum_hederae_1 Aplosporella_prunicola_1 Macrophomina_phaseolina_1 Neofusicoccum_parvum_1 Guignardia_citricarpa_1 Cryomyces_antarcticus_Corr Trypethelium_eluteriae Hortaea_werneckii Polychaeton_citri Baudoinia_compniacensis Acidomyces_richmondensis Dissoconium_aciculare Zasmidium_cellare Cercospora_zeae_maydis Mycosphaerella_Ston1 Septoria_musiva Septoria_populicola Mycosphaerella_fijiensis_1 Pseudocercospora_pini_densiflorae_1 Mycosphaerella_laricina Zymoseptoria_passerinii Zymoseptoria_ardabiliae Zymoseptoria_tritici Zymoseptoria_pseudotritici Passalora_fulva Dothistroma_septosporum Myriangium_duriaei Aureobasidium_pullulans_AY4 Aureobasidium_pullulans_subglaciale

0.97 1

0.47

Symbiotaphrina_kochii_1 Trinosporium_guianense_1 Xylona_heveae_1 Xanthoria_parietina Gyalolechia_flavorubescens Lasallia_pustulata Umbilicaria_muehlenbergii Cladonia_grayi Cladonia_metacorallifera Cladonia_macilenta

0.95 0.97 0.81

1

1

Paracoccidioides_brasiliensis_1 Ajellomyces_dermatitidis_1 Ajellomyces_capsulatus_1 Gymnascella_aurantiaca_1 Gymnascella_citrina_1 Uncinocarpus_reesii Coccidioides_immitis Coccidioides_posadasii Arthroderma_otae Arthroderma_gypseum Arthroderma_benhamiae Trichophyton_rubrum Thermoascus_aurantiacus_1 Thermomyces_lanuginosus Talaromyces_stipitatus Talaromyces_marneffei Byssochlamys_spectabilis_1 Aspergillus_aculeatus_1 Aspergillus_carbonarius_1 Aspergillus_brasiliensis_1 Aspergillus_niger_1 Aspergillus_tubingensis_1 Aspergillus_kawachii_1 Aspergillus_foetidus_1 Aspergillus_terreus_1 Aspergillus_sojae Aspergillus_flavus Aspergillus_nidulans_HxA Aspergillus_sydowii_1 Aspergillus_versicolor_1 Aspergillus_clavatus Neosartorya_udagawae_1 Aspergillus_fumigatus Neosartorya_fischeri_1 Aspergillus_wentii Monascus_purpureus_1 Monascus_ruber_1 Aspergillus_glaucus_1 Aspergillus_ruber_1 Aspergillus_zonatus Penicillium_roqueforti Penicillium_chrysogenum Penicillium_digitatum Penicillium_camemberti Penicillium_oxalicum Penicillium_paxilli_1 Hymenoscyphus_varicosporoides_1 Penicillium_citrinum_1 Phaeomoniella_chlamydospora_1 Endocarpon_pusillum Cyphellophora_europaea_1 Herpotrichiellaceae_UM238 Exophiala_dermatitidis Cladophialophora_carrionii

0.83

0.64

1

Eutypa_lata Anthostoma_avocetta Pestalotiopsis_fici Apiospora_montagnei Hypoxylon_CO27_5_1 Hypoxylon_EC38_1 Hypoxylon_CI_4A_1 Daldinia_eschscholzii_1 Podospora_anserina Chaetomium_thermophilum Myceliophthora_thermophila Thielavia_terrestris Chaetomium_globosum Sordaria_macrospora Neurospora_crassa_XDH Neurospora_tetrasperma Ceratocystis_fimbriata Hirsutella_thompsonii Tolypocladium_inflatum Cordyceps_militaris Beauveria_bassiana Periglandula_ipomoeae_Corr Aciculosporium_take_Corr Claviceps_paspali_Corr Claviceps_fusiformis Claviceps_purpurea Neotyphodium_gansuense Epichloe_glyceriae Epichloe_brachyelytri Epichloe_elymi Epichloe_typhina Epichloe_festucae Epichloe_amarillans Metarhizium_acridum Metarhizium_anisopliae Metarhizium_robertsii Trichoderma_reesei_QM6a Trichoderma_longibrachiatum Trichoderma_virens Trichoderma_harzianum Trichoderma_atroviride Trichoderma_asperellum Ilyonectria_sp Nectria_haematococca_1 Fusarium_acuminatum Fusarium_fujikuroi_1 Fusarium_circinata_1 Fusarium_oxysporum_lycopersici_1 Fusarium_oxysporum_Fo5176_1 Fusarium_equiseti Fusarium_pseudograminearum Fusarium_graminearum Acremonium_alcalophilum Sodiomyces_alkalinus Verticillium_albo_atrum Colletotrichum_gloeosporioides_1 Colletotrichum_orbiculare Glomerella_graminicola Colletotrichum_fiorinae Colletotrichum_higginsianum_Corr Grosmannia_clavigera Sporothrix_schenckii Ophiostoma_novo_ulmi Ophiostoma_piceae Magnaporthe_oryzae Gaeumannomyces_graminis_Corr Togninia_minima_1 Cryphonectria_parasitica Diaporthe_longicolla_1

0.76

0.58

1

0.99

0.14

Geotrichum_candidum_3C_1 Blumeria_graminis_hordei Blumeria_graminis_tritici Rutstroemia_echinophila_1 Rutstroemia_firma_1 Sclerotinia_sclerotiorum_1_Corr Botrytis_cinerea_1 Botrytis_paeoniae_1 Sclerotinia_borealis_1 Ciborinia_camelliae_1 Amorphotheca_resinae Ascocoryne_sarcoides Glarea_lozoyensis_1 Hymenoscyphus_fraxineus Hymenoscyphus_infarciens Calycina_herbarum Hymenoscyphus_fructigenus Hymenoscyphus_salicellus_Corr Hymenoscyphus_scutula Hymenoscyphus_repandus_1 Marssonina_brunnea Cadophora_sp_DSE1049_1 Meliniomyces_bicolor_1 Rhizoscyphus_ericae_1 Chalara_longipes_1 Meliniomyces_variabilis_1 Loramyces_juncicola Fungal_sp_EF0021_1 Phialocephala_scopiformis_1 Acephala_macrosclerotiorum_1 Thelebolus_microsporus Geomyces_pannorum Geomyces_destructans

0.88

0.36

Sarcoscypha_coccinea_1 Ascodesmis_nigricans Pyronema_omphalodes Wilcoxina_mikolae Morchella_conica_1 Morchella_importuna_1 Tuber_melanosporum_1 Choiromyces_venosus_1

0.92

Candida_caseinolytica Starmerella_bombicola Candida_apicola Galactomyces_candidum Blastobotrys_adeninovorans_XDH Babjeviella_inositovora Pichia_pastoris Candida_boidinii Candida_arabinofermentans Brettanomyces_bruxellensis Brettanomyces_anomalus_Corr Kuraishia_capsulata

1

1

Taphrina_populina Taphrina_wiesneri Taphrina_flavorubra Taphrina_deformans_Corr

1

Chionosphaera_apobasidialis Basidioascus_undulatus_Part (Geminibasidiomycetes) Termitomyces_sp_J132_Part (Agaricomycetes) Microbotryum_violaceum Rhodotorula_mucilaginosa Rhodosporidium_toruloides Rhodotorula_glutinis Sporobolomyces_roseus Sporidiobolus_salmonicolor Septobasidium_sp_PNB30_8B Heterobasidion_annosum (Agaricomycetes)

1

Sarcoscypha_coccinea_2 Symbiotaphrina_kochii_2_Corr Patellaria_atrata_2 Alugraphum_hederae_2 Aplosporella_prunicola_2 Guignardia_citricaria_2_Corr Macrophomina_phaseolina_2 Neofusicoccum_parvum_2 Diaporthe_longicolla_2 Togninia_minima_2 Daldinia_eschscholzii_2_Corr Hypoxylon_CI_4A_2 Hypoxylon_CO27_5_2 Hypoxylon_EC38_2 Colletotrichum_gloeosporioides_2 Nectria_haematococca_2 Fusarium_fujikuroi_2 Fusarium_circinata_2_Corr Fusarium_oxysporum_lycopersici_2 Fusarium_oxysporum_Fo5176_2 Penicillium_paxilli_2 Penicillium_citrinum_2 Hymenoscyphus_varicosporoides_2 Hysterium_pulicare_2 Cenococcum_geophilum_2 Lepidopterella_palustris_2 Zopfia_rhizophila_2 Lophiostoma_macrostomum_2 Helminthosporium_solani_2_Corr Lentithecium_fluviatile_2 Shiraia_Slf14_2 Pleosporales_UM_1110_2 Hymenoscyphus_laetus_2 Phaeosphaeria_nodorum_2 Cochliobolus_lunatus_2 Cochliobolus_victoriae_2 Cochliobolus_carbonum_2 Cochliobolus_sativus_2 Cochliobolus_heterostrophus_C5_2 Cochliobolus_miyabeanus_2 Setosphaeria_turcica_2 Pyrenophora_seminiperda_2_Corr Pyrenophora_teres_2 Pyrenophora_tritici_repentis_2 Alternaria_brassicicola_2 Alternaria_arborescens_2 Pyrenochaeta_UM_256_2 Cucurbitaria_berberidis_2 Leptosphaeria_maculans_2 Dothidotthia_symphoricarpi_2 Didymella_exigua_2 Melanomma_pulvis_pyrius_2 Pleomassaria_siparia_2 Gymnascella_aurantiaca_2 Gymnascella_citrina_2 Paracoccidioides_brasiliensis_2 Ajellomyces_capsulatus_2 Ajellomyces_dermatitidis_2 Byssochlamys_spectabilis_2 Thermoascus_aurantiacus_2 Monascus_purpureus_2 Monascus_ruber_2 Aspergillus_terreus_2 Aspergillus_nidulans_HxnS Aspergillus_sydowii_2 Aspergillus_versicolor_2 Aspergillus_aculeatus_2 Aspergillus_carbonarius_2 Aspergillus_brasiliensis_2 Aspergillus_niger_2 Aspergillus_tubingensis_2 Aspergillus_kawachii_2 Aspergillus_foetidus_2 Neosartorya_fischeri_2 Neosartorya_udagawae_2 Aspergillus_glaucus_2 Aspergillus_ruber_2 Phaeomoniella_chlamydospora_2 Cyphellophora_europaea_2 Mycosphaerella_fijiensis_2 Pseudocercospora_pini_densiflorae_2 Glarea_lozoyensis_2 Hymenoscyphus_repandus_2 Oidiodendron_maius Geotrichum_candidum_3C_2

0.87

0.2 0.95

0.95 1

0.99

1

1

0.99

1 1

1

0.92 0.49

0.9 1

0.99

Xylona_heveae_2 Trinosporium_guianense_2

1

Rhizoscyphus_ericae_2 Meliniomyces_bicolor_2 Chalara_longipes_2 Meliniomyces_variabilis_2 Cadophora_sp_DSE1049_2 Phialocephala_scopiformis_2 Fungal_sp_EF0021_2 Acephala_macrosclerotiorum_2 Rutstroemia_echinophila_2 Rutstroemia_firma_2 Ciborinia_camelliae_2 Sclerotinia_borealis_2 Sclerotinia_sclerotiorum_2 Botrytis_cinerea_2 Botrytis_paeoniae_2

0.85

1

0.56

Morchella_conica_2 Morchella_importuna_2 Tuber_melanosporum_2 Choiromyces_venosus_2

0.96 1

Exobasidium_vaccinii Tilletiaria_anomala Pseudozyma_flocculosa_Corr Pseudozyma_antarctica Pseudozyma_aphidis Ustilago_hordei Sporisorium_reilianum Ustilago_maydis Pseudozyma_hubeiensis Cryptococcus_albidus Cryptococcus_vishniacii

1

1

Conidiobolus_coronatus_Corr Conidiobolus_incongruus_1A Conidiobolus_incongruus_1B Conidiobolus_incongruus_1C

1

Rhizophagus_irregularis Mortierella_alpina_ATCC_32222_1B Mortierella_alpina_B6842_1B Mortierella_verticillata Mortierella_alpina_ATCC_32222_1A Mortierella_alpina_B6842_1A Ramicandelaber_brevisporus_Corr Coemansia_reversa Martensiomyces_pterosporus

0.96 1 1 0.96

Basidiobolus_meristosporus_1D Basidiobolus_meristosporus_1C Basidiobolus_heterosporus Basidiobolus_meristosporus_1A Basidiobolus_meristosporus_1B

0.86 1 0.67

Batrachochytrium_dendrobatidis Gonapodya_prolifera_1A Gonapodia_prolifera_1B

0.95

Sphaeroforma_arctica Capsaspora_owczarzaki

0.85

Amphimedon_queenslandica Caenorhabditis_elegans Drosophila_melanogaster_XDH Bos_taurus_XDH Trichoplax_adherens Nematostella_vectensis Evechinus_chloroticus Capitella_teleta Aplysia_californica

0.97

0.19

0.76

Trichomonas_vaginalis

1

Trimastix_pyriformis_Corr Chondrus_crispus Porphyridium_purpureum Bathycoccus_prasinos Chlamydomonas_reinhardtii Physcomitrella_patens Selaginella_moellendorffii Arabidopsis_thaliana_AtXDH1 Zea_mays

1 0.66 1

Saprolegnia_diclina Pythium_ultimum Phytophthora_sojae Pseudoperonospora_cubensis

1

Nannochloropsis_gaditana 0.96 0.99

Aureococcus_anophagefferens Phaeodactylum_tricornutum Thalassiosira_pseudonana 0.4

Figure S3. A Maximum Likelihood rooted tree of all available fungal XDH-like enzymes with Eukaryotic out-groups. High quality readable figure is available as a separate supplementary file uploaded in PDF format. Colour keys for fungal clades, metazoans and Ichthyosporea (Opisthokonta) are those given in figure 4. Archaeplastida and Stramenopiles, including green algae and plants (Viridiplantae), red algae (Rhodophyta), Oomycetes and Diatoms are at the bottom of the tree, indicated with different shades of green. In black with no additional colouring, representative species from other taxa: Thecamonas trahens (Apusozoa, Bikonta), Guillardia theta (Cryptophyta, Chromista), Dictyostelium discoideum (Amoebozoa, Unikonta), Trichomonas vaginalis (Parabasalia, Excavata), Trimastix pyriformis (Metamonada, Excavata). In red lettering we indicate proteins where biochemical work is extant (comprising 3D structural work for Bos taurus XDH). In green lettering we indicate proteins that are in positions that do not correspond to the taxonomically appropriate position of the organism in question. Searches for genes encoding XDH-like proteins were carried out with both HxA and HxnS of A. nidulans as in silico probes. All fungal gene models and proteins were deduced manually. The auto-annotated accession numbers were curated as indicated in Supplementary Table S1 (a considerable number of them are miscalled). The proteins were aligned with MAFFT EINS-i (for sequences with multiple conserved domains and long gaps) with the default parameters. The alignment was curated with BMGE with a Blosum 30 similarity matrix. The Maximum Likelihood phylogeny was carried out with PhyML 3.0 with automatic model selection (LG substitution model selected). Numbers at nodes indicate aLRTs (approximate Likelihood Ratio test values).

Comments on the phylogeny of XDH-like enzymes in the fungi. The putative XDH from Galactomyces (Geotrichum) candidum (http://www.ncbi.nlm.nih.gov/bioproject/247755) clusters, as expected, with other Saccharomycotina. However there is another sequence at the NCBI database of a genome from a different strain of an identically named organism (http://www.ncbi.nlm.nih.gov/bioproject/243259). This strain shows an HxA orthologue clustering with the HxA orthologues of the Leotiomycetes, and an HxnS orthologue in a mixed clade, clustered (alTR 1.00) with the Leotiomycetes Oidiodendron maius, Hymenoscyphus repandus and Glarea lozoyensis (shown in grey). There seem to be no question that these sequences correspond to two different organisms, the former a genuine member of the Saccharomycotina, the latter of the Leotiomycetes. A few other Purine hydroxylase proteins have an unexpected position: three members of the Eurotiales (in green lettering) which include the only Penicillia to have an HxnS orthologue, cluster with the Hypocreales. The proteins of the basal members of the Taphrinomycotina, Saitoella complicata and species of genus Taphrina do not cluster together as would be expected. The Basidiomycota are separated into two discrete clades, one (comprising Ustilago maydis), which appear as an out-group of all the ascomycete sequences and a second, which clusters with the putative orthologues of HxnS. An interesting positioning is that of the Oidiodendron maius (Leotiomycetes, Helotiales) putative XDH. The cognate protein maps within the Pezizomycotina HxnS-like clade. It is one of the two species among all the sequenced Pezizomycotina to have a putative orthologue of HxnS, in the (apparent) absence of an orthologue of HxA. It shows both characteristic sequence insertions in the 2Fe/2S cluster and between the 2Fe/2S domain and the FAD/NAD binding domain. It carries a hydrophobic residue (Val533) where we have Tyr454 and Ile478 in HxA and HxnS, respectively. It has a His (His1124) where HxA has Phe1044 and HxnS has His1069. The ORF is interrupted by four introns, of which the first two are widely conserved among HxnS orthologues, the fourth is conserved in several other HxnS orthologues of the Helotiales, while the third is - within the limits of the genomes available - unique of O. maius. There is no question this protein is phylogenetically related to HxnS rather than to HxA. However, uniquely among all putative HxnS structural orthologues, it does not have the sequence FATALH (HxnS: 1064-1069) in its substrate binding site nor does it have FTALF, near universal among HxA Pezizomycotina orthologues (HxA: 1040-1044) and all biochemically characterised XDHs (with one exception, see below); instead it specifies FGALH, (1120-1124). This sequence change is identical to one occurring in the putative XDH of the four Taphrina species, while the characterised XDH of Blastobotrys (Arxula) adeninivorans [1] has FGATF. Indeed, a Gly residue replaces the Thr in all putative Saccharomycotina HxAs. While no biochemical work is extant in O. maius, we propose that this enzyme is not a Nicotinate hydroxylase but rather a XDH. O. maius has all the enzymes of purine breakdown (summarised in [2]), including an orthologue of UaY, the pathway specific regulatory gene characterised in A. nidulans [2, 3] and N. crassa [4]. On the contrary, it has none of the nicotinate specific clustered genes to be described below. There is no other hxA/hxnS paralogue present in the O. maius genome. A second species has in its genome an HxnS orthologue in the absence of an HxA orthologue. This is Rhytidhysteron rufulum (Dothideomycetes, Hysteriales). At variance with the situation in O. maius, the R. rufulum gene encodes a typical HxnS enzyme, included in a conserved hxn gene cluster. Other independent, probably genus or even species-specific duplications of XDH-like enzymes occurred in non-dikarya (Mortierella alpina, Conidiobolus incongruus, Basidiobolus

meristosporus, Gonapodya prolifera). None of these paralogues carry the diagnostic HxnS sequence FATAL(H). No biochemical work is extant in these fungal species.

