(A) fleck

letter

© 1999 Nature America Inc. • http://genetics.nature.com

Involvement of nucleotide-excision repair in msh2 pms1independent mismatch repair


Oliver Fleck1, Elisabeth Lehmann1, Primo Schär2 & Jürg Kohli1

Nucleotide-excision repair (NER) and mismatch repair (MMR) are prominent examples of highly conserved DNA repair systems which recognize and replace damaged and/or mispaired nucleotides in DNA. In humans, inheritable defects in components of the NER system are associated with severe diseases such as xeroderma pigmentosum (XP) and Cockayne syndrome1 (CS), whereas inactivation of MMR is accompanied by predisposition to certain types of cancer2. In Schizosaccharomyces pombe, the msh2- and pms1-dependent long-patch MMR system efficiently corrects small insertion/deletion loops and all base-base mismatches, except C/C. Up to 70% of C/C mismatches generated in recombination intermediates, and to a lesser extent also other base-base mismatches, are thought to undergo correction by a minor, short-patch excision repair system3,4. We identify here the NER genes rhp14, swi10 and rad16 as components of this repair pathway and show that they act independently of msh2 and pms1.

We have investigated the effects of mutations in the DNA repair genes msh2, pms1, rhp14, swi10 and rad16 on mismatch correction in fission yeast. msh2 and pms1 encode homologues of bacterial MutS and MutL, respectively5,6, and both are core components of the post-replicative MMR system. The proteins Rhp14p, Swi10p and Rad16p are components of the NER pathway that repairs a broad spectrum of chemical DNA alterations inducing local structural distortions1. Rhp14p is a newly identified fission yeast homologue of Saccharomyces cerevisiae Rad14p (48% similarity) and human XPA (36% similarity), which are indispensable for the damage-recognition/incision stage in the NER reaction. Inactivating mutations in the respective genes cause severe cellular sensitivity to ultraviolet light associated with a reduction in NER activity7. Mutations in rhp14 in S. pombe cause high ultraviolet sensitivity in an epistatic relationship with swi10 (unpublished observations). Swi10p and Rad16p are the fission yeast homologues of S. cerevisiae Rad10p and Rad1p and human ERCC1 and ERCC4, respectively8–10. These proteins act in NER as heterodimeric endonucleases that mediate strand incision 5´ to the lesion1,8. In yeast, the formation of intragenic wild-type recombinants (prototrophic recombinants) in heteroallelic crosses reflects independent repair of mismatches arising in heteroduplex DNA intermediates generated during homologous recombination4. To study the role of MMR and NER factors in intragenic recombination, we examined the ability of wild-type and mutant strains to produce prototrophic recombinants in standardized crosses4. In the cross ade6-485×ade6-M387, in which two C/C mismatches separated by 26 bp are generated (Fig. 1), wild-type cells yielded a prototroph frequency of 158×10–6 (Table 1). Most prototrophs produced in this cross were postulated to result from short-patch repair of adjacent C/C mismatches by a minor pathway, the frequency being high because the long-patch MMR system would not compete in C/C

a

b

c

d

e

f

Fig. 1 Structure of ade6, mutations used in this study and formation of mismatches. a, The ORF starts at nt 875 and ends with the stop codon at nt 2,531. Positions of ade6 mutations4,20 are shown, with nucleotide numbers in parenthesis. b, DNA sequences of the regions surrounding the mutations from wild type (top line) and mutants (bottom line). Only the 5´→3´ strand is shown (nontranscribed strand). The nucleotides differing from the wild-type sequence are underlined. c−e, Two-factor crosses (Table 1) and formation of mismatches when mutated sites are included in heteroduplex DNA. Repair of the bases in the mismatches (underlined) gives wild-type information. c, 485×M387; d, 485×51; e, 421×51. f, One-factor cross used for tetrad analysis (Table 2).

1Institute of General Microbiology, University of Bern, Baltzer-Strasse 4, CH-3012 Bern, Switzerland. 2Institute for Medical Radiobiology, August-Forel

Strasse 7, CH-8008 Zürich, Switzerland. Correspondence should be addressed to O.F. (e-mail: [email protected]).