Comments on the exon-intron structure of hxnS orthologues. The intron-exon organization is broadly class specific. Eurotiales and Onygenales (Eurotiomycetes) share multiple intron positions with Helotiales (Leotiomycetes) and Xylonomycetaceae (Xylonomycetes), including those of all three A. nidulans introns. Most Eurotiales (see below for outstanding exceptions in the Penicillum genus) have four conserved introns (in A. nidulans the second intron is absent) but only the most 5’ intron is present in species of the early divergent class of Pezizomycetes, whose hxnS genes usually have five introns. Potentially, this is the only intron that survived the re-functionalisation as it is present in the hxA orthologue genes of three of the dozen species of Basidiomycota (Heterobasidion annosum, Microbotryum violaceum, Septobasidium sp. strain PNB30-8B) that occur at the basis of the HxnS branch in the PHI/PHII phylogeny (figure 4 and figure S3). Nevertheless, none of the four hxnS introns conserved in the Eurotiales are present in Pleosporales or Botryosphaeriales (usually two introns, one conserved across these orders of Dothideomycetes), Hypocreales and Glomerellales (both Sordariomycetes, 8 and 9 introns, respectively) and Symbiotaphrina (recently assigned to Xylonomycetes, 3 introns, none corresponding to the 5 occupied intron positions found in Xylonomycetaceae). Intriguing is the exon-intron structure of the hxnS gene in some early divergent species in Penicillium, the sister genus of Aspergillus in the family of the Aspergillaceae. The genome sequences of P. paxilli, P. citrinum and the misnamed species Hymenoscyphus varicosporoides all specify 8 introns at exactly the same positions as those in hxnS genes of the Nectriaceae family, and share none with Aspergillus hxnS (the other sequenced Penicillium species have no hxnS orthologue). This exon-intron structure is completely coherent with the phylogeny of fungal Purine Hydroxylase paralogues (figure S4) that shows that the HxnS orthologues in these Penicillium are directly related to those of Hypocreales (Sordariomycetes) rather than to HxnS proteins from other Eurotiales, while the situation for the HxA orthologues is taxonomically completely orthodox: all Penicillium species (including P. citrinum, P. paxilli) clustered with Eurotiales and none with Sordariomycetes. These circumstantial evidence strongly suggests that these exceptional species of Penicillium have (re-)acquired an hxnS gene from a species of Hypocreales by horizontal gene transfer. References: 1 Jankowska, D. A., Trautwein-Schult, A., Cordes, A., Hoferichter, P., Klein, C., Bode, R., Baronian, K., Kunze, G. 2013 Arxula adeninivorans xanthine oxidoreductase and its application in the production of food with low purine content. J Appl Microbiol. 115, 796-807. (10.1111/jam.12284) 2 Galanopoulou, K., Scazzocchio, C., Galinou, M. E., Liu, W., Borbolis, F., Karachaliou, M., Oestreicher, N., Hatzinikolaou, D. G., Diallinas, G., Amillis, S. 2014 Purine utilization proteins in the Eurotiales: cellular compartmentalization, phylogenetic conservation and divergence. Fungal genetics and biology : FG & B. 69, 96-108. (10.1016/j.fgb.2014.06.005 S1087-1845(14)00108-X [pii]) 3 Suarez, T., de Queiroz, M. V., Oestreicher, N., Scazzocchio, C. 1995 The sequence and binding specificity of UaY, the specific regulator of the purine utilization pathway in

Aspergillus nidulans, suggest an evolutionary relationship with the PPR1 protein of Saccharomyces cerevisiae. The EMBO journal. 14, 1453-1467. 4 Liu, T. D., Marzluf, G. A. 2004 Characterization of pco-1, a newly identified gene which regulates purine catabolism in Neurospora. Current genetics. 46, 213-227. (10.1007/s00294004-0530-8)

Table S1. Purine- and nicotinate dehydrogenases in the Eukaryota. These only concern the proteins used for the phylogeny of the purine hydrolases and nicotinate dehydrogenases (PH), figure 4 and figure S3. Corresponding HxA- and HxnS orthologue accession numbers, accessible at NCBI, are listed. Species (428 strains) FUNGI – Non-Dikarya Mortierella verticillata Mortierella alpina ATCC 32222

Mortierella alpina B6842

Rhizophagus irregularis DAOM 197198w (JGI) Conidiobolus coronatus (also at NCBI) Conidiobolus incongruus

Basidiobolus heterosporus Basidiobolus meristosporus B9252

(JGI) Coemansia reversa (also at NCBI) (JGI) Martensiomyces pterosporus * (JGI) Ramicandelaber brevisporus * Batrachochytrium dendrobatidis JAM81 Gonapodya prolifera

FUNGI – Basidiomycota Ustilaginomycotina Tilletiaria anomala (JGI) Exobasidium vaccinii * Ustilago maydis 521

PH-encoding locus

Assigned Locus number (NCBI)

Protein Accession number

AEVJ01000235.1|:516-5033 ADAG01001033.1|:98453102900 (gene A) ADAG01001070.1|:218014222784 (gene B) AZCI01001013.1|:76357-80760 (gene A) AZCI01001070.1|:c7576171087 (gene B) JARB01005427.1|:15002-20660

MVEG_04668 NA

KFH69864

scaffold_97|78523|83036 (AP) & EST Cluster : Locus7237v1rpkm3.27 JNEM01008748.1|:9830-14313 (gene A) JNEM01009973.1|:2385528363 (gene B) JNEM01007870.1|:c128228314 (gene C) JNET01030457.1|:c2829924166 JNEO01016617.1|:15438-19574 (gene A) JNEO01012274.1|:c2346219323 (gene B) JNEO01006932.1|:c5462750478 (gene C) JNEO01008178.1|:c3345629330 (gene D) scaffold_25|45856|50052

NA

GLOINDRAFT _11827 (JGI)

ERZ97180 (partial sequence)

NA

NA NA

(JGI)

scaffold_37|34086|38369

(JGI) *

scaffold_476|11934|17180 includes a 999-nt insert between large direct repeats ADAR01000130.1|:4026046195 LSZK01000210.1|:c4021834336 (gene A) LSZK01000087.1|:c4852642863 (gene B)

(JGI) *

BATDEDRAFT _25113 M427DRAFT_1 31958 (gene A) M427DRAFT_5 1789 (gene B)

XP_006679022

JMSN01000028.1|:c110580105791 scaffold_9|220135|224743

K437DRAFT_2 45899 (JGI) *

XP_013243943

AACP01000110.1|:30755-

UMAG_03264

XP_011389680

KXS19430 (PH1-A) KXS20831 (PH1-B)

Sporisorium reilianum Ustilago hordei Pseudozyma hubeiensis Pseudozyma antarctica Pseudozyma aphidis Pseudozyma flocculos

Pucciniomycotina Microbotryum violaceum p1A1 Lamole aka Microbotryum lychnidis-dioicae (JGI) Sporobolomyces roseus * Sporidiobolus salmonicolor Rhodotorula toruloides Rhodotorula glutinis

Rhodotorula mucilaginosa (JGI) Chionosphaera apobasidialis * (JGI) Septobasidium sp. PNB30-8B * Agaricomycotina Cryptococcus albidus (JGI) Cryptococcus vishniacii * Heterobasidion irregulare aka (JGI) Heterobasidion annosum s.l Termitomyces sp. J132

Basidioascus undulatus

FUNGI – Ascomycota Taphrinomycotina (JGI) Saitoella complicata (also at NCBI) Taphrina deformans PYCC 5710

35137 FQ311473.1|388459-392832 CAGI01000169.1|125594129982 BAOW01000133.1|c7414169762 BAFG01000453.1|25766-30136

sr14258 UHOR_05076

CBQ73663 CCF51968

PHSY_006691

XP_012192681

PAN0_006c295 0 PaG_05999

XP_014657078

PFL1_06549

XP_007882283 (the C-terminus is not homologous)

AEIJ01000674.1|:21607-26584 CDLV01000009.1|783490788467

MVLG_06038

KDE03476

scaffold_13|262236|267856 (AP) CENE01000030.1|64145-69992

(JGI) *

AWNI01000039.1|:410636415006 AOUS01001022.1|:c8954584928 Includes frameshift

ALAU01000211.1|:6380668989 AEVR01000059.1|:c2164016463 AEVR02000023.1|:625189630366 JWTJ01000147.1|:16672-22067 scaffold_7|364969|369822

SPOSA6832_04 433 RHTO_05260

ETS60008

CEQ42602 (introns were overlooked) EMS19097

NA

NA (JGI) *

scaffold_20|365285|370933

(JGI) *

LKPZ01000016.1|:c143905139270 scaffold_4|747537|752201

NA

AEOJ01000007.1|:868231873947 scaffold_06|868231|873947 JDCH01000751.1|:c472-1 (Nterminus) JDCH01000750.1|:c3691-1 (central) JDCH01000749.1|:c6553564024 (C-terminus) JTLS01000972.1|:c2395-3 (Nterminus) JTLS01000452.1|:c1868415179 (C-terminus)

HETIRDRAFT _154846

XP_009547290 (exons were overlooked)

J132_08758

KNZ79755 (introns/exons were overlooked)

scaffold_1|879434|883597

G7K_4935-t1 (NCBI) TAPDE_00487 0 (N-terminus) TAPDE_00427 9 (C-terminus)

CAHR02000232.1|26550-29069 (N-terminus) CAHR02000189.1| c4189139766 (C-terminus)

(JGI) *

NA

GAO50814 (NCBI) CCG84408 (N-terminus) CCG83939 (C-terminus)

Taphrina deformans JCM 22205 Taphrina wiesneri Taphrina flavorubra Taphrina populina Saccharomycotina Pichia pastoris DSMZ 70382 Pichia pastoris GS115 aka Komagataella phaffii Kuraishia capsulata (JGI) Babjeviella inositovora (also at NCBI) (JGI) Candida arabinofermentans (also at NCBI) (JGI) Candida caseinolytica (also at NCBI) Candida boidinii Brettanomyces bruxellensis Brettanomyces anomalus

Blastobotrys adeninivorans Galactomyces candidum CLIB 918 Starmerella bombicola Candida apicola PEZIZOMYCOTINA Orbiliomycetes Arthrobotrys oligospora Dactylellina haptotyla aka Monacrosporium haptotylum Drechslerella stenobrocha Pezizomycetes Tuber melanosporum

Pyronema omphalodes aka (JGI) Pyronema confluens (JGI) Ascobolus immersus * (JGI) Choiromyces venosus * (JGI) Terfezia boudieri *

BAVV01000037.1|188095192270 BAVU01000030.1|203950208124 BAVW01000029.1|149235153416 BAVX01000002.1|c5078946651

NA

CABH01000313.1|c8897-4749

NA

NC_012964.1|21701002174248 CBUD020000029.1| c4971645463 scaffold_1|977443|981603

PAS_chr22_0112 KUCA_T00003 149001 (JGI)

scaffold_1|335985|340238

(JGI)

scaffold_3|1563019|1567173

(JGI)

LMZO01000014.1|:c125385121141 AZMW01000189.1|:c2301718752 LCTY01000001.1|:c483801479516 Including 13 bp duplication CBZY010000003.1|10146801018897 CCBN010000014.1|c400911396719 BBSW01000010.1|c2331419328 LBNK01000001.1|:c14249991420899

NA

ADOT01000147.1|:c483350478933 AQGS01000024.1|:c5080546433

AOL_s00081g3 25 H072_948

XP_011123444

ASQI01000063.1|:81295-85680

DRE_00023

EWC48718

CABJ01001597.1|c7559171270 CABJ01000281.1|c139110134465 (2) CATG01001584.1|c5630051686

Locus not annotated Locus not annotated PCON_12424

absent

scaffold_3|149466|153732 (AP)

(JGI) *

scaffold_3|911684|916004 scaffold_106|11655|16299 (2) scaffold_4|1579577|1583929

(JGI) *

NA NA NA

XP_002492094 CDK27172

NA NA

GNLVRS02_A RAD1D12518g BN980_GECA1 4s01737g NA

R4ZGN4 CDO56254

NA

(JGI) *

XP_011106940

absent (2) CCX32154

(JGI) Wilcoxina mikolae * (JGI) Ascodesmis nigricans * (JGI) Morchella conica *

(JGI) Morchella importuna * (JGI) Sarcoscypha coccinea * Lecanoromycetes Cladonia metacorallifera Cladonia macilenta (JGI) Cladonia grayi * Gyalolechia flavorubescens (JGI) Xanthoria parietina * Umbilicaria muehlenbergii Lasallia pustulata Xylonomycetes (JGI) Xylona heveae (also at NCBI) (JGI) Trinosporium guianense * (JGI) Symbiotaphrina kochii *

Leotiomycetes Blumeria graminis f. sp. hordei A6 Blumeria graminis f. sp. tritici 96224 Pseudogymnoascus pannorum var. pannorum M1372 Pseudogymnoascus destructans 20631-21 (JGI) Thelebolus microsporus * Botrytis cinerea T4

Sclerotinia sclerotiorum

scaffold_8|788009|792435 (AP) scaffold_18|302469|306786 (AP) scaffold_18|121185|125555 scaffold_64|55926|60640 (AP) (2) scaffold_2|586250|590620 (AP) scaffold_44|111510|116194 (2) scaffold_5|354994|359193 (AP) scaffold_101|113340|117827 (AP) (2)

(JGI) * (JGI) *

AXCT02000543.1|:1383017990 AUPP01000438.1|:1454418704 scaffold_9|30295|34455 AUPK01000016.1|:c3918434925 scaffold_7|601906|606148 (AP)

NA

JFDN01000109.1|:11228-15506

NA

JYIL01001320.1|:11352-15627

NA

scaffold_11|282831|287152 scaffold_2|3048379|3053309 (AP) (2) scaffold_4|65962|70268 scaffold_77|80761|85664 (AP) (2) scaffold_6|1001298|1005531 (AP) scaffold_6|1194725|1199457 (AP) (2)

(JGI)

AOLT01012859.1|:c103116208 ANZE01012231.1|:1011614219 AYKR01000965.1|:3503-7964

BGHDH14_bgh 06183 BGT96224_345

CCU77189

V493_06059

KFY23144 (the protein is too long at the N-terminus)

AEFC01000491.1|:c1478910399 scaffold_5|823033|827281 (AP)

GMDG_02965

XP_012741374

ALOC01000611.1|:c4649842158

BofuT4_P06499 0.1 (N-term) BofuT4_P06500 0.1 (C-term) BofuT4_P08161 0.1 SS1G_14350 (N-terminus) SS1G_14351 (C-terminus)

ALOC01000541.1|:c223002218501 (2) AAGT01000668.1|:8386-11897 (N-terminus) AAGT01000669.1|1-507 (Cterminus) & (Broad EST) G787P5105FA9.T0 (AP)

(JGI) *

(JGI) * (JGI) *

NA (JGI) * NA (JGI) *

(JGI) *

(JGI) *

EPQ62890

(JGI) * CCD43657 CCD43658 CCD52002 (2) XP_001584737 XP_001584738

Sclerotinia borealis

Botrytis paeoniae

Glarea lozoyensis

Fungal sp. EF0021

Marssonina brunnea f. sp. 'multigermtubi' MB_m1 Oidiodendron maius Geotrichum candidum strain 3C

Amorphotheca resinae

Ascocoryne sarcoides Ciborinia camelliae

Rutstroemia echinophila

Poculum sydowianum

Calycina herbarum Hymenoscyphus salicellus

Hymenoscyphus scutula Hymenoscyphus infarciens Hymenoscyphus fructigenus Hymenoscyphus fraxineus

(http://www.broadinstitute.org/) AAGT01000385.1|:c129008393 (2) AYSA01000353.1|:c114667130 AYSA01000181.1|:c4508040566 (2) LBGX01000395.1|:c4355739218 LBGX01000778.1|:c3607931579 (2) ALVE01000039.1|:c272536268251 ALVE01000002.1|:421387426045 (2) AIET01001355.1|:c278408274110 AIET01001355.1|:849201853859 (2) AFXC01000120.1|:3312737362 JMDP01000167.1|:8904293667 JMRO01000046.1|:540372544557 JMRO01000106.1|:c212221207543 (2) JZSE01000420.1|:c3418130000 JZSE01000223.1|:112121116302 (duplication) AIAA01000122.1|:c142082137920 LGKQ01001362.1|:c6015-1677 LGKQ01000402.1|:2589330367 (2) JWJA01005169.1|:c11070-6763 JWJA01000773.1|:2101-6670 (2) JWJB01010317.1|:44342-46812 (N-terminus) JWJB01010820.1|:26-1896 (Cterminus) JWJB01002008.1|:24-4425 (Partial) (2) LLEY01000015.1|:c615772611608 LLCD01003750.1|:1861-5275 (N-terminus) LLCD01004351.1|:c4410-3655 (C-terminus) LKTO01000760.1|:7934-12095 LLCB01000058.1|:c123716119552 LKUV01000003.1|:c240395236231 LLCC01000020.1|:c2056516317

SS1G_08428 SBOR_6728 SBOR_4076

XP_001590688 (2) (protein is too short at the N-terminus) ESZ92865 ESZ95547 (intron is wrongly annotated) (2)

NA

GLAREA_0963 2 GLAREA_0886 8 NA

XP_008084419

MBM_00517

XP_007288406

OIDMADRAFT _171175 NA

KIM95720 (an exon is overlooked)

NA

NA NA

NA

NA

NA NA

NA NA NA NA

XP_008076020 (2)

Hymenoscyphus repandus

Hymenoscyphus laetus CBS 340.76 (Sordariomycetes?) Hymenoscyphus varicosporoides CBS 651.66 (Penicillium?) (JGI) Acephala macrosclerotiorum * (JGI) Cadophora sp. DSE1049 * (JGI) Chalara longipes *

(JGI) Loramyces juncicola * (JGI) Meliniomyces bicolor * (JGI) Meliniomyces variabilis * (JGI) Phialocephala scopiformis (also at NCBI) (JGI) Rhizoscyphus ericae * (JGI) Rutstroemia firma *

Eurotiomycetes Aspergillus nidulans biA1 (reference protein)

Aspergillus nidulans FGSC A4

Aspergillus terreus

Aspergillus niger CBS 513.88

Aspergillus kawachii

LLCE01000003.1|:c491479487313 LLCE01000019.1|:c158554153654 (2) LLCA01000031.1|:c122585118392 LLCA01000013.1|:c246712242191 (2) LLCF01000048.1|:8492-12784 LLCF01000007.1|:115792120768 (2) scaffold_15|243721|247968 scaffold_262|18216|22843 (2) scaffold_37|303465|307676 scaffold_2|309814|314467 (2) scaffold_6|1017180|1021346 (AP) scaffold_6|178635|183273 (AP) (2) scaffold_7|1417797|1422435

NA

scaffold_15|432795|436964 scaffold_15|1921817|1926458 (2) scaffold_4|714981|719148 (AP) scaffold_32|313469|318096 (2)

(JGI) *

scaffold_10|952743|956928

LY89DRAFT_7 81300 LY89DRAFT_7 06582 (JGI) *

scaffold_10|168639|173443 (AP) (2) scaffold_11|722225|726391 (AP) scaffold_49|244301|248951 (2) scaffold_1|1475225|1479532 (AP) scaffold_2|508085|512630 (2) X82827.1|585-4817 (Glatigny & Scazzocchio, 1995)

AACD01000098.1|:1688421116 AACD01000170.1|:2776032118 (2)

AAJN01000109.1|:112077116331 AAJN01000215.1|:c5460050204 (2) NT_166539.1|13318441336073 NT_166520.1|:290799-295216 (2) BACL01000033.1|114869-

NA

NA

(JGI) * (JGI) * (JGI) *

(JGI) *

(JGI) *

KUJ18220 KUJ17908 (2)

(JGI) *

hxA gene (XDH_EMENI) (Glatigny & Scazzocchio, 1995) AN5613

CAA58034 / Q12553 xanthine dehydrogenase (purine hydroxylase I)

AN9178 NB. Locus and predicted protein are correct at AspGD ATEG_03959

XP_682447 NCBI WRONG (2) AspGD does not provide accession numbers

ATEG_08616

XP_001217202 (2) (homology is lost at the C-terminus) XP_001401908

ANI_1_902184 ANI_1_105603 4 AKAW_01061

XP_663217

XP_001213137

XP_001390055 (2) GAA82946

Aspergillus sojae Aspergillus flavus Aspergillus oryzae RIB40 Aspergillus fumigatus Af293 Neosartorya fischeri

Neosartorya udagawae

Aspergillus clavatus (JGI) Aspergillus aculeatus (also at NCBI)

(JGI) Aspergillus carbonarius (also at NCBI) (JGI) Aspergillus acidus aka A. foetidus aka A. luchuensis (also at NCBI) (JGI) Aspergillus brasiliensis (also at NCBI) (JGI) Aspergillus glaucus CBS 516.65 (also at NCBI) (JGI) Aspergillus sydowii (also at NCBI) (JGI) Aspergillus tubingensis (also at NCBI) (JGI) Aspergillus versicolor (also at NCBI) (JGI) Aspergillus wentii (also at NCBI) (JGI) Aspergillus zonatus (also at NCBI) (JGI) Eurotium rubrum aka Aspergillus ruber (at NCBI) Penicillium chrysogenum Wisconsin 54-1255 aka Penicillium rubens Penicillium oxalicum 1142 Penicillium digitatum Pd1 Penicillium roqueforti

119096 BACL01000152.1|:c7857974163 (2) BACA01000963.1|:c204078199835 AAIH02000056.1|:c114946110692 AP007155.1|:2989828-2994081 AAHF01000005.1|:992326996586 AAKE03000005.1|:c10850181080758 AAKE03000012.1|:159786164138 (2) BBXM01000038.1|:471112475371 BBXM01000084.1|:615272619624 (2) AAKD03000029.1|:c247358243109 scaffold_2|2697492|2701741 (AP) scaffold_11|1089314|1093677 (2) scaffold_4|1529953|1534188 scaffold_11|980305|984734 (AP) (2) scaffold_5|1354508|1358735 scaffold_3|3367804|3372220 (AP) (2) scaffold_7|557633|561862 (AP) scaffold_12|159753|164160 (2) scaffold_34|67065|71293 scaffold_3|1126936|1131415 (2)

AKAW_05047

GAA86933 (2)

NA AFLA_027200

XP_002374230

AOR_1_195815 4 AFUA_4G1122 0 NFIA_105140

XP_001820196

NFIA_094210

XP_001261698 (2)

AUD_2410

GAO83450

AUD_5206

GAO86246 (2)

ACLA_050310

XP_001271985

XP_751707 XP_001266923

(JGI)

(JGI)

(JGI)

(JGI) (JGI)

scaffold_4|540227|544475 (AP) scaffold_14|384592|388975 (2) scaffold_7|1026071|1030298 (AP) scaffold_3|303186|307597 (2) scaffold_5|1947216|1951462 scaffold_16|318700|322980 (AP) (2) scaffold_1|1624834|1629079

(JGI)

scaffold_3|1862091|1866377

(JGI)

scaffold_28|163924|168147 scaffold_2|20378|24860 (AP) (2) NW_003020081.2:14980031502273

(JGI)

Pc22g06330

XP_002564663

AGIH01000294.1|:c115845111536 AKCU01000234.1|:c3002525754 CBMR010000309.1:|c28267-

PDE_08434

EPS33472

PDIP_33700

XP_014535974

PROQFM164_S

CDM36668

(JGI)

(JGI)

(JGI)

Penicillium camemberti Penicillium paxilli

Penicillium citrinum

Talaromyces stipitatus Talaromyces marneffei Thermomyces lanuginosus Byssochlamys spectabilis

(JGI) Thermoascus aurantiacus *

(JGI) Monascus purpureus * (JGI) Monascus ruber (also at NCBI) Arthroderma benhamiae Arthroderma gypseum Arthroderma otae Trichophyton rubrum Trichophyton verrucosum

Trichophyton equinum Trichophyton tonsurans Coccidioides immitis RS Coccidioides posadasii C735 delta SOWgp Uncinocarpus reesii Blastomyces gilchristii SLH14081 aka Ajellomyces dermatitidis Histoplasma capsulatum G186AR aka Ajellomyces capsulatus

23997 CBVV010000316.1|:110005114280 AOTG01000382.1|:c213578209295 AOTG01000229.1|:c6229457402 (2) LKUP01000466.1|:8487-12779 LKUP01000591.1|:1753822514 (2) ABAS01000006.1|:c10935091089259 ABAR01000009.1|:530801535066 ANHP01000232.1|:96119100361 BAUL01000093.1:c4852-555 BAUL01000291.1|16075-20649 (2) scaffold_12|678656|682937 (AP) scaffold_9|337380|342034 (AP) (2) scaffold_63|30587|34870 scaffold_44|18569|23142 (2) scaffold_120|40906|45189 scaffold_22|26888|31451 (2) ABSU01000026.1|:8471988976 ABQE01000233.1|:c9268188423 ABVF01000212.1|:c147188142926 ACPH01000467.1|:104107108360 ACYE01000253.1|:c2998025726 (Pseudo gene: 2 premature stop codons) ABWI01000691.1|:c2928025035 ACPI01000629.1|:c3243228187 AAEC03000001.1|:c45407994536543 ACFW01000049.1|:c16311841626931 AAIW01000349.1|:c7717-3483 ACBU01000519.1|:c192911188556 ACBU01001509.1|:c3855033943 (2) ABBS02000087.1|:c2263218273 ABBS02000082.1|:c236537232178 (Duplication) ABBS02000272.1|:1708321682 (2)

05g000501 PCAMFM013_ S010g000114 NA

CRL23676

NA

TSTA_077920

XP_002341817

PMAA_040820

XP_002151227

NA PVAR5_3105 PVAR5_8010

GAD94479 GAD99299 (2) (exon is overlooked)

(JGI) *

(JGI) * (JGI) ARB_02280

XP_003011430

MGYG_06870

XP_003170879

MCYG_06415

XP_002844451

TERG_07188

XP_003232340

TRV_04973

XP_003020897

TEQG_03787

EGE04942

TESG_05242

EGD97942

CIMG_01495

XP_001247724

CPC735_04950 0 UREG_05104 BDBG_03499

XP_003065725

BDBG_09398 HCBG_03511

XP_002620218 (2) (inextant introns were annotated) EEH08222

HCBG_09167

EEH02602 (2)

XP_002584415 XP_002626335

Paracoccidioides brasiliensis Pb03

(JGI) Gymnascella aurantiaca *

(JGI) Gymnascella citrina * Ascosphaera apis

Exophiala dermatitidis Herpotrichiellaceae sp. UM238 Cladophialophora carrionii Cyphellophora europaea

Coniosporium apollinis (Dothideomycetes ?) Endocarpon pusillum Z07020 Phaeomoniella chlamydospora RR-HG1

Phaeomoniella chlamydospora UCRPC4

Dothideomycetes Leptosphaeria maculans

Pyrenophora teres f. teres

Pyrenophora triticirepentis

Pyrenophora seminiperda

Alternaria brassicicola

Alternaria arborescens

Phaeosphaeria nodorum

ABHV02000165.1|:127963132258 ABHV01000435.1|:c128734124085 (2) scaffold_19|217052|221418 (AP) scaffold_35|10540|15109 (AP) (2) scaffold_28|62781|67135 scaffold_29|233058|237606 (2) AARE01006949.1|:528-2520 (N-terminus) AARE01002943.1|:1-2496 (Cterminus) AFPA01000145.1|:270526274608 AMYF01000005.1|:c7426470140 AOFF01000008.1|:c658316654231 AOBU01000050.1|:c187792183489 AOBU01000059.1|:c129366124948 (2)

PABG_03125

EEH20894

PABG_06956

EEH16869 (2)

AJKL01000087.1|:277638281803 APWS01000105.1|:3751941844 JACF01000342.1|:c1722913019 JACF01000099.1|:51840-56436 (2) LCWF01000007.1|:c1824714037 LCWF01000106.1|:5174256338 (2)

W97_07210

XP_008721046 (2) (the protein is shorter with 12 AAs at the Nterminus) XP_007783379

EPUS_03718

XP_007805892

UCRPC4_g002 93 UCRPC4_g044 16

KKY28869

FP929105.1|c1782909-1778547 FP929127.1|:1901889-1906466 (2)

LEMA_P04443 0.1 LEMA_P02944 0.1 PTT_04424 PTT_07497

XP_003836907

PTRG_06036

XP_001936369

PTRG_07698

XP_001938030 (2)

AEEY01000672.1|:c8757-4539 AEEY01001409.1|:c5662652046 (2) AAXI01000283.1|:336049340262 AAXI01000364.1|:6843-11423 (2) ATLS01000374.1|:20973-25206 ATLS01000051.1|:c5453249953 (2) ACIW01002083.1|:c6103-1869 ACIW01000963.1|:4619150768 (2) AIIC01000053.1|:90370-94580 AIIC01000105.1|:c41447-36871 (2) AAGI01000164.1|:318514-

(JGI) *

(JGI) * NA

HMPREF1120_ 06110 NA

XP_009158553

G647_01148

XP_008722771

HMPREF1541_ 07421 HMPREF1541_ 08505

XP_008719967

NA

KKY19715 (2)

XP_003839271 (2) XP_003296021 XP_003297181 (2)

NA

NA

NA

SNOG_07509

XP_001797843

aka Parastagonospora nodorum

(JGI) Setosphaeria turcica (also at NCBI)

(JGI) Cochliobolus heterostrophus C5 aka (NCBI) Bipolaris maydis (JGI) Cochliobolus sativus aka (NCBI) Bipolaris sorokiniana Cochliobolus miyabeanus aka (NCBI) Bipolaris oryzae Cochliobolus victoriae aka (NCBI) Bipolaris victoriae Cochliobolus carbonum aka (NCBI) Bipolaris zeicola Pyrenochaeta sp. UM 256

Pleosporales_UM_1110

Shiraia sp. Slf14

Corynespora cassiicola

Helminthosporium solani

Hortaea werneckii Hysterium pulicare

Rhytidhysteron rufulum

Zymoseptoria tritici IPO323 aka Mycosphaerella graminicola Zymoseptoria passerinii

322705 Includes frameshift AAGI01000083.1|:96257100778 (2) scaffold_10|771173|775391 (AP) scaffold_14|193421|197997 (2) scaffold_2|894394|898657 scaffold_24|84847|89437 (2) scaffold_1|969116|973381 scaffold_9|283965|288571 (AP) (2) AMCO01000008.1|:c172179167915 AMCO01000106.1|:6301167648 (2) AMCY01000020.1|:c224063219798 AMCY01000206.1|:c1754012922 (2) AMCN01000037.1|:1605820323 AMCN01000091.1|:c1697212354 (2) AOUM01000047.1|:c263276259002 AOUM01000070.1|:2806432595 (2) AJMS01009549.1|:62-4302 AJMS01010346.1|:1975024271 (2) AXZN01000041.1|:6371667944 AXZN01000045.1|:c360961356434 (2) JAQF01000469.1|:71108-75395 JAQF01000510.1|:88857-93446 (2) AWWW01000929.1|:613810368 AWWW01001360.1|:1068715355 (2) AIJO01010339.1|:c12476-8376 AJFK01001090.1|:384817389059 AJFK01000232.1|:c3484030331 (2) PHI gene is not covered AJFL01001926.1|:c8719-4214 (2) ACPE01000001.1|:44323174436405

AFIY01000542.1|:c8546281374

SNOG_04191

XP_001794615 (2)

SETTUDRAFT _166689 SETTUDRAFT _176195 COCC4DRAFT _183960 COCC4DRAFT _45341 COCSADRAFT _105648 COCSADRAFT _172265 COCMIDRAFT _82012 COCMIDRAFT _6414 COCVIDRAFT _23627 COCVIDRAFT _31607 COCCADRAF T_89627 COCCADRAF T_5375 NA

XP_008021540 XP_008023425 (2) XP_014084733 XP_014073253 (2) XP_007694664 XP_007701174 (2) XP_007683075 XP_007689217 (2) XP_014560158 XP_014550728 (2)

XP_007709785 XP_007712661 (2)

NA

NA

NA

NA

NA NA

NA

MYCGRDRAF T_53902

NA

XP_003856586

Zymoseptoria ardabiliae STIR04_3.3.2 Zymoseptoria pseudotritici STIR04_5.9.1 (JGI) Baudoinia compniacensis aka (NCBI) Baudoinia panamericana (JGI) Dothistroma septosporum (also at NCBI) (JGI) Mycosphaerella fijiensis aka (NCBI) Pseudocercospora fijiensis