314

nature genetics • volume 21 • march 1999

letter


Table 1 • Prototroph frequencies Genotype

Two-factor 485×M387

Wild type pms1 msh2 swi10 rhp14 rad16 msh2 swi10 msh2 rhp14 msh2 rad16 pms1 swi10 pms1 rhp14 pms1 rad16 rhp14 swi10

158 (14) 233 (31) 164 (51) 4.8 (1.4) 6.3 (0.6) 9.8 (0.9) 5.8 (0.6) 5.1 (1.0) 5.1 (1.8) 61 (11) 28 (8.3) 63 (18) 6.4 (0.7)

Table 3 • Mitotic reversion rates

crossesa

ade6-485 to Ade+

421×51

15 (3.5) 191 (10) 108 (4.6) 2.5 (0.5) 1.8 (0.4) 3.1 (0.8) 12 (3.0) 5.3 (1.7) 7.4 (0.5) 31 (6.0) 13 (2.1) 19 (8.3) 2.4 (0.4)

7.8 (1.3) 183 (47) 31 (7.5) 4.8 (0.8) 4.6 (0.7) 7.4 (1.4) 23 (14) 18 (4.7) 20 (3.6) 35 (4.9) 29 (8.1) 49 (22) NT

Mutation rate Wild type pms1 swi10 pms1 swi10 rhp14 pms1 rhp14 rhp14 swi10 rad16 pms1 rad16

3.1 (1.0) 22.8 (6.3)b 20.7 (6.4)b 49.2 (9.2)c 18.9 (6.4)b 59.8 (13.4)c 16.9 (6.2) 32.6 (6.1)b 53.6 (14.6)c

ade6-687 to Ade+

Fold increase

Mutation rate

Fold increase

7 7 16 6 19 5 11 17

8.4 (4.9) 106 (33.9)b 12.0 (0.6) 89.3 (20.8) NT NT NT NT NT

13 1 11 – – – – –

aThe

crosses were performed with strains carrying the ade6 alleles specified4. Numbers represent prototrophic segregants per 106 colony-forming spores. All crosses were carried out three times. Numbers in parentheses are standard deviations. The heteroduplex DNA intermediates formed in each cross are schematically shown in Fig. 1. NT, not tested.

ade6 mutations used are 485 (C→G) and 687 (T insertion in a run of five thymines; ref. 4). Numbers are average Ade+ revertants per 109 cell divisions (with standard deviations in parentheses) obtained in two or three independent experiments with nine cultures per experiment. NT, not tested. bMutation rate of single mutant significantly different from wild type as judged from non-overlapping standard deviations. cMutation rate of double mutant significantly different from those of respective single mutants.

repair4. Significantly less prototrophs were counted in the crosses 485×51 (15×10–6, mismatches separated by 22 bp) and 421×51 (7.8×10–6, mismatches separated by 90 bp), in which only one or none of the mismatches generated is a C/C. This drop in prototroph frequency was explained by efficient processing of non-C/C mismatches by the long-patch MMR system, which will co-repair adjacent mismatches and thus prevent formation of recombinants4. When either pms1 or msh2 was mutated, prototroph frequencies increased significantly in the crosses 485×51 (one C/C) and 421×51 (no C/C), but only marginally in 485×M387 (two C/C). This allele-specific effect is accounted for by more frequent independent repair of non-C/C mismatches by short-patch excision due to the absence of functional MMR. In contrast, mutations in swi10, rhp14 or rad16 reduced prototroph formation in the cross 485×M387 (two C/C), whereas the effect was less pronounced in 485×51 (one C/C) and nearly absent in 421×51 (no C/C). The same differential phenotype was observed in rhp14 swi10 doublemutant crosses (Table 1). This epistatic relationship between different functional defects in the NER pathway suggests that the effect on intragenic recombination is a consequence of a deficiency in NER rather than in a recombination-associated function known to exist for Swi10p but not for Rhp14p. Thus, the allele-specific decrease of prototroph frequencies in crosses allowing for C/C mismatch formation can be explained by reduced NER-mediated short-patch repair of C/C mismatches.

In a double-mutant background of pms1 and either of the NER genes, prototroph levels in all crosses were significantly reduced compared with the frequencies measured in the pms1 singlemutant crosses, and similar effects were found in crosses with MMR/NER double mutants involving msh2. These data corroborate the involvement of NER in C/C repair during meiotic recombination and establish that this pathway also accounts for correction of non-C/C mismatches, although its contribution is detectable only in the absence of functional MMR. In yeast, meiotic mismatch-repair efficiency can be assessed directly by quantitation of post-meiotic segregation (PMS) in tetrad analysis3. Whole-chromatid conversion (WCC) tetrads are indicative of mismatch correction, whereas PMS tetrads result from failure of mismatch repair in hybrid DNA recombination intermediates. We assayed repair efficiency of pms1 and swi10 mutants in the cross ade6-M26 sup9-UGA×ade6-M26/16C sup9UGA, in which detectable C/C and G/G mismatches occur at the heterozygous 16C site11 (Fig. 1, Table 2). As approximately 30% of C/C mismatches escape correction in repair-proficient cells, the frequency of PMS is usually elevated in crosses producing C/C mismatches3,11. Nevertheless, we found that the pms1 mutation further increased PMS and concomitantly reduced WCC. The increase of PMS is less pronounced in crosses with C/C mismatch formation6 and probably reflects loss of G/G repair. Elevated PMS correlated with reduced WCC was also found in a

aTwo-factor


Tested reversiona

Genotype

485×51

Table 2 • Aberrant segregations in ade6-M26 sup9-UGA×ade6-M26/16C sup9-UGA crossesa WCCb