Pseudocercospora pinidensiflorae

(JGI) Septoria musiva aka (NCBI) Sphaerulina musiva (JGI) Septoria populicola aka (NCBI) Sphaerulina populicola Passalora fulva aka (JGI) Cladosporium fulvum Cercospora canescens

Mycosphaerella sp. Ston1 Mycosphaerella laricina Cladosporium sphaerospermum Aureobasidium pullulans AY4 Guignardia citricarpa aka Phyllosticta citricarpa

Neofusicoccum parvum

Macrophomina phaseolina MS6

Cryomyces antarcticus (JGI) Acidomyces

AFIX01000226.1|:c8444180353 AFIT01000355.1|:77694-81782

NA

scaffold_8|382255|386331

BAUCODRAF T_577650

XP_007677710

scaffold_1|703612|707688

DOTSEDRAFT _39924

EME48616

scaffold_1|3134033|3138388 (AP) AIHZ01000030.1|:c6648862133 scaffold_2|4952439|4956861 (AP) (2) AIHZ01000140.1|:c185686181267 (2) AWYD01001424.1|:1264716837 AWYD01001792.1|:c2184517419 (2) scaffold_1|3651001|3655086

MYCFIDRAFT _48128

XP_007920014

MYCFIDRAFT _45300

XP_007922515 (2)

scaffold_134|46961|51046 (AP)

NA

AMRR01004224.1|:c157026152902

NA

ANSM01007968.1|:1-4077 (partial) Lacks 5 residues at the Nterminus AWYF01003274.1|:c7444270357 AWYE01001183.1|:c5116-703 PHI gene is found on 4 nonoverlapping contigs AMCU01000220.1|:c2749523314 AOTE01004287.1|:1006-5157 AOTE01002293.1|:c3937-1 (Nterminus) (2) AOTE01002292.1|:c6905-6298 (C-terminus) (2) AORE01001606.1|:7503579314 AORE01000907.1|:c9850-5340 (2) AHHD01000035.1|:583432587727 AHHD01000030.1|:9330397853 (2) AYQD01001144.1|:c4428-270 Includes 2 frameshifts scaffold_74|33407|37489 (AP)

NA

NA

NA

SEPMUDRAFT _122866

EMF17508

NA NA

NA NA

UCRNP2_9149

XP_007588384

UCRNP2_5272

XP_007584554 (2)

MPH_00876

EKG21955

MPH_00564

EKG22109 (2)

NA FE78DRAFT_8

KXL48883

richmondensis BFW (also at NCBI) (JGI) Aplosporella prunicola * (JGI) Aulographum hederae * (JGI) Aureobasidium subglaciale EXF-2481 (also at NCBI) (JGI) Botryosphaeria dothidea (also at NCBI) (JGI) Cenococcum geophilum (also at NCBI) (JGI) Cercospora zeaemaydis * (JGI) Cochliobolus lunatus aka Curvularia lunata (at NCBI) (JGI) Cucurbitaria berberidis * (JGI) Didymella exigua *

(JGI) Dissoconium aciculare * (JGI) Dothidotthia symphoricarpi * (JGI) Lentithecium fluviatile * (JGI) Lepidopterella palustris (also at NCBI) (JGI) Lophiostoma macrostomum * (JGI) Melanomma pulvispyrius * (JGI) Myriangium duriaei * (JGI) Patellaria atrata *

(JGI) Pleomassaria siparia * (JGI) Polychaeton citri * (JGI) Sporormia fimetaria * (JGI) Trypethelium eluteriae * (JGI) Zasmidium cellare * (JGI) Zopfia rhizophila *

6749 scaffold_14|248651|252841 scaffold_2|619672|624199 (2) scaffold_10|172303|176508 (AP) scaffold_44|147458|152399 (2) scaffold_4|251391|255572 (AP)

(JGI) *

scaffold_831|195815|200087 (AP) scaffold_402|28207|32803 (2) scaffold_23|1399280|1403600 (AP) scaffold_11|224057|228687 (2) scaffold_6|223433|227515

(JGI)

scaffold_18|216235|220480 (AP) scaffold_5|265003|269585 (2) scaffold_1|7139902|7144108 (AP) scaffold_4|485744|490273 (2) scaffold_36|111624|115879 (AP) scaffold_30|135581|140123 (2) scaffold_2|1439149|1443341

(JGI)

scaffold_7|619692|623895 (AP) scaffold_4|1530881|1535403 (AP) (2) scaffold_8|1540548|1544781 scaffold_19|61487|66021 (2) scaffold_10|177880|182186 scaffold_855|602|5299 (AP) (2) scaffold_20|188081|192362 (AP) scaffold_181|9679|14226 (2) scaffold_6|162110|166473 (AP) scaffold_214|51631|56175 (2) scaffold_4|2011896|2016077 (AP) scaffold_6|123881|128097 scaffold_16|50809|55340 (AP) (2) scaffold_3|659655|664055 scaffold_17|636855|641532 (AP) (2) scaffold_2|809474|813577 (AP) scaffold_20|305289|309531

(JGI) *

scaffold_14|396201|400387 (AP) scaffold_3|1218345|1222508 (AP) scaffold_9|2758278|2762514 scaffold_19|1835902|1840427 (2)

(JGI) *

(JGI) *

AUEXF2481D RAFT_2656

(JGI)

(JGI) *

(JGI) *

(JGI) *

(JGI) *

(JGI) * (JGI) (JGI) *

(JGI) * (JGI) * (JGI) *

(JGI) *

(JGI) * (JGI) *

(JGI) * (JGI) *

XP_013346121

Sordariomycetes Thielavia terrestris Myceliophthora thermophila Podospora anserina (JGI) Neurospora discreta (also at NCBI) Neurospora crassa OR74A Neurospora tetrasperma FGSC 2508 Sordaria macrospora Chaetomium globosum Chaetomium thermophilum var. thermophilum Magnaporthe oryzae 70-15 Gaeumannomyces graminis var. tritici Magnaporthe poae

Grosmannia clavigera Verticillium alfalfae aka V. albo-atrum Verticillium dahliae

Glomerella graminicola aka Colletotrichum graminicola (JGI) Acremonium alcalophilum * (JGI) Cryphonectria parasitica * Trichoderma atroviride Trichoderma virens Trichoderma reesei QM6a Cordyceps militaris Fusarium verticillioides aka Gibberella moniliformis

CP003014.1|:c10043771000144 CP003008.1|:1153538-1157789 CU638743.1|c15240031519799 scaffold_21|103224|107425

THITE_212341 0 MYCTH_23116 89 PODANSg6463

XP_003657567 XP_003666737 XP_001909427

(JGI)

AABX02000008.1|:9393398138 AFBT01000264.1|:8437388570 CABT02000015.1|:6234866556 AAFU01000747.1|:c2238118151 ADUW01000094.1|:373236377660

NCU03350

XP_956459

NEUTE1DRAF T_130703 SMAC_04084

XP_009852458

CHGG_08076

XP_001225732

CTHT_0001520

XP_006690701

AACU03000115.1|:517654522108 ADBI01000921.1|:12296-16828 Includes a frameshift ADBL01000174.1|:c3438-3 (Nterminus) ADBL01000173.1|:c1292012060 (C-terminus) ACXQ02000012.1|:c346505342072 ABPE01002434.1|:c1515210989 ABJE01001128.1|:c1071-4 (Nterminus) Includes 3 frameshifts ABJE01001127.1|:c3189728874 (C-terminus) ACOD01000254.1|:c6381059587

MGG_12738

XP_003716708

GGTG_11192

XP_009227337

MAPG_00752

KLU81667

Locus not annotated CMQ_6586

absent

scaffold_4|77418|81642

(JGI) *

scaffold_4|1002846|1007253

(JGI) *

ABDG01000131.1|:5459-9732

TRIATDRAFT _141294 TRIVIDRAFT_ 40214 TRIREDRAFT_ 78797 CCM_08980

XP_013944701

FVEG_09642

EWG50413 (the C-terminus is not homologous)

Locus not annotated FVEG_12680

Absent (2)

ABDF01000171.1|:c9792793693 AAIL02000034.1|:869355873599 AEVU01000504.1|:c126382122136 AAIM02000119.1|:588578592791 Includes a frameshift AAIM02000167.1|:c357-1 (Nterminus) (2) AAIM02000166.1|:c282447278039 (C-term) (2)

XP_003346651

VDBG_05801

XP_014175747 (the N-terminus of the protein is too long) XP_003004688

VDAG_07735

XP_009654935

GLRG_09943

XP_008098819

XP_013950236 XP_006966038 XP_006674178

EWG54466 (2)

Fusarium oxysporum f. sp. lycopersici 4287

Fusarium oxysporum Fo5176

Fusarium graminearum PH-1 aka Gibberella zeae Nectria haematococca

Metarhizium acridum Metarhizium robertsii aka M. anisopliae ARSEF 23 Epichloe festucae Fl1 Epichloe festucae E2368 Epichloe brachyelytri Epichloe typhina Epichloe amarillans Epichloe glyceriae Neotyphodium gansuense Periglandula ipomoeae Claviceps fusiformis Claviceps paspali

Aciculosporium take

Claviceps purpurea Epichloe elymi Beauveria bassiana Trichoderma longibrachiatum Trichoderma hamatum

Fusarium acuminatum Fusarium

AAXH01000665.1|:c7115166938

FOXG_11147

KNB11127 KNB11128 (identical)

AAXH01000944.1|:c2812223329 (2) AFQF01002556.1|:c105639101426 AFQF01002934.1|:c4754942757 (2) AACM02000060.1|:4556549773

FOXG_15354

KNB17256 (2)

FOXB_09368

EGU80093

FOXB_11888

EGU77600 (2)

FGSG_01561

XP_011317373

ACJF01000006.1|:c756119751917 ACJF01000017.1|:589089593861 (2) ADNI01000757.1|:c12246-7852 ADNJ02000001.1|:61919606196376

NECHADRAF T_74201 NECHADRAF T_93123 MAC_05768 MAA_01730

XP_003049835

AFRX01000127.1|:4634250808 ADFL01000166.1|:c5780253336 AFRB01000152.1|:c2517320683 AFSE01000297.1|:c6416-1926 AFRF01000168.1|:c5301048544 AFRG01000045.1|:7594280442 AFRE01000097.1|:3234636817 AFRD01000341.1|:3388-7525 Includes two frameshifts AFRA01000505.1|:2871-7449 AFRC01001511.1|:c242-1 (Nterminus) AFRC01000532.1|:c1833314163 (C-terminus) AFQZ01002722.1|:646-875 (Nterminus) AFQZ01002052.1|:c4430-74 (C-terminus) CAGA01000046.1|c124305119726 AMDJ01000066.1|:c2694122451 ADAH01000750.1|:c2009915820 ANBJ01000092.1|:c177346173130 ANCB01006209.1|:c3137-4 (Nterminus) ANCB01006208.1|:c2459-1350 (C-terminus) CBMG010001156.1|:c1888014674 CBMF010000113.1|22770-

NA

XP_003045535 (2) XP_007812108 XP_007817919

NA NA NA NA NA NA NA NA NA

NA

CPUR_06642

CCE32778

NA BBA_09514

XP_008602833

NA NA

NA BN848_001989

CEG02643 (other strain)

pseudograminearum CS5834 Fusarium equiseti Fusarium fujikuroi B14

Fusarium circinata

Hirsutella thompsonii MTCC6686 Hirsutella thompsonii MTCC3556 Tolypocladium inflatum Ophiostoma novo-ulmi subsp. novo-ulmi Ophiostoma piceae Sporothrix schenckii Daldinia eschscholzii UM1020

Pestalotiopsis fici Eutypa lata Colletotrichum higginsianum

Colletotrichum gloeosporioides Nara gc5

Colletotrichum gloeosporioides Cg-14

Colletotrichum orbiculare Diaporthe longicolla

Togninia minima aka (JGI) Phaeoacremonium aleophilum Ceratocystis fimbriata Pochonia chlamydosporia aka Metacordyceps

26978

0 (other strain)

CBMI010004690.1|c8772-4560 ANFV01000109.1|:212834217048 ANFV01000154.1|:258353263142 (2) AYJV01000213.1|:c14123-9906 AYJV01002387.1|:c1691712133 (2) Includes a frameshift APKU01000014.1|:8279387152 APKB01000178.1|:634-4993

NA NA

AOHE01000160.1|:c138459134125 AMZD01000013.1|:171575175819 AQHS01000110.1|:c658820654545 AWEQ01000108.1|:2071625070 AIID01010287.1|:1310-5540 AIID01010551.1|:4919-8737 (N-terminus) (2) AIID01010204.1|:1-953 (Cterminus) (2) ARNU01000008.1|:180313184562 AORF01002279.1|:7649-11889 CACQ02000903.1|4227-7826 (N-terminus) CACQ02001357.1|86-1198 (Cterminus) ANPB01001438.1|:558-4769 ANPB01003480.1|:c3172126700 (2)

NA

AMYD01003168.1|:c568-1 (Nterminus) AMYD01002424.1|:1-3577 (Cterminus) AMYD01001480.1|:1014815155 (2) AMCV01007890.1|:c6433-2232 AYRD01005743.1|:c4650442236 AYRD01007500.1|:1650321162 (2) AORD01000096.1|:c2864324415 AORD01000675.1|:c2254918042 (2) APWK02000097.1|:3411538646 AOSW01007804.1|:c960-8 (Nterminus)

NA

NA NA

NA F503_00401

EPE07679

HMPREF1624_ 08655 NA

ERS94944

PFICI_08825

XP_007835597

UCREL1_7929 CH063_05924 (N-term) CH063_06870 (C-term) CGGC5_4347 CGGC5_10775 (N-term) CGGC5_10774 (C-term) Locus not annotated CGLO_11610

XP_007795805 CCF33816 (N-term)

CGLO_07347

EQB52978 (almost OK) (2)

Cob_13466 NA

ENH77218

UCRPA7_883

XP_007911665

UCRPA7_4126

XP_007914875 (2)

NA NA

CCF34999 (C-term) XP_007274869 XP_007282293 (N-term) (2) XP_007282292 (C-term) (2) absent EQB49081

chlamydosporia

(JGI) Anthostoma avocetta * (JGI) Apiospora montagnei * (JGI) Glomerella acutata aka Colletotrichum fiorinae (also at NCBI) (JGI) Glomerella cingulata aka Colletotrichum gloeosporoides (JGI) Hypoxylon sp. CI-4A (also at NCBI) (JGI) Hypoxylon sp. CO27-5 (also at NCBI) (JGI) Hypoxylon sp. EC38 (also at NCBI) (JGI) Ilyonectria sp. * (JGI) Sodiomyces alkalinus * (JGI) Trichoderma asperellum * (JGI) Trichoderma harzianum * Ichthyosporea (Opisthokonta) Sphaeroforma arctica Capsaspora owczarzaki

Metazoa (Opisthokonta) Amphimedon queenslandica Caenorhabditis elegans Drosophila melanogaster Bos taurus Trichoplax adhaerens

AOSW01007803.1|:c1163-3 (centre) AOSW01007802.1|:c113198973 (C-terminus) scaffold_26|513374|517604

(JGI) *

scaffold_128|73959|78209 (AP)

(JGI) *

scaffold_27|90095|94323 (AP)

(JGI)

scaffold_9|1386510|1390721 (AP) scaffold_7|512563|517601 (AP) (2) scaffold_36|159626|163847 scaffold_65|18438|23298 (AP) (2) scaffold_120|76383|80602 (AP) scaffold_173|28821|33659 (AP) (2) scaffold_112|119391|123610 scaffold_19|20052|24890 (AP) (2) scaffold_8|1633339|1637549

(JGI)

scaffold_12|1114514|1118775 (AP) scaffold_8|868478|872740

(JGI) *

scaffold_14|680395|684644

(JGI) *

AEOD01005612.1|:c2179411053 ACFS02000276.1|:7908-13454

SARC_06399

ND

LOC100631741

XP_011403627

ND ND ND ND

CELE_F55B11 Dmel_CG7642 XDH_BOVIN TRIADDRAFT _27111 NEMVEDRAF T_v1g192610 NA

CAB05902 AAF54895 (rosy) P80457 EDV24053

ELU12941

XP_001307869

(JGI)

(JGI)

(JGI)

(JGI) *

(JGI) *

CAOG_005326

Nematostella vectensis

ND

Evechinus chloroticus

Capitella teleta

GAPB01058245.1|:117-4058 (TSA: transcribed RNA sequence) ND

Aplysia californica

ND

CAPTEDRAFT _198744 LOC101862427

Parabasalia, Excavata Trichomonas vaginalis G3

AAHC01000999.1|:11860-

TVAG_433470

XP_014155170 (the C-terminus shows no holology) KJE94733 (the C-terminus shows no homology)

XP_001625891

XP_012939897

15783 Metamonada, Excavata Trimastix pyriformis (RCP-MX)

GAFH01000714.1|:c4117-36 (TSA: transcribed RNA sequence) Includes frameshift

NA

AEIE01002225.1|:c130846124920

GUITHDRAFT _164776

XP_005827081

AAFI02000174.1|:22223-26488

DDB_G029104 7

XP_635420

ADVD01001535.1|:c2800323797

AMSG_11410

XP_013752713 (the protein is too short at the N-terminus)

CAKH01001095.1|:2166125845 AROW01002701.1|:2482-6783

CHC_T0000621 6001 NA

XP_005718689

Viridiplantae, Archaeplastida Bathycoccus prasinos Chlamydomonas reinhardtii Physcomitrella patens

ND ND

XP_007510146 EDP03026

Selaginella moellendorffii

ND

Arabidopsis thaliana Zea mays

ND ND

Bathy11g02970 CHLREDRAFT _117669 PHYPADRAFT _162514 SELMODRAFT _83922 AT4G34890 LOC100384368

AIJL01000187.1|:10838-15096 ADOS01000675.1|:c179221174896 AAQY02000076.1|:329675334024 AHJF01000177.1|:c11719-7361

SDRG_01208 NA

XP_008604947

PHYSODRAFT _295142 NA

XP_009517573

GAGR01000097.1|:177-4547 (TSA: transcribed RNA sequence) ACJI01000839.1|:10653-14825

Naga_100208g3

EWM22353

AURANDRAF T_36810 PHATRDRAFT _15968

XP_009034984

Cryptophyta, Chromista Guillardia theta

Amoebozoa, Unikonta Dictyostelium discoideum AX4 Apusozoa, Bikonta Thecamonas trahens

Rhodophyta, Archaeplastida Chondrus crispus Porphyridium purpureum

Oomycetes, Stramenopiles (Heterokonta) Saprolegnia diclina Pythium ultimum Phytophthora sojae Pseudoperonospora cubensis Ochrophyta, Stramenopiles (Heterokonta) Nannochloropsis gaditana

Aureococcus anophagefferens Phaeodactylum tricornutum

ND

ABQD01000070.1|:467845472860

EDQ74505 EFJ33495 AEE86434 XP_008657455

XP_002184143 (inextant intron was annotated)

Thalassiosira pseudonana

AAFD02000038.1|:335161340359

THAPSDRAFT _270071

XP_002294840 (inextant introns were annotated)

NB: PH encoding loci were manually deduced for the fungal kingdom Letters in bold indicate groups of Eukaryotes Green coloured text: hxnS orthologues tagged (2) Red coloured text: genes are either wrongly annotated or the gene-products are supposedly non-functional. In parenthesis, some explanation thereto is given. Grey highlighted text: taxonomical classification is dubious ND: not deduced by us NA: genome not annotated The blue star (*) indicates each of the fungal species for which the use of the JGI genome sequences was explicitly permitted with a view to manually deduce HxA, HxnS and HxnR proteins for comparative purposes (PH phylogeny and Consurf analysis) prior to publication of these genome sequences. For contact details of the Principal Investigators of the genome projects involved, we refer to the Info pages of the corresponding JGI genome portals. NOTES: Leotiomycetes (Erysiphales): Erysiphe necator (5 strains) and Erysiphe pisi have no PH in their genome. Piedraia hortae (Dothideomycetes; Capnodiales; Piedraiaceae) does not appear to have PHI (HxA) nor PHII (HxnS). References: Glatigny, A. & Scazzocchio, C. (1995). Cloning and molecular characterization of hxA, the gene coding for the xanthine dehydrogenase (purine hydroxylase I) of Aspergillus nidulans. J Biol Chem 270, 35343550.

Table S2. Gain- and loss-of-function alleles of hxnR and hxnS hxnR or hxnS strain name parental strain changed changed amino acid alleles nucleotide hxnRc100 HZS.354 HZS.248 T751G Y226D hxnRc101 HZS.355 T757C W228R c hxnR 102 HZS.452 C730G P219A hxnRc103 HZS.453 A1883C K603T c hxnR 104 HZS.454 T751G Y226D hxnRc105 HZS.455 T751G Y226D c hxnR 106 HZS.456 T751G Y226D c hxnR 107 HZS.457 T751G Y226D hxnRc108 HZS.458 G1884T K603N c hxnR 109 HZS.459 T751A Y226N hxnRc110 HZS.460 T757C W228R c hxnR 150* HZS.461 G784T, G787C D237Y,A238P hxnRc151* HZS.462 G1884T K603N c hxnR 152* HZS.463 T751A Y226N c hxnR 200 HZS.464 HZS.98 T764C F230S hxnRc201 HZS.465 T757C W228R c hxnR 202 HZS.466 T751G Y226D hxnRc203 HZS.467 A1882G K603E c hxnR 300 HZS.468 HZS.418 C731T P219L hxnRc301 HZS.469 T757C W228R c hxnR 302 HZS.470 T764C F230S c hxnR 303 HZS.471 T757C W228R hxnRc304 HZS.472 A1894C T607P c hxnR 305 HZS.473 T1769C F565S hxnRc306 HZS.474 A752C Y226S c hxnR 307 HZS.475 G758C W228S hxnRc308 HZS.476 T791C F239S c hxnR 309 HZS.477 T1769C F565S c hxnR 310 HZS.478 T763A F230I hxnRc311 HZS.479 A754G N227D c hxnR 7** FGSCA872 FGSC A26 G1884T K603N hxnRc48** CS51.2 C1990T R639C hxnR2** CS302 A148 G227A G76D hxnR3** CS302.2 G1833A W578STOP hxnR80*** HZS.220 TN0 A21 A244G K82E hxnS29** HZS.113 CS51.10.1 T3668C F1213S hxnS35** HZS.110 FGSC A872 98STOP (182-185) hxnS41** HZS.109 1162STOP G3064T; 3066 Asterisks indicate the applied mutagenesis. * 4-Nitroquinoline N-oxide mutagenesis, ** Methylnitronitrosoguanidine mutagenesis, *** PCR-based mutagenesis. All other alleles were obtained by UV mutagenesis. Highlighted amino acid changes in the same background color mark missense mutations in one and the same codon.

Table S3. Orthologue hxnR loci and accession numbers of corresponding HxnR orthologues. These only concern the proteins used for the Consurf analysis of the zinc-finger regulator HxnR (figure S4) and the data given are thus not all inclusive. Species (126 Pezizomycotina) Eurotiomycetes Aspergillus nidulans

hxnR gene locus (manually deduced)

Assigned locus number (NCBI)

Assigned Protein Accession number (NCBI)

AACD01000170.1|:2 3303-25963 scaffold_14|380488|3 82993 scaffold_16|324591|3 27084 (AP) AP007164.1|:c23256 14-2323089 AAIH02000271.1|:c1 9461-16936 BACA01000149.1|:1 4054-16582 AAJN01000215.1|:c5 9094-56517

AN11197

CBF82382 (the N-terminus is longer with 6 AAs)

(JGI) Aspergillus aculeatus (also at NCBI) (JGI) Aspergillus carbonarius (also at NCBI) Aspergillus niger CBS 513.88 (JGI) Aspergillus brasiliensis (also at NCBI) Aspergillus kawachii

scaffold_11|1086464| 1088927 scaffold_11|986537|9 89113 (AP) NT_166520.1|:28267 9-285269 scaffold_12|149966|1 52584 BACL01000152.1|:c8 7133-84533

(JGI)

(JGI) Aspergillus acidicus aka A. foetidus aka A. luchuensis (also at NCBI) (JGI) Aspergillus tubingensis (also at NCBI) (JGI) Aspergillus wentii (also at NCBI) (JGI) Aspergillus glaucus (also at NCBI) JGI) Eurotium rubrum aka Aspergillus ruber (at NCBI) Penicillium carneum

scaffold_3|3378193|3 380793 (AP)

(JGI)

scaffold_3|293413|29 6013 scaffold_10|94813|97 253 scaffold_3|1123372|1 126027 scaffold_2|25866|285 21 (AP)

(JGI)

CBXS010002886.1|4 010-6563 CBMR010000287.1| 11236-13789 CBVV010000512.1|c 46348-43798 ALJY01002280.1|:c4 202-1667 CBXO010000164.1|3 4125-36675 CBXN010000112.1|1 84473-187026 CBXP010000195.1|3

NA

(JGI) Aspergillus sydowii (also at NCBI) (JGI) Aspergillus versicolor (also at NCBI) Aspergillus oryzae RIB40 Aspergillus flavus Aspergillus sojae Aspergillus terreus

Penicillium roqueforti Penicillium camemberti Penicillium aurantiogriseum Penicillium biforme Penicillium paneum Penicillium fuscoglaucum

(JGI) (JGI) AOR_1_1570114

XP_003190358

AFLA_063610

XP_002379105 (at the N-terminus the protein is shorter with 50 AAs)

NA ATEG_08618

XP_001217204 (the N-terminus is too long and carries deleterious gaps)

(JGI) ANI_1_1050034

XP_001390050

AKAW_05051

GAA86937 (the N-terminus is too short and one intron is overlooked in the coding sequence)

(JGI) (JGI) (JGI)

PROQFM164_S0 4g001025 PCAMFM013_S 022g000208 NA NA NA NA

CDM36144 (the N-terminus is longer with 5 AAs) CRL27528 (the N-terminus is longer with 5 AAs)

Penicillium digitatum Pd1 Penicillium paxilli Penicillium citrinum (JGI) Monascus purpureus * (JGI) Monascus ruber (also at NCBI) Talaromyces stipitatus ATCC 10500 Talaromyces marneffei ATCC 18224 (JGI) Talaromyces aculeatus * Byssochlamys spectabilis (JGI) Thermoascus aurantiacus * Blastomyces gilchristii SLH14081 aka Ajellomyces dermatitidis Histoplasma capsulatum G186AR aka Ajellomyces capsulatus Paracoccidioides brasiliensis Pb03 (JGI) Gymnascella aurantiaca * Cyphellophora europaea Capronia coronata Capronia epimyces

Cladophialophora yegresii Phaeomoniella chlamydospora RR-HG1 Phaeomoniella chlamydospora UCRPC4 Dothideomycetes Phaeosphaeria nodorum Pyrenochaeta sp. UM 256 Pyrenochaeta lycopersici

Pleosporales sp. UM 1110

5162-37712 AKCU01000378.1|:c 73339-70788 AOTG01000616.1|:3 1558-34092 LKUP01000591.1|:17 538-22514 scaffold_46|125844|1 28757 (AP) scaffold_149|16408|1 9320 ABAS01000027.1|:c1 49321-146803 ABAR01000002.1|:1 362859-1365445 scaffold_1|4922711|4 925290 BAUL01000291.1|98 40-12835 scaffold_9|344642|34 7679 (AP) ACBU01001509.1|:c 45470-42265

PDIP_55780

XP_014532804 (too short at the Nterminus)

NA NA (JGI) * (JGI) TSTA_050470

XM_002485516

PMAA_031780

XP_002144843 (too long at the Nterminus)

(JGI) * PVAR5_8008

GAD99297

(JGI) * BDBG_09400

XP_002620220 (carries a deletion, which results in frameshift)

ABBS02000272.1|:1 0427-13670

HCBG_09164

EEH02599 (carries a large deleterious gap)

ABHV01000435.1|:c 135719-132432 scaffold_35|17908|20 763 (AP) (Pseudo gene) AOBU01000059.1|:1 31907-134781 AMWN01000007.1|: 33338-36527 AMGY01000008.1|:2 0872-24090

PABG_12465

KGY14693

AMGW01000004.1|: 1026744-1029591 JACF01000099.1|:c4 8660-45889 LCWF01000106.1|:c 48562-45791

A1O7_05689

UCRPC4_g0441 4

KKY19713 (wrongly annotated, not recognizable sequence)

AAGI01000083.1|:10 1735-105051 AOUM01000070.1|:3 3523-36976 GAJI01016548.1|:c29 08-83 (TSA: transcribed RNA sequence) AJMS01010346.1|:25 001-28253 NB. Partial at edge of

SNOG_04192

XP_001794616 (at the N-terminus the protein is shorter with 100 AAs)

(JGI) *

HMPREF1541_0 8507 A1O1_07578 A1O3_08403

XP_008722826 (the N-terminus is 30 AA shorter) XP_007728445 (at the N-terminus the protein is shorter with 60 AAs) XP_007738501 (too short at the Nterminus and carries deleterious gap) XP_007757887 (at the N-terminus the protein is shorter with 15 AAs)

NA

NA NA

NA

Leptosphaeria maculans

Pyrenophora triticirepentis Pyrenophora teres f. teres Pyrenophora seminiperda Alternaria brassicicola Alternaria arborescens (JGI) Setosphaeria turcica (also at NCBI) Shiraia sp. Slf14 Corynespora cassiicola (JGI) Cucurbitaria berberidis * (JGI) Didymella exigua * (JGI) Dothidotthia symphoricarpi * (JGI) Lentithecium fluviatile * (JGI) Lophiostoma macrostomum * (JGI) Melanomma pulvispyrius * (JGI) Pleomassaria siparia * Helminthosporium solani

Hysterium pulicare Rhytidhysteron rufulum Macrophomina phaseolina MS6 Guignardia citricarpa aka Phyllosticta citricarpa Neofusicoccum parvum

(JGI) Botryosphaeria dothidea (also at NCBI) (JGI) Aplosporella prunicola *

(JGI) Mycosphaerella fijiensis aka Pseudocercospora fijiensis

contig FP929127.1|:190781 0-1911512 AAXI01000364.1|:12 305-15633 AEEY01001409.1|:c5 1169-47837 ATLS01000051.1|:c4 9074-45770 ACIW01000963.1|:5 6805-59911 AIIC01000105.1|:c36 091-33125 scaffold_14|199110|2 02534 AXZN01000045.1|:c 355891-352787 JAQF01000510.1|:94 995-98309 scaffold_4|491158|49 4514 scaffold_30|129433|1 32777 (AP) scaffold_4|1553600|1 556996 (AP) scaffold_19|66693|69 719 scaffold_181|15049|1 8274 scaffold_214|56963|6 0202 scaffold_17|632646|6 36107 (AP) AWWW01001360.1|: 16328-19540 NB. Partial at edge of contig AJFK01000232.1|:c2 9646-26356 AJFL01001926.1|:c3 544-206 AHHD01000030.1|:1 00300-104036 AOTE01002292.1|:c4 704-713 AORE01000907.1|:c 3154-1 (N-terminus) AORE01001369.1|:7579 (C-terminus) scaffold_402|35000|3 8696 scaffold_2|624735|62 8493 NB. Partial at edge of contig scaffold_5|809879|81 2505

LEMA_P029460

PTRG_07699 PTT_07496

XP_003839273 (carries deleterious gaps and the protein is shorter with 70 AAs) XP_001938031 (carries deleterious gaps and the protein is too short) XP_003297180 (protein is shorter with 80 AAs)

NA NA NA (JGI) NA NA (JGI) * (JGI) * (JGI) * (JGI) * (JGI) * (JGI) * (JGI) * NA

NA NA MPH_00565

EKG22110 85 (the N-terminus is shorter with 85 AAs)

NA UCRNP2_5271 (N-terminus)

(JGI) (JGI) *

(JGI)

XP_007584552 (N-terminus)

(at NCBI) Pseudocercospora pinidensiflorae Mycosphaerella laricina Mycosphaerella sp. Ston1 Cladosporium sphaerospermum

(JGI) Dothistroma septosporum (also at NCBI) (JGI) Septoria musiva aka Sphaerulina musiva (also at NCBI) (JGI) Septoria populicola aka Sphaerulina populicola (also at NCBI) (JGI) Zasmidium cellare * Aureobasidium pullulans AY4 (JGI) Aureobasidium pullulans var. subglaciale EXF-2481 (also at NCBI) (JGI) Cenococcum geophilum (also at NCBI) (JGI) Lepidopterella palustris (also at NCBI) (JGI) Myriangium duriaei *

(JGI) Patellaria atrata * (JGI) Zopfia rhizophila * Sordariomycetes Fusarium oxysporum Fo5176 Fusarium oxysporum f. sp. lycopersici 4287 Fusarium fujikuroi B14 Fusarium verticillioides aka Gibberella moniliformis

Fusarium circinata

Fusarium acuminatum

AWYD01000740.1|:c 516816-514199 AWYE01001109.1|:c 24071-21180 AWYF01000450.1|:1 0814-14321 AIIA01013032.1|:c36 14-1084 NB. Partial at edge of contig scaffold_6|602123|60 4975

NA

scaffold_6|979027|98 2647 (AP)

(JGI)

scaffold_10|119993|1 23959 (AP) NB. Undefined areas in penultimate intron scaffold_6|549912|55 2542 (AP) AMCU01000011.1|:c 35282-32442 scaffold_10|149795|1 52616 (AP)

(JGI)

scaffold_11|229142|2 32863 scaffold_77|61204|64 603 (AP) scaffold_14|693037|6 95801 (hxnR1) scaffold_8|1253906|1 256729 (AP) (hxnR2) scaffold_16|57894|61 339 scaffold_19|1841613| 1844800

(JGI)

AFQF01002414.1|:17 394-20421 AAXH01001227.1|:c 8745-5697 ANFV01000166.1|:c 39590-36504 AAIM02000142.1|:1 28314-131338 (hxnR1) AAIM02000047.1|:c2 11441-208608 (hxnR2) AYJV01000420.1|:c9 1047-87962 NB. Partial at edge of contig CBMG010000685.1| 53703-56749

FOXB_07972

EGU81522

FOXG_17380

KNB20316

NA NA NA

(JGI)