Number of tetrads Cross Wild typed % (±s.d.) pms1 % (±s.d.) swi10 % (±s.d.) pms1 swi10 % (±s.d.)

1,395 601 446 594

6+:2–

2+:6–

8+:0–

30

35

1

1 7 0

16 12 5

0 0 0

PMSc 0+:8– 2 0 0 0

Total

5+:3–

3+:5–

71 5.1 (±0.59) 18 3.0 (±0.70) 19 4.3 (±0.96) 5 0.84 (±0.37)

25

3

7 10 13

6 3 13

WCC

ab4+:4– 1+:7– 0 3 0 13

0 1 0 0

Total 28 2.0 (±0.38) 20 3.3 (±0.73) 13 2.9 (±0.79) 52 8.8 (±1.16)

+PMS 99 7.1 (±0.69) 38 6.3 (±0.99) 32 7.2 (±1.22) 57 9.6 (±1.21)

PMS WCC+PMS (in %) 28 53 41 91

aG/G and C/C mismatches can be formed in these one-factor crosses11. bWhole-chromatid conversions (WCC). 8+:0– and 0+:8– tetrads were each counted as two conversion events. cab4+:4– tetrads contained two PMS spore clones and were counted as one 5+:3– and one 3+:5– event, and the 1+:7– tetrad was counted as one 3+:5– PMS event and one 2+:6– conversion event. dData from ref. 11. s.d., standard deviation11.


315

letter


Table 4 • Mutation spectra of ade6-485 revertants Mutationa

Genotype G→C Occurrence Wild type pms1 swi10

6/15 1/14 9/14

G→T Frequencyb 1.3 1.6 13.3

A→G

Occurrence

Frequency

Occurrence

6/15 3/14 3/14

1.3 4.9 4.4

3/15 9/14 2/14

sup Frequency 0.6 14.7 3.0

Occurrence

Frequency

1/14

1.6

ade6-485 mutation is a C→G transversion at position 2,119, which changes a TAC codon for tyrosine to a TAG stop codon4. Three types of mutations at TAG were found in the revertants. G→C and G→T are changes of the third base of the stop codon and restore codons for tyrosine. A→G is a change of the second base of the stop codon, giving rise to a TGG codon for tryptophan. One revertant contained the TAG stop codon and no mutations were found in the 230 bp upstream of the 485 mutation site. We propose that this Ade+ revertant had either a suppressor mutation or a second mutation elsewhere in ade6, which restored the Ade+ phenotype by intragenic complementation. G→C reversions can result from unrepaired C/C or G/G mismatches, G→T reversions from unrepaired G/A or T/C and A→G reversions from unrepaired A/C or G/T mismatches. In wild type, the three types of reversions occurred with similar frequencies. In the pms1 mutant, A→G and to some extent G→T, but not G→C, reversions are increased, whereas in the swi10 mutant most of the revertants arose by G→C transversions. The pattern of G→C and A→G reversions is significantly different between pms1 and swi10 (χ2 = 10.83, χ20.01 = 6.635). bRevertants of the indicated type per 109 cell divisions as calculated from the mutation rates shown (Table 3).


aThe

swi10 mutant background (Table 2). The effect was less pronounced than in pms1 mutants and likely reflects loss of C/C repair. In pms1 swi10 double-mutant crosses, however, 91% of aberrant segregation events were PMS. The PMS to WCC ratio (8.8% versus 0.84%) differs significantly from that obtained in the pms1 single-mutant cross (3.3% versus 3.0%), showing that swi10 and pms1 can act independently in meiotic mismatch correction. Thus, inactivation of both MMR and NER abolishes nearly all mismatch-repair activity in meiotic cells. During DNA replication, base-pairing errors can occur by misincorporation of nucleotides or by strand slippage in simple, repetitive DNA sequences. If not repaired, these events give rise to base substitution and frameshift mutations, respectively12. We tested the effect of mutations inactivating NER and MMR on mitotic reversion of two ade6 mutations. In pms1, rhp14, swi10 and rad16 mutants, reversion rates of ade6-485 (C→G transversion) were similarly increased (Table 3). In the pms1 swi10, pms1 rhp14 and pms1 rad16 double mutants, the rates were close to the sum of those of the respective single mutants, whereas in the rhp14 swi10 double mutant it remained at the level of the single mutants. This is consistent with independent roles of MMR and NER in mutation avoidance. Analysis of the mutagenic events by DNA sequencing revealed characteristic mutational spectra (Table 4). In wild-type cells the different reversion events found at 485 were equally frequent, whereas A→G transitions originating from unrepaired A/C or G/T mismatches were predominant in the pms1 mutant, and G→C transversions originating from unrepaired C/C or G/G mismatches were the most frequent events observed in the swi10 mutant. We also examined reversion of ade6-687 (T insertion in a run of five thymines) in pms1 and swi10 mutants (Table 3). Reversion of this allele reflects a failure of repair of unpaired bases (T or A) generated by template-strand slippage during replication. Reversion of 687 was increased in the pms1 mutant and to a similar extent in the pms1 swi10 double mutant, but not so in the swi10 single-mutant background. Thus, a deficiency in NER does not seem to affect repair of unpaired thymines or adenines. Previous studies suggested a function of NER proteins in mismatch correction. Point mutations in S. cerevisiae RAD3 enhance spontaneous mutation rates in a RAD6- and thus error-prone synthesis-independent manner, indicating an involvement of Rad3p in correction of replication-associated promutagenic lesions13,14. S. cerevisiae Rad1p has been shown to act in conjunction with Msh2p in processing of a 26-bp, non-palindromic insertion loop generated in hybrid DNA intermediates of meiotic homologous recombination15. A mutation of mei-9, the Drosophila melanogaster homologue of rad16, increases PMS, and thus may be defective in meiotic mismatch correction16,17. 316

Moreover, the human NER complex was found to act on G/G and G/A mismatched substrates18. Here, we show that the NER factors encoded by rhp14, swi10 and rad16 have a role in meiotic and mitotic mismatch correction that is independent of msh2 and pms1. Thus, key factors of NER constitute a pathway for mismatch correction which accounts for processing of C/C mismatches and, in the absence of functional MMR, for repair of other base-base mismatches but not of mononucleotide loops of unpaired thymine or adenine. These findings provide new insight into understanding the phenotypes associated with mismatch-repair deficiency, and will be useful for evaluating the contribution of NER to mismatch correction in human cells.

Methods Strains and media. All MMR+/NER+ strains containing the ade6 mutations 51, 421, 485, 687 and M387 are from the S. pombe strain collection in Bern. The nature of the mutations has been determined4. The msh2 disruption strains were derived from crossing with strain Ru39 (h– msh2::his3+ his3-D1; ref.5). The pms1 disruption strains were derived either from PRS301 (h– pms1::ura4+ ura4-D18; ref. 6) or from MAB032 (h– pms1::his3+ his3-D1 ura4-D18 leu1-32; M. Baur, P.S. and J.K., manuscript in preparation). The swi10 strains were derived from SK15 (h90 swi10::ura4+ ura4D18; ref. 9) and the rad16 strains from SK24 (h90 rad16::ura4+ ura4-D18; ref. 10). The rhp14 strains were derived from OL456 (h– rhp14::kanMX his3-D1 leu1-32 ura4-D18). In this strain the entire ORF (EMBL accession number AL023587) was replaced by the kanMX6 disruption cassette (unpublished data). S. pombe media and general genetic methods were used as described19. Genetic mismatch-repair assays. Prototroph frequencies in intragenic two-factor crosses were measured as described4. Mitotic mutation rates and aberrant segregation frequencies in tetrads were determined according to described protocols5,6. DNA sequencing of Ade+ revertants. DNA sequences were analysed by direct sequencing of PCR products according to standard protocols. PCR was performed on DNA isolated from Ade+ revertants as follows: 30 cycles (45 s 94 oC, 45 s 48 oC, 1 min 72 oC) with primer ad6+1847, 5´−GATTATGTTTCAAAGATCGC−3´, and primer ad6-2172, 5´−TCTTGAAGCTGCGGTACGAG−3´ . Primers were derived from the ade6 sequences near the 485 mutation4,20. PCR products were separated from primers and a single strand was reamplified with primer ad6+1847 (20 cycles). DNA sequences were determined from the single strand with primer ad6-2172 by the dideoxy method using a sequencing kit (Amersham). All revertants used for sequencing were derived from independent cultures. Acknowledgements