(JGI) * NA (JGI)

(JGI) (JGI) *

(JGI) * (JGI) *

NA FVEG_11007 FVEG_03388

NA

NA

EWG52212 EWG41242 (unhomologous region in the middle of the protein)

Nectria haematococca Fusarium virguliforme (JGI) Ilyonectria sp. * Glomerella graminicola aka Colletotrichum graminicola Colletotrichum orbiculare Colletotrichum fioriniae (JGI) Glomerella acutata aka Colletotrichum fiorinae MH 18 (at NCBI) Colletotrichum gloeosporioides Cg-14 (JGI) Glomerella cingulata aka Colletotrichum gloeosporoides Grosmannia clavigera Ophiostoma novo-ulmi subsp. novo-ulmi Ophiostoma piceae Eutypa lata Pestalotiopsis fici Daldinia eschscholzii UM1020 (JGI) Anthostoma avocetta * (JGI) Hypoxylon sp. CI-4A (also at NCBI) (JGI) Hypoxylon sp. CO27-5 (also at NCBI) (JGI) Hypoxylon sp. EC38 (also at NCBI) Diaporthe longicolla MSPL 10-6 Togninia minima aka Phaeoacremonium aleophilum (JGI) Leotiomycetes Glarea lozoyensis (JGI) Amorphotheca resinae (also at NCBI) (JGI) Chalara longipes * (JGI) Meliniomyces bicolor * (JGI) Meliniomyces variabilis * Fungal sp. EF0021

ACJF01000056.1|:c1 15648-112600 AEYB01000915.1|:4 7734-50770 scaffold_4|3041407|3 044563 ACOD01000324.1|:c 55773-52579

NECHADRAFT_ 102108 NA

XP_003040920 (N-terminus sequence is longer with 16 AAs)

GLRG_11296

XP_008100172

AMCV01004979.1|:c 255501-252355 JARH01000269.1|:c3 46795-343566 scaffold_49|221146|2 24379 (AP)

Cob_08884

ENH82459 (an intron is overlooked) XP_007593481

AMYD01000831.1|:c 17493-14325 scaffold_2|843861|84 7029 (AP)

CGLO_04093

ACXQ02000048.1|:3 76723-380065 AMZD01000132.1|:7 3343-76666 AQHS01000229.1|:1 28284-131592 AORF01001865.1|:c2 6181-23062 ARNU01000067.1|:c 206030-203109 AIID01007324.1|:c30 08-69 scaffold_33|540390|5 43402 (AP) scaffold_65|28475|31 363 scaffold_173|36751|3 9802 scaffold_19|28113|31 172 AYRD01007761.1|:c 16270-13226 AORD01000689.1|:c 71201-68278

CMQ_5378

ALVE01000002.1|:4 28703-431536 scaffold_11|1036280| 1039464 (AP) scaffold_6|1389484|1 392661 scaffold_15|875918|8 79209 scaffold_4|1069211|1 072404 AIET01001355.1|:93 2028-935093

GLAREA_08870

(JGI) *

CFIO01_01344 (JGI)

EQB55919 (gene carries long deletion)

(JGI)

XP_014174598 (an annotated intron is inexistent)

NA F503_04661

EPE04146

UCREL1_6605

XP_007794499 (only C-terminus is found) XP_007830069

PFICI_03297 NA (JGI) * (JGI) (JGI) (JGI) NA Locus is not recognised

(JGI) (JGI) * (JGI) * (JGI) * NA

XP_008076022

Xylonomycetes (JGI) Xylona heveae (also at NCBI) (JGI) Trinosporium guianense * (JGI) Symbiotaphrina kochii * Pezizomycetes Tuber melanosporum (JGI) Choiromyces venosus * (JGI) Morchella conica * (JGI) Morchella importuna *

scaffold_2|3056269|3 059646 scaffold_77|88733|92 038 scaffold_6|1202438|1 205513

(JGI)

CABJ01000281.1|c14 5729-143254) scaffold_106|6103|95 95 scaffold_64|63084|65 030 (AP) scaffold_44|107091|1 09037

GSTUM_000079 14001 (JGI) *

(JGI) * (JGI) *

XP_002839756 (C-terminus is not correct)

(JGI) * (JGI) *

NA: genome not annotated NB: All gene models were manually deduced Red coloured text: genes are either wrongly annotated or the gene-products are supposedly non-functional. Between parenthesis, some explanation thereto is given. AA: amino acids The blue star (*) indicates each of the fungal species for which the use of the JGI genome sequences was explicitly permitted with a view to manually deduce HxA, HxnS and HxnR proteins for comparative purposes (PH phylogeny and Consurf analysis) prior to publication of these genome sequences. For contact details of the Principal Investigators of the genome projects involved, we refer to the Info pages of the corresponding JGI genome portals.

Table S4. The loci of hxnS and/or hxnR genes in species in six classes of Pezizomycotina. Note that these two genes do not occur in currently genome-sequenced species in the Orbiliomycetes and Lecanoromycetes classes. This table is not all inclusive. Code

species

hxnS gene locus

hxnR gene locus

L

Eurotiomycetes Aspergillus nidulans

Aspergillus niger CBS 513.88

AACD01000170.1|:2776032118 AAJN01000215.1|:c5460050204 BACL01000152.1|:c7857974163 NT_166520.1|:290799-295216

R

Aspergillus flavus

-

R

Aspergillus oryzae RIB40

-

R

Aspergillus sojae

-

S

Neosartorya udagawae

S

Neosartorya fischeri

L

(JGI) Aspergillus carbonarius

L L

(JGI) Aspergillus aculeatus (JGI) Aspergillus acidicus aka Aspergillus foetidus aka Aspergillus luchuensis (JGI) Aspergillus brasiliensis (JGI) Aspergillus glaucus (JGI) Aspergillus sydowii (JGI) Aspergillus tubingensis (JGI) Aspergillus versicolor

BBXM01000084.1|:615272619624 AAKE03000012.1|:159786164138 scaffold_11|980305|984734 (AP) scaffold_11|1089314|1093677 scaffold_3|3367804|3372220 (AP)

AACD01000170.1|:2330325963 AAJN01000215.1|:c5909456517 BACL01000152.1|:c8713384533 NT_166520.1|:282679285269 AAIH02000271.1|:c1946116936 AP007164.1|:c23256142323089 BACA01000149.1|:1405416582 -

L

Aspergillus terreus

L

Aspergillus kawachii

L

L L L L L R L

scaffold_11|986537|989113 (AP) scaffold_11|1086464|1088927 scaffold_3|3378193|3380793 (AP)

scaffold_12|159753|164160 scaffold_3|1126936|1131415 scaffold_14|384592|388975 scaffold_3|303186|307597 scaffold_16|318700|322980 (AP) scaffold_2|20378|24860 (AP)

scaffold_12|149966|152584 scaffold_3|1123372|1126027 scaffold_14|380488|382993 scaffold_3|293413|296013 scaffold_16|324591|327084 (AP) scaffold_10|94813|97253 scaffold_2|25866|28521 (AP)

-

CBXS010002886.1|40106563 AKCU01000378.1|:c7333970788 CBMR010000287.1|1123613789 ALJY01002280.1|:c42021667 CBXO010000164.1|3412536675 CBXN010000112.1|184473187026 CBVV010000512.1|c4634843798 CBXP010000195.1|3516237712 AOTG01000616.1|:3155834092 LKUP01000289.1|:123220-

R

(JGI) Aspergillus wentii (JGI) Eurotium rubrum aka Aspergillus ruber Penicillium carneum

R

Penicillium digitatum Pd1

-

R

Penicillium roqueforti

-

R

Penicillium aurantiogriseum

-

R

Penicillium biforme

-

R

Penicillium paneum

-

R

Penicillium camemberti

-

R

Penicillium fuscoglaucum

-

U

Penicillium paxilli

U

Penicillium citrinum

AOTG01000229.1|:c6229457402 LKUP01000591.1|:17538-

L

Byssochlamys spectabilis

22514 BAUL01000291.1|16075-20649

L

(JGI) Thermoascus aurantiacus

scaffold_9|337380|342034 (AP)

U

(JGI) Monascus purpureus

scaffold_44|18569|23142

U R

(JGI) Monascus ruber Talaromyces marneffei

scaffold_22|26888|31451 -

R

Talaromyces stipitatus

-

R L

L

(JGI) Talaromyces aculeatus Blastomyces gilchristii SLH14081 aka Ajellomyces dermatitidis Histoplasma capsulatum G186AR aka Ajellomyces capsulatus Paracoccidioides brasiliensis Pb03

L

(JGI) Gymnascella aurantiaca

ACBU01001509.1|:c3855033943 ABBS02000272.1|:1708321682 ABHV01000435.1|:c128734124085 scaffold_35|10540|15109 (AP)

S L

(JGI) Gymnascella citrina Cyphellophora europaea

R

Capronia coronata

scaffold_29|233058|237606 AOBU01000059.1|:c129366124948 -

R

Capronia epimyces

-

R

Cladophialophora yegresii

-

L

JACF01000099.1|:51840-56436

L

Phaeomoniella chlamydospora RR-HG1 Leotiomycetes Glarea lozoyensis

S S

Botrytis cinerea B05.10 Sclerotinia sclerotiorum

S

Sclerotinia borealis

L

Fungal sp. EF0021

R

(JGI) Amorphotheca resinae

U U U L

(JGI) Chalara longipes (JGI) Meliniomyces bicolor (JGI) Meliniomyces variabilis Xylonomycetes (JGI) Xylona heveae

L L

(JGI) Trinosporium guianense (JGI) Symbiotaphrina kochii

L

Pezizomycetes Tuber melanosporum

L L L

(JGI) Choiromyces venosus (JGI) Morchella conica (JGI) Morchella importuna

L

ALVE01000002.1|:421387426045 AAID01000672.1|:c5950-1449 AAGT01000385.1|:c129008393 AYSA01000181.1|:c4508040566 AIET01001355.1|:849201853859 scaffold_6|178635|183273 (AP) scaffold_15|1921817|1926458 scaffold_32|313469|318096

125746 BAUL01000291.1|984012835 scaffold_9|344642|347679 (AP) scaffold_46|125844|128757 (AP) scaffold_149|16408|19320 ABAR01000002.1|:13628591365445 ABAS01000027.1|:c149321146803 scaffold_1|4922711|4925290 ACBU01001509.1|:c4547042265 ABBS02000272.1|:1042713670 ABHV01000435.1|:c135719132432 scaffold_35|17908|20763 (AP) (Pseudo gene) AOBU01000059.1|:131907134781 AMWN01000007.1|:3333836527 AMGY01000008.1|:2087224090 AMGW01000004.1|:10267441029591 JACF01000099.1|:c4866045889 ALVE01000002.1|:428703431536 AIET01001355.1|:932028935093 scaffold_11|1036280|1039464 (AP) scaffold_6|1389484|1392661 scaffold_15|875918|879209 scaffold_4|1069211|1072404

scaffold_2|3048379|3053309 (AP) scaffold_77|80761|85664 (AP) scaffold_6|1194725|1199337 (AP)

scaffold_2|3056269|3059646

CABJ01000281.1|c139110134465 scaffold_106|11655|16299 scaffold_64|55926|60640 (AP) scaffold_44|111510|116194

CABJ01000281.1|c145729143254 scaffold_106|6103|9595 scaffold_64|63084|65030 (AP) scaffold_44|107091|109037

scaffold_77|88733|92038 scaffold_6|1202438|1205513

S

(JGI) Sarcoscypha coccinea

U

Sordariomycetes Fusarium oxysporum Fo5176

scaffold_101|113340|117827 (AP)

scaffold_101|118102|119164 (AP) AFQF01002414.1|:1739420421 AAXH01001227.1|:c87455697 ANFV01000166.1|:c3959036504 AAIM02000142.1|:128314131338

U

Fusarium verticillioides aka Gibberella moniliformis

U

Nectria haematococca

U

Fusarium virguliforme

AFQF01002934.1|:c4754942757 AAXH01000944.1|:c2812223329 ANFV01000154.1|:258353263142 gb|AAIM02000166.1|:c282447278039 NB. Partial at edge of contig ACJF01000017.1|:589089593861 AEYB01001709.1|:4637-9519

R

Fusarium acuminatum

-

U

Fusarium circinata

AYJV01002387.1|:c1691712133

R R

-

R

(JGI) Ilyonectria sp. Glomerella graminicola aka Colletotrichum graminicola Colletotrichum orbiculare

R

Colletotrichum fioriniae

-

U

Colletotrichum gloeosporioides Cg-14 (JGI) Glomerella cingulata aka Colletotrichum gloeosporoides Grosmannia clavigera

AMYD01001480.1|:1014815155 scaffold_7|512563|517601 (AP)

-

R

Ophiostoma novo-ulmi subsp. novo-ulmi Ophiostoma piceae

U

Diaporthe longicolla

U R

Togninia minima aka Phaeoacremonium aleophilum Eutypa lata

AYRD01007500.1|:1650321162 AORD01000675.1|:c2254918042 -

R

Pestalotiopsis fici

-

U

Daldinia eschscholzii UM1020

R

(JGI) Anthostoma avocetta

AIID01010551.1|:4919-8737 (N-terminus) AIID01010204.1|:1-953 (Cterminus) -

L L L L

(JGI) Hypoxylon sp. CI-4A (JGI) Hypoxylon sp. CO27-5 (JGI) Hypoxylon sp. EC38 Dothideomycetes Phaeosphaeria nodorum

L

Pyrenochaeta sp. UM 256

U U

U R R

Fusarium oxysporum f. sp. lycopersici 4287 Fusarium fujikuroi B14

-

-

-

ACJF01000056.1|:c115648112600 AEYB01000915.1|:4773450770 CBMG010000685.1|5370356749 AYJV01000420.1|:c9104787962 NB. Partial at edge of contig scaffold_4|3041407|3044563 ACOD01000324.1|:c5577352579 AMCV01004979.1|:c255501252355 JARH01000269.1|:c346795343566 AMYD01000831.1|:c1749314325 scaffold_2|843861|847029 (AP) ACXQ02000048.1|:376723380065 AMZD01000132.1|:7334376666 AQHS01000229.1|:128284131592 AYRD01007761.1|:c1627013226 AORD01000689.1|:c7120168278 AORF01001865.1|:c2618123062 ARNU01000067.1|:c206030203109 AIID01007324.1|:c3008-69

scaffold_65|18438|23298 (AP) scaffold_173|28821|33659 (AP) scaffold_19|20052|24890 (AP)

scaffold_33|540390|543402 (AP) scaffold_65|28475|31363 scaffold_173|36751|39802 scaffold_19|28113|31172

AAGI01000083.1|:96257100778 AOUM01000070.1|:28064-

AAGI01000083.1|:101735105051 AOUM01000070.1|:33523-

L

Pleosporales sp. UM 1110

32595 AJMS01010346.1|:1975024271

L

Pyrenophora tritici-repentis

AAXI01000364.1|:6843-11423

L

Pyrenophora teres f. teres

AEEY01001409.1|:c5662652046

L

Pyrenophora seminiperda

L

Alternaria brassicicola

L

Alternaria arborescens

ATLS01000051.1|:c5453249953 ACIW01000963.1|:4619150768 AIIC01000105.1|:c41447-36871

L

Leptosphaeria maculans

FP929127.1|:1901889-1906466

L

Shiraia sp. Slf14

L

Corynespora cassiicola

AXZN01000045.1|:c360961356434 JAQF01000510.1|:88857-93446

L L L

(JGI) Setosphaeria turcica (JGI) Cucurbitaria berberidis (JGI) Didymella exigua

scaffold_14|193421|197997 scaffold_4|485744|490273 scaffold_30|135581|140123

L

(JGI) Dothidotthia symphoricarpi

L L L L

(JGI) Lentithecium fluviatile (JGI) Lophiostoma macrostomum (JGI) Melanomma pulvis-pyrius (JGI) Pleomassaria siparia

L

Helminthosporium solani

scaffold_4|1530881|1535403 (AP) scaffold_19|61487|66021 scaffold_181|9679|14226 scaffold_214|51631|56175 scaffold_17|636855|641532 (AP) AWWW01001360.1|:1068715355

S

L

(JGI) Cochliobolus heterostrophus C5 aka Bipolaris maydis (JGI) Cochliobolus sativus aka Bipolaris sorokiniana Bipolaris oryzae aka Cochliobolus miyabeanus Bipolaris victoriae aka Cochliobolus victoriae Bipolaris zeicola aka Cochliobolus carbonum (JGI) Cochliobolus lunatus aka Curvularia lunata Hysterium pulicare

L L

Rhytidhysteron rufulum Macrophomina phaseolina MS6

L

Guignardia citricarpa aka Phyllosticta citricarpa

L

Neofusicoccum parvum

S S S S S

scaffold_24|84847|89437

36976 AJMS01010346.1|:2500128253 NB. Partial at edge of contig AAXI01000364.1|:1230515633 AEEY01001409.1|:c5116947837 NB. Frameshift in coding seq ATLS01000051.1|:c4907445770 ACIW01000963.1|:5680559911 AIIC01000105.1|:c3609133125 FP929127.1|:19078101911512 AXZN01000045.1|:c355891352787 JAQF01000510.1|:9499598309 scaffold_14|199110|202534 scaffold_4|491158|494514 scaffold_30|129433|132777 (AP) scaffold_4|1553600|1556996 (AP) scaffold_19|66693|69719 scaffold_181|15049|18274 scaffold_214|56963|60202 scaffold_17|632646|636107 (AP) AWWW01001360.1|:1632819540 NB. Partial at edge of contig -

scaffold_9|283965|288571 (AP)

-

AMCO01000106.1|:6301167648 AMCY01000206.1|:c1754012922 AMCN01000091.1|:c1697212354 scaffold_5|265003|269585

-

AJFK01000232.1|:c3484030331 AJFL01001926.1|:c8719-4214 AHHD01000030.1|:9330397853 AOTE01002293.1|:c3937-1 (Nterminus) AOTE01002292.1|:c6905-6298 (C-terminus) AORE01000907.1|:c9850-5340

AJFK01000232.1|:c2964626356 AJFL01001926.1|:c3544-206 AHHD01000030.1|:100300104036 AOTE01002292.1|:c4704-713

-

AORE01000907.1|:c3154-1 (N-terminus) AORE01001369.1|:7-579 (C-

L L

(JGI) Botryosphaeria dothidea (JGI) Aplosporella prunicola

scaffold_402|28207|32803 scaffold_2|619672|624199

S U

R

(JGI) Aulographum hederae (JGI) Mycosphaerella fijiensis aka Pseudocercospora fijiensis Pseudocercospora pini-densiflorae aka Mycosphaerella gibsonii Mycosphaerella laricina

scaffold_44|147458|152399 scaffold_2|4952439|4956861 (AP) AWYD01001792.1|:c2184517419 -

R

Mycosphaerella sp. Ston1

-

R

Cladosporium sphaerospermum

-

R R

(JGI) Dothistroma septosporum (JGI) Septoria musiva aka Sphaerulina musiva (JGI) Septoria populicola aka Sphaerulina populicola

-

R

(JGI) Zasmidium cellare

-

R

Aureobasidium pullulans AY4

-

R

-

L U R

(JGI) Aureobasidium pullulans var. subglaciale EXF-2481 (JGI) Cenococcum geophilum (JGI) Lepidopterella palustris (JGI) Myriangium duriaei

L L

(JGI) Patellaria atrata (JGI) Zopfia rhizophila

scaffold_16|50809|55340 (AP) scaffold_19|1835902|1840427

U

R

-

scaffold_11|224057|228687 scaffold_855|602|5299 (AP) -

terminus) scaffold_402|35000|38696 scaffold_2|624735|628493 NB. Partial at edge of contig scaffold_5|809879|812505 AWYD01000740.1|:c516816514199 AWYE01001109.1|:c2407121180 AWYF01000450.1|:1081414321 AIIA01013032.1|:c3614-1084 NB. Partial at edge of contig scaffold_6|602123|604975 scaffold_6|979027|982647 (AP) scaffold_10|119993|123959 (AP) NB. Undefined areas in penultimate intron scaffold_6|549912|552542 (AP) AMCU01000011.1|:c3528232442 scaffold_10|149795|152616 (AP) scaffold_11|229142|232863 scaffold_77|61204|64603 (AP) scaffold_14|693037|695801 (hxnR1) scaffold_8|1253906|1256729 (AP) (hxnR2) scaffold_16|57894|61339 scaffold_19|1841613|1844800

Codes (left column): L = hxnS and hxnR genes are present and linked; S = hxnS is presenthxnR is absent; R = hxnR is present-hxnS is absent; U = hxnS and hxnR genes are present but unlinked. For genomes accessible at the NCBI’s WGS database, the accession number(s) of the relevant DNA contigs is (are) given. The genome sequences of Aspergillus niger CBS 513.88, Aspergillus oryzae RIB40 and Leptosphaeria maculans JN3 are available from the NCBI’s nr/nt database. (JGI): genome sequences available at JGI; scaffold data are provided for each gene locus. See also the footnotes under Tables S1 and S3. (AP): the coding strand is antiparallel of the scaffold direction in the JGI genomes. Notes: Myriangium duriaei appears to specify two paralog hxnR genes (but no hxnS). Species that have neither hxnR nor hxnS in their genome sequences are not listed (including Aspergillus fumigatus, Aspergillus clavatus, Aspergillus zonatus, Penicillium chrysogenum and Neurospora crassa amongst many others).

Table S5. A. nidulans strains used in this work. (All strains are veA1 mutant) Strain

Genotype

Purpose

Reference

A148

pabaA1 wA3

provided by Herb Arst

CS51.2

hxnRc48 biA1

growth test; UV mutagenesis; sequencing UV mutagenesis

this work

parental strain in genetic crosses with HZS.98 recipient strain in transformation experiment to obtain hxnR deletion mRNA expression analysis; sequencing sequencing RT-PCR RT-PCR growth test; enzyme assay; mRNA expression analysis RT-PCR; parental strain in genetic crosses growth test; recipient strain for transformation; parental strain of HZS.220 parental strain in genetic crosses with CS1132; recipient strain for UV mutagenesis recipient strain in transformation experiment to obtain hxnS deletion protein assay; parental strain in genetic crosses with HZS.122 growth test; protein assay growth test; protein

(Cultrone, et al., 2005)

c

CS1132

hxnR 7 biA1 pyrG89 pantoB100 hxA18 biA1

CS2902

pyrG89 riboB2pyroA4 biA1

CS302

wA4 pabaA1 hxnR2

CS302.2 CS3095 FGSCA26 FGSCA872/ CS51

wA4 pabaA1 hxnR3 areA600 biA1 sb43 biA1 hxnRc7 biA1

NA0313

pantoB100 yA2

TN02 A21

riboB2 pyroA4 nkuA::argB+

HZS.98

pantoB100 pabaA1

HZS.105

hxA::zeo pyrG89 pantoB100 biA1

HZS.106

hxnS::zeo hxA::zeo pyrG89 pantoB100 biA1 pyr4 in trans

HZS.109

hxnS41 hxnRc7 biA1 wA3

HZS.110

hxnS35 hxnRc7 biA1 wA3

CS51.10.1

this work

(Yu, et al., 2004)

this work

this work (Kudla, et al., 1990) (Kafer, 1965) (Scazzocchio, et al., 1973) (Robellet, et al., 2010)

(Nayak, et al., 2006)

this work

this work

this work

this work this work

HZS.113

c

HZS.120

hxnS29 pyrG89 hxnR 7 pantoB100 biA1 riboB2 pabaA1

HZS.122

riboB2 pabaA1 yA2

HZS.135

hxB20 biA1

HZS.136

hxnR::zeo pantoB100

HZS.145

assay growth test; protein assay recipient strain in transformation experiment to obtain hxnS deletion parental strain in genetic crosses with HZS.106 growth test; Northern analysis; RT-PCR growth tests; Northern analysis; RT-PCR, protein assay growth tests; RTPCR RT-PCR

HZS.216

xprD1 biA1 pabaA1

HZS.220

hxnP::riboB+ riboB2 hxnR80 pyroA4 nkuA::argB+

HZS.245

hxA::zeo riboB2 pantoB100 protein assay biA1 recipient strain for hxA::zeo pantoB100 UV and 4pabaA1 yA2 nitroquinoline 1oxide mutagenesis hxnS::zeo biA1 pyr4 in enzyme assay trans

HZS.248

HZS.254

growth test; protein assay

HZS.354

hxA::zeo pantoB100 pabaA1 yA2 hxnRc100

growth test; enzyme assay

HZS.355

hxA::zeo pantoB100

growth test; enzyme

this work (Hamari, et al., 2009)

this work

provided by S. Amillis

this work

this work (Kudla, et al., 1990) provided by Vicky Sophianopoulou this work (hxnR80 mutation was introduced by transformation of the "uphxnP-riboB+downhxnP" hxnP substitution cassette carrying a PCR generated mutation in the hxnP flanking hxnR sequence (will be described elsewhere by Bokor, Flipphi, Ámon, Scazzocchio and Hamari) into TN02 A21) this work this work (obtained by cross of HZS.106 with HZS.122) this work (obtained by cross of HZS.106 with HZS.122) this work (obtained from HZS.248 by UV mutagenesis) this work (obtained from

pabaA1 yA2 hxnRc101

assay

HZS.405

hxA::zeo hxnRc7 pyroA4 pabaA1 yA2

HZS.418

hxA18 pantoB100

control strain in growth tests and protein assays recipient strain for UV mutagenesis

HZS.452



HZS.453



HZS.454



HZS.455



HZS.456



HZS.457



HZS.458



HZS.459



HZS.460



HZS.461



HZS.462



HZS.463



HZS.464

pantoB100 pabaA1 hxnRc200 growth test; enzyme assay

HZS.248 by UV mutagenesis) this work

this work (obtained by cross of HZS.98 with CS1132) this work (obtained from HZS.248 by UV mutagenesis) this work (obtained from HZS.248 by UV mutagenesis) this work (obtained from HZS.248 by UV mutagenesis) this work (obtained from HZS.248 by UV mutagenesis) this work (obtained from HZS.248 by UV mutagenesis) this work (obtained from HZS.248 by UV mutagenesis) this work (obtained from HZS.248 by UV mutagenesis) this work (obtained from HZS.248 by UV mutagenesis) this work (obtained from HZS.248 by UV mutagenesis) this work (obtained from HZS.248 by 4nitroquinoline 1-oxide mutagenesis) this work (obtained from HZS.248 by 4nitroquinoline 1-oxide mutagenesis) this work (obtained from HZS.248 by 4nitroquinoline 1-oxide mutagenesis) this work (obtained from HZS.98 by UV mutagenesis)

HZS.465


HZS.466


HZS.467


HZS.468

hxA18 pantoB100 hxnRc300


HZS.469



HZS.470



HZS.471



HZS.472



HZS.473



HZS.474



HZS.475



HZS.476



HZS.477



HZS.478



HZS.479



HZS.546

alX4 biA1

HZS.599

hxnSΔ::pabaA+ pabaA1 riboB2

parental strain for hxnR deletion growth test; enzyme assay

this work (obtained from HZS.98 by UV mutagenesis) this work (obtained from HZS.98 by UV mutagenesis) this work (obtained from HZS.98 by UV mutagenesis) this work (obtained from HZS.418 by UV mutagenesis) this work (obtained from HZS.418 by UV mutagenesis) this work (obtained from HZS.418 by UV mutagenesis) this work (obtained from HZS.418 by UV mutagenesis) this work (obtained from HZS.418 by UV mutagenesis) this work (obtained from HZS.418 by UV mutagenesis) this work (obtained from HZS.418 by UV mutagenesis) this work (obtained from HZS.418 by UV mutagenesis) this work (obtained from HZS.418 by UV mutagenesis) this work (obtained from HZS.418 by UV mutagenesis) this work (obtained from HZS.418 by UV mutagenesis) this work (obtained from HZS.418 by UV mutagenesis) (Scazzocchio & Darlington, 1968) this work (obtained by transformation of the "ruphxnS-pabaA+-

rdownhxnS" substitution cassette into HZS.120) Explanation of mutant alleles, which are not described in the text: hxA18 is a chain termination mutation at codon 148 of the hxA gene encoding Purine hydroxylase I (Glatigny & Scazzocchio, 1995), hxA::zeo is a deletion of hxA made by gene substitution with zeo marker gene (Hamari and Scazzocchio unpublished), nkuA is deletion of nkuA that is essential for nonhomologous end joining of DNA in double-strand break repair (Nayak, et al., 2006), sb43 is a non-functional allele of the sulphate transporter SB (Arst, 1968), veA1 mutation in velA results in profuse conidiation regardless of the presence or absence of light (Kafer, 1965), yA2 is mutation in yA resulting yellow conidia (Clutterbuck, 1972) and pyr4 is gene for orotidine 5'-phosphate carboxylase in N. crassa (Buxton & Radford, 1983), which complements pyrG89 allele of A. nidulans. Other gene symbols refer to auxotrophies: argB2, arginine; biA1, biotin; pabaA1, p-aminobenzoic acid; pantoB100, pantothenic acid; pyroA4, pyridoxine; pyrG89 uracil or uridine and riboB2, riboflavin.

References: Arst HN, Jr. (1968) Genetic analysis of the first steps of sulphate metabolism in Aspergillus nidulans. Nature 219: 268-270. Buxton FP & Radford A (1983) Cloning of the structural gene for orotidine 5'-phosphate carboxylase of Neurospora crassa by expression in Escherichia coli. Mol Gen Genet 190: 403-405. Clutterbuck AJ (1972) Absence of laccase from yellow-spored mutants of Aspergillus nidulans. J Gen Microbiol 70: 423-435. Cultrone A, Scazzocchio C, Rochet M, Montero-Moran G, Drevet C & Fernandez-Martin R (2005) Convergent evolution of hydroxylation mechanisms in the fungal kingdom: molybdenum cofactorindependent hydroxylation of xanthine via alpha-ketoglutarate-dependent dioxygenases. Mol Microbiol 57: 276-290. Glatigny A & Scazzocchio C (1995) Cloning and molecular characterization of hxA, the gene coding for the xanthine dehydrogenase (purine hydroxylase I) of Aspergillus nidulans. J Biol Chem 270: 35343550. Hamari Z, Amillis S, Drevet C, Apostolaki A, Vagvolgyi C, Diallinas G & Scazzocchio C (2009) Convergent evolution and orphan genes in the Fur4p-like family and characterization of a general nucleoside transporter in Aspergillus nidulans. Mol Microbiol 73: 43-57. Kafer E (1965) Origins of translocations in Aspergillus nidulans. Genetics 52: 217-232. Kudla B, Caddick MX, Langdon T, et al. (1990) The regulatory gene areA mediating nitrogen metabolite repression in Aspergillus nidulans. Mutations affecting specificity of gene activation alter a loop residue of a putative zinc finger. EMBO J 9: 1355-1364. Nayak T, Szewczyk E, Oakley CE, et al. (2006) A versatile and efficient gene-targeting system for Aspergillus nidulans. Genetics 172: 1557-1566. Robellet X, Oestreicher N, Guitton A & Velot C (2010) Gene silencing of transgenes inserted in the Aspergillus nidulans alcM and/or alcS loci. Curr Genet 56: 341-348. Scazzocchio C & Darlington AJ (1968) The induction and repression of the enzymes of purine breakdown in Aspergillus nidulans. Biochim Biophys Acta 166: 557-568. Scazzocchio C, Holl FB & Foguelman AI (1973) The genetic control of molybdoflavoproteins in Aspergillus nidulans. Allopurinol-resistant mutants constitutive for xanthine-dehydrogenase. Eur J Biochem 36: 428-445. Yu JH, Hamari Z, Han KH, Seo JA, Reyes-Dominguez Y & Scazzocchio C (2004) Double-joint PCR: a PCRbased molecular tool for gene manipulations in filamentous fungi. Fungal Genet Biol 41: 973-981.

Table S6. Primers used in this study for qRT-PCR, sequencing, cloning, construction of gene replacement cassettes and obtaining of gene-specific probes. qRT-PCR hxnP ReTi frw hxnP ReTi rev hxnS ReTi frw hxnS ReTi rev hxnT ReTi frw hxnT ReTi rev hxnY ReTi frw hxnY ReTi rev

5’- tgtacttctttgactgcatgg -3’ 5’- gagtattcgttgcccttgag -3’ 5’- gagcatttctatcttgagacga -3’ 5’- ccattgtgttctgggtactg -3’ 5’- ctcgaccagtttctacacgac -3’ 5’- ccgagatgatttcaaggacga -3’ 5’- gtcattcttcgatcctctcacc -3’ 5’- ggttgagtttctcgtcttcgt -3’

hxnZ ReTi frw

5’- cgctgtatttcaactttctccc -3’

hxnZ ReTi rev 5’- cagtagttgcggtaggtcag -3’ hxnR ReTi frw 5’- cggcttctgttctactacagg -3’ hxnR ReTi rev 5’- cagtctaggtctggaaagtctc -3’ actin ReTi frw 5’- ggtatcatgatcggtatggg -3’ actin ReTi rev 5’- tatctgagtgtgaggatacca -3’ AN9174 ReTi frw 5’- ttctttgcacattgccaactc -3’ AN9174 ReTi rev 5’- gcattccaatagcgaaagcc -3’ AN9179 ReTi frw 5’- gtgatgaacgagtacaccca -3’ AN9179 ReTi rev 5’- aggaccttcgtatgcttgac -3’ AN8360 ReTi frw 5’- gcctgggaatctgtatggtg -3’ AN8360 ReTi rev 5’- ccgacaattccaaatgtcttctc -3’ AN5650 ReTi frw 5’- atgtctgctgttatctatctgctc -3’ AN5650 ReTi rev 5’- gccaatcctccttaccttcc- 3’ DNA probes for Northern or Southern analysis hxnS probe frw 5’- tgacactgaggatcttcgca -3’ hxnS probe rev 5’- ggcgatatcactgagatgac -3’ hxnT probe frw 5’- ctttgcgctgcagcaccgtg -3’ hxnT probe rev 5’- gtaggctggcctgctggact -3’ hxnR probe frw 5’- ggtcactgccgttgatatt -3’ hxnR probe rev 5’- atgctctaggcgatggaatga -3’ hxnP probe frw 5’- ccatctcattgcgggtgtag -3’ hxnP probe rev 5’- gactgcatggatcgagtatg -3’ hxnY probe frw 5’- actcttgtccgtacatctcg -3’ hxnY probe rev 5’- cattgatatagtacgggtga -3’ hxnZ probe frw 5’- gtcgatagcctgcaacatcg -3’ hxnZ probe rev 5’- gatatcggctgtccagccac -3’ hxB probe frw 5’- caggtgcttcgtaaatgaagac -3’ hxB probe rev 5’- gaattggcttctccgcaag -3’ actA probe frw 5’- catggaaggtaaggtttctgcc -3’ actA probe rev 5’- cttagaagcacttgcggtgg -3’ hxnS deletion hxnS r up frw 5'- gtgtactcgttcatcacgccaaag -3' hxnS r up rev 5'- cttgctgttggagacgacttgg -3' hxnS r paba chim frw 5'- ccaagtcgtctccaacagcaaggcacatagctattacacgtatgtttgagac -3' hxnS r paba chim rev 5'- catcgccacagctcaagttctgtagtttgcttgaatggctaacgaggcattg -3' hxnS r down frw 5'- agaacttgagctgtggcgatg -3' hxnS r down rev 5'- agagatacagaacatgcatttcttccc -3' hxnS r up nest frw 5'- cagttgaggcatcttgatgtgag -3' hxnT rev 5'- ctattgagcgaaagggtagtccgtatag -3' hxnR and hxnS deletion with Chaveroce's method hxnR/zeo frw 5'- taatataatcaaagcatctcctagctctatacggagtctccatcaaagcaggaattctcagtcctgctcc -3' hxnR/zeo rev 5'- agcatgaatactacgacacagaatacagatagacagttgatgcaagctacgacagaattcctgcagcccg -3' hxnS/zeo frw 5'- gagtaaagaggggttcgaggggagaaagggagcccatggtttcgactgtcggaattctcagtcctgctcc-3' hxnS/zeo rev 5'- tcaatataaacctgccaaaggtgccgtcacatctcgcgtcgaaggctcgggacagaattcctgcagcccg -3' for cloning

hxnR XbaI frw 5'- tttttttttctagacagctaatcctgcagtatagactcctc -3' hxnR KpnI rev 5'- ttttttttggtaccctcaatagagcatgaatactacgacac -3' hxnS cDNA frw2 5'- ttttttttgaattcggactgcaccgagaaccatg -3' hxnS cDNA rev 5'- ttttttttgaattctcaggcaacagcaacgaaaaatcc -3' gene specific primers, sequencing primers hxnS 5UTR frw 5'- gtgcatacatcacgactgattgg -3' hxnS frw0 5'- gtgcatacatcacgactgattgg -3' hxnS frw2 5'- catgcgaagatcctcagtgtcaac -3' hxnS rev2 5'- ggacgtttgtcacctgagagagg -3' hxnS rev5 5'- ggacgtttatggaacgttagagg-3' hxnS rev6 5'- ccatgctgtctcgtctgaaggacgac -3' hxnS 2k down rev 5’- aggaccttcgtatgcttgac -3’ hxnS 4k up frw 5'- cagagacagcagaatgtagggactgggtc -3' hxnR downst probe frw 5’- ggtagtccgtatagcccttctctg-3’ hxnR downst probe rev 5’- gtggagattcatggtactgtaacc -3’ hxnR 2F 5'- gcacgcttatcgtctccactg -3' hxnR 800F 5'- gtatgatgccaatacagtaaagctacc -3' hxnR 1375F 5'- cttctcccgcttcaatactacatacc -3' hxnR 1958 F 5'- agagatacagaacatgcatttcttccc -3' UR frw 5'- gacggacctgtcgagtcttattgtg -3' UR rev 5'- cagctataccattctccgttcgcac -3' UR 1F 5'- gacggacctgtcgagtcttattgtg -3' UR 2F 5'- cccttcttcagagaagatctgagc -3' UR 3F 5'- acagtaccatgaatctccactccg -3' UR 4F 5'- gcgctgggcgtagtattccacattcag -3' UR 5F 5'- cccaactcctctcatcgcatctgaatttcg -3' UR 6F 5'- gctccaagaacggatcgcccaactc -3' UR 7F 5'- cacaccaaccaccgaactaatttacc -3' UR 8F 5'- cggcgtctcccatttcagacatgaacc -3' UR 9F 5'- gggaatggcgacataccgaaggac -3' UR 10F 5'- accgattggtcttgtgtatgcagatgac -3' UR 11F 5'- aaagagtctcgatcggtcccaatagc -3' UR 12F 5'- cccttcaaccaggtgcttgacgag -3' UR 13F 5'- gggaggatgcagacctaggtacga -3' UR 14F 5'- agtattcaatgtgagtttcctgcagg -3' UR 15F 5'- gagatgtgacggcacctttggcag -3' UR 1R 5'- gctatacggactaccctttcgctc -3' hxnS F0 5'- atggacgccctccttccgagatcatcg -3' hxnS F420 5'- gggaagttccagctatccgcggatgatatcg -3' hxnS F820 5'- tcgccaaattcgtacccgaactg -3' hxnS F1227 5'- ggaaacattgccacggcgtctc -3' hxnS F1627 5'- aggctgtgctcgatatcgttctc -3' hxnS 2030 5'- gggcgctgtgggatatgttgatcatacttctc -3' hxnS F2430 5'- gacgggagtatggatgtttgga -3' hxnS F2830 5'- acatcccgaatgtctggctgcg -3' hxnS F3230 5'- ccgtgtctacacagacggatcag -3' hxnS F3636 5'- tttactcagggagtggcatgca -3' hxnS F4055 5'- ggtaagcgagccgttggtgctagac -3' hxnS R275 5'- gtgataacatgctttccagatactc -3'

Underlined letters in the primer sequences or in the primer names refer to the restriction sites designed within. Italic letters at the 5' end refer to the chimeric nature of the primer.

Supplementary Materials and Methods Identification of hxnS and hxnR Identification of an hxnS-carrying cosmid of W31:H08 from the A. nidulans ordered cosmid library of chromosome VI (pWE15 based genomic library) [1] was identified by Southern blot analysis using the PCR product of "hxnS probe frw" – "hxnS probe rev" primers as hybridisation probe. A 16,703 bp long hxnS-positive BglII fragment was subcloned into the BamHI site of the pKS-Bluescript vector (pHZ-hxnS). Transformation of the W31:H08 cosmid and the 16.7 Kb subclone into hxnS41 and the hxnR2 loss-of-function mutants (HZS.109 and CS302, respectively) resulted in the full complementation of the mutations. A 6,820 nt PCR product amplified from total DNA by "UR frw" and "UR rev" primers were cloned into SmaI digested pBluescript SK vector and sequenced by using "hxnS 5UTR frw", "hxnS frw0", "hxnS frw2", "hxnS rev2", "hxnS rev5", "hxnS rev6", "UR 1F", "UR 2F", "UR 3F", "UR 4F", "UR 5F", "UR 6F", "UR 7F", "UR 8F", "UR 9F", "UR 10F", "UR 11F", "UR 12F", "UR 13F", "UR 14F" and "UR 15F" primers. The sequenced region carried the 4,359 nt long complete coding sequence of hxnS, which was identical with the AN9178 locus in AspGD genome database (GeneBank accession number KY962010). Upstream to the hxnS start codon we identified an ORF (to be called hxnT) and a 178 nt long 3' end of a Zn-finger transcription factor (identified as hxnR). A PCR product amplified from total DNA by "hxnS 4k up frw" and "hxnS 2k down rev" primers carrying a 4,753 nt long region upstream to the start codon of hxnS, the hxnS ORF and a 2,825 nt long region downstream to the stop codon of hxnS was cloned into SmaI digested pBluescript SK plasmid. From this clone hxnR was sequenced by using "hxnR 2F", "hxnR 800F", "hxnR 1375F", "hxnR 1958 F" and pBluescript SK specific "T3" and "T7" primers. Primer sequences are listed in Table S6. Sequence determination of hxnS and hxnR mutations and hxnS cDNA. Sequence analysis was carried out either on cloned PCR products or purified PCR products. The hxnR PCR products from control- and mutant strains (used primers were "hxnR XbaI frw" and "hxnR KpnI rev") were cloned into KpnI/XbaI digested pBluescript SK plasmid prior to sequence analysis. Sequencing was carried out by using the "hxnR 2F", "hxnR 800F" "hxnR 1375F" and "hxnR 1958 F" primers. The hxnS cDNA was amplified with the "hxnS cDNA frw2" and "hxnS cDNA rev" primer pairs from cDNA generated from total RNA sample of an hxnR+ (FGSC A26) strain grown on 1mM acetamide as sole N-source for 8 hours at 37°C and induced with 1 mM 6-OH nicotinic acid for further 2 hours. The PCR product was cloned into EcoRI digested pBluescript SK plasmid and sequenced with "hxnS F0", "hxnS F420", "hxnS F820", "hxnS F1227", "hxnS F1627", "hxnS 2030", "hxnS F2430", "hxnS F2830", "hxnS F3230", "hxnS F3636", "hxnS F4055" and "hxnS R275" primers. The primers used are listed in Table S6. DNA sequencing was done over both strands by the Sanger sequencing service of LGC (http://www.lgcgroup.com) analysing three independent biological samples. Deletion of the hxnR and hxnS Deletion of hxnR. hxnR deletion was carried out by the Chaveroce's method [2]. The hxnR gene on an hxnR-carrying cosmid of W31:H08 from the A. nidulans ordered cosmid library of chromosome VI was replaced in vivo in E. coli KS272 by the zeo gene using a phage  Red expressing Escherichia coli strain. The transformation marker zeo gene was amplified from plasmid pCDA21 [2] using chimeric primers "hxnR/zeo frw" and "hxnR/zeo rev". These

primers are composed, respectively, of 50 nucleotides with identity to both sides of hxnR UTR (upstream the ATG and downstream the termination codon) and 20 nucleotides with identity to the zeo gene. The plasmid p-hxnR and the PCR product of zeocin marker gene (flanked by hxnR UTR specific sequences) were sequentially transformed into E. coli KS272 strain, the in vivo recombination was triggered by 0.2% L-arabinose in LB medium at 30°C and subsequently, the recombinant p-hxnR::zeo plasmid containing E. coli strains were selected on ampicillin/zeocin containing LB medium. The zeo gene leads to no phenotype in A. nidulans and therefore we developed a direct selection strategy for the hxnR deletion. The p-hxnR::zeo plasmid was used (5.4 µg of DNA) to transform A. nidulans strain alX4 biA1 (HZS.546) and hxnR deletion strains were isolated from the selective hypoxanthine + acetamide + allopurinol + 100 µM nicotinic acid medium. Strains carrying alX4, a chain termination mutation in the gene encoding allantoinase [3], are strongly inhibited by allantoin or any of its precursors, such as hypoxanthine, in the presence on non-repressive nitrogen sources [4]. Strain HZS.546 is strongly inhibited by hypoxanthine on acetamide as sole nitrogen source. This inhibition is clearly seen in a medium with acetamide as sole nitrogen source, containing allopurinol, which inhibits completely PHI (HxA) [5], and 1mM or 100 µM nicotinic acid. On this medium, inhibition of growth depends on the nicotinate-mediated induction of HxnS, which hydroxylates hypoxanthine to xanthine, the latter converted to uric acid by XanA [6], which is further oxidized to allantoin. A deletion of hxnR will prevent the induction of hxnS, and thus hypoxanthine toxicity. We took advantage of this to select hxnR deletion strains. Out of 42 tested transformants, 9 showed hxnR phenotype (i.e. they did not grow on either allopurinol supplemented hypoxanthine-, nicotinic acid and 6-OH nicotinic acid N-sources). Southern blot analysis of EcoRV digested total DNA using a PCR probe that hybridises with the region directly downstream of hxnR (generated by PCR using "hxnR downst probe frw" "hxnR downst probe rev" primers) showed that the desired genetic exchange between hxnR locus on chromosome and the zeo allele of the recombinant plasmid had occurred in three transformants. The hxnR::zeo alX4 biA1 strains were crossed with NA0313 and the selected progeny hxnR::zeo pantoB100 (HZS.136) was used in further experiments. Primer sequences are listed in Table S6. Deletion of hxnS. The hxnS gene was deleted by two different methods. One which originated strain HZS.106 was done as above (using "hxnS/zeo frw" and "hxnS/zeo rev" primers and by co-transformation of the p-hxnS::zeo plasmid with Aspergillus autoreplicative, N. crassa pyr4 carrying plasmid into HZS.105), the second which originated strain HZS.599 was done by the transformation of a gene substitution cassette constructed by the double-joint PCR method [7] as described previously [8]. The hxnS deletion was obtained by using a pabaA+ substitution cassette. The "A", "B" and "C" components of the cassette were amplified with the "hxnS rup frw" – "hxnS rup rev", "hxnS r paba chim frw" – hxnS r paba chim rev" and "hxnS rdown frw" – "hxnS rdown rev" primer pairs, respectively. The 2,825 bp, 3,905 bp and 2,664 bp long "A", "B" and "C" components were assembled to a 8,264 bp long substitution cassette using "hxnS r up nest frw" and "hxnT rev" primers. The substitution cassette was transformed into HZS.120 and 50 PABA prototroph strains were selected, pre-screened for the deletion by growth test on nicotinic acid and 6-OH nicotinic acid as sole N-sources and checked with Southern blot analysis using the "C" component (hxnS downstream flanking region) as the probe on PvuII digested total DNA. Out of 9 putative hxnS transformants, 6 carried the desired single copy integration at the hxnS locus. Growth ability of the hxnS strains was tested while co-segregation of pabaA+ marker gene with the hxnS deletion in the progeny of genetic crosses (with HZS.223) was verified. Primer sequences are listed in Table S6.

References: 1. Brody H, Griffith J, Cuticchia AJ, Arnold J, Timberlake WE (1991) Chromosome-specific recombinant DNA libraries from the fungus Aspergillus nidulans. Nucleic Acids Res 19: 3105-3109. 2. Chaveroche MK, Ghigo JM, d'Enfert C (2000) A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res 28: E97. 3. Galanopoulou K, Scazzocchio C, Galinou ME, Liu W, Borbolis F, et al. (2014) Purine utilization proteins in the Eurotiales: cellular compartmentalization, phylogenetic conservation and divergence. Fungal Genet Biol 69: 96-108. 4. Darlington AJ, Scazzocchio C (1967) Use of analogues and the substrate-sensitivity of mutants in analysis of purine uptake and breakdown in Aspergillus nidulans. J Bacteriol 93: 937-940. 5. Scazzocchio C, Holl FB, Foguelman AI (1973) The genetic control of molybdoflavoproteins in Aspergillus nidulans. Allopurinol-resistant mutants constitutive for xanthinedehydrogenase. Eur J Biochem 36: 428-445. 6. Cultrone A, Scazzocchio C, Rochet M, Montero-Moran G, Drevet C, et al. (2005) Convergent evolution of hydroxylation mechanisms in the fungal kingdom: molybdenum cofactor-independent hydroxylation of xanthine via alphaketoglutarate-dependent dioxygenases. Mol Microbiol 57: 276-290. 7. Yu JH, Hamari Z, Han KH, Seo JA, Reyes-Dominguez Y, et al. (2004) Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi. Fungal Genet Biol 41: 973-981. 8. Karacsony Z, Gacser A, Vagvolgyi C, Scazzocchio C, Hamari Z (2014) A dually located multiHMG-box protein of Aspergillus nidulans has a crucial role in conidial and ascospore germination. Mol Microbiol 94: 383-402.

A eukaryotic nicotinate-inducible gene cluster ...

A eukaryotic nicotinate-inducible gene cluster ...

Suggest Documents

A eukaryotic nicotinate-inducible gene cluster

Eukaryotic Gene Expression

Dre2, a Conserved Eukaryotic Fe/S Cluster Protein, Functions in ...

A Eukaryotic-Acquired Gene by a Biotrophic Phytopathogen ... - PLOS

A novel gene cluster allows preferential utilization

Position Effects on Eukaryotic Gene Expression

Databases on Eukaryotic Gene Regulation - Semantic Scholar

A Homeotic Gene Cluster Patterns the ... - ScienceDirect.com

Position Effects on Eukaryotic Gene Expression

Cryptococcus neoformans Gene Expression during ... - Eukaryotic Cell

THE EVOLUTIONARY DYNAMICS OF EUKARYOTIC GENE ORDER

Horizontal gene transfer in eukaryotic algal evolution

A carotenoid synthesis gene cluster from ...

Noise Minimization in Eukaryotic Gene Expression

in eukaryotic 18S rRNA gene

BIASED EUKARYOTIC GENE REGULATION RULES ... - CiteSeerX

Automated eukaryotic gene structure annotation using

Eukaryotic Gene Expression - Begell House Digital Library

Doxycycline-dependent photoactivated gene expression in eukaryotic ...

How does eukaryotic gene prediction work?

Cloning a eukaryotic DNA glycosylase repair gene by the ...

In vivo transcription of a eukaryotic regulatory gene - Europe PMC

Development of a Highly Efficient Gene Targeting ... - Eukaryotic Cell

A self-initiating eukaryotic transient gene expression - BioMedSearch