This work was supported by the Swiss National Science Foundation and a fellowship of the Deutsche Forschungsgemeinschaft to O.F. Received 28 July 1998; accepted 14 January 1999. nature genetics • volume 21 • march 1999


Sancar, A. DNA excision repair. Annu. Rev. Biochem. 65, 43–81 (1996). Modrich, P. & Lahue, R. Mismatch repair in replication fidelity, genetic recombination, and cancer biology. Annu. Rev. Biochem. 65, 101–133 (1996). 3. Schär, P., Munz, P. & Kohli, J. Meiotic mismatch repair quantified on the basis of segregation patterns in Schizosaccharomyces pombe. Genetics 133, 815–824 (1993). 4. Schär, P. & Kohli, J. Marker effects of G to C transversions on intragenic recombination and mismatch repair in Schizosaccharomyces pombe. Genetics 133, 825–835 (1993). 5. Rudolph, C. et al. The msh2 gene of Schizosaccharomyces pombe is involved in mismatch repair, mating-type switching, and meiotic chromosome organization. Mol. Cell. Biol. 19, 241–250 (1999). 6. Schär, P., Baur, M., Schneider, C. & Kohli, J. Mismatch repair in Schizosaccharomyces pombe requires the mutL homologous gene pms1: molecular cloning and functional analysis. Genetics 146, 1275–1286 (1997). 7. Aboussekhra, A. & Wood, R.D. Repair of UV-damaged DNA by mammalian cells and Saccharomyces cerevisiae. Curr. Opin. Genet. Dev. 4, 212–220 (1994). 8. Lehmann, A.R. Molecular biology of DNA repair in the fission yeast Schizosaccharomyces pombe. Mutat. Res. 363, 147–161 (1996). 9. Rödel, C., Kirchhoff, S. & Schmidt, H. The protein sequence and some intron positions are conserved between the switching gene swi10 of Schizosaccharomyces pombe and the human excision repair gene ERCC1. Nucleic Acids Res. 20, 6347–6353 (1992). 10. Carr, A.M. et al. The rad16 gene of Schizosaccharomyces pombe: a homolog of the RAD1 gene of Saccharomyces cerevisiae. Mol. Cell. Biol. 14, 2029–2040 (1994). 11. Schär, P. & Kohli, J. Preferential strand transfer and hybrid DNA formation at the recombination hotspot ade6-M26 of Schizosaccharomyces pombe. EMBO J. 13,

5212–5219 (1994). 12. Schär, P. & Jiricny, J. in Nucleic Acids and Molecular Biology: Eukaryotic Mismatch Repair (eds Eckstein, F. & Lilley, D.M.J.) 199–247 (Springer-Verlag Berlin, Heidelberg, 1998). 13. Montelone, B.A., Gilbertson, R., Nassar, R., Giroux, C. & Malone, R.E. Analysis of the spectrum of mutations induced by the rad3-102 mutator allele of yeast. Mutat. Res. 267, 55–66 (1992). 14. Montelone, B.A. & Malone, R.E. Analysis of the rad3-101 and rad3-102 mutations of Saccharomyces cerevisiae: implications for structure/function of Rad3 protein. Yeast 10, 13–27 (1994). 15. Kirkpatrick, D.T. & Petes, T.D. Repair of DNA loops involves DNA-mismatch and nucleotide-excision repair proteins. Nature 387, 929–931 (1997). 16. Sekelsky, J.J., McKim, K.S., Chin, G.M. & Hawley, R.S. The Drosophila meiotic recombination gene mei-9 encodes a homologue of the yeast excision repair protein Rad1. Genetics 141, 619–627 (1995). 17. Carpenter, A.T.C. Mismatch repair, gene conversion, and crossing-over in two recombination-defective mutants of Drosophila. Proc. Natl Acad. Sci. USA 79, 5961–5965 (1982). 18. Huang, J.-C., Hsu, D.S., Kazantsev, A. & Sancar, A. Substrate spectrum of human excinuclease: repair of abasic sites, methylated bases, mismatches, and bulky adducts. Proc. Natl Acad. Sci. USA 91, 12213–12217 (1994). 19. Gutz, H., Heslot, H., Leupold, U. & Loprieno, N. in Handbook of Genetics, Schizosaccharomyces pombe (ed. King, R.C.) 395–446 (Plenum Press, New York, 1994). 20. Szankasi, P., Heyer, W.-D., Schuchert, P. & Kohli, J. DNA sequence analysis of the ade6 gene of Schizosaccharomyces pombe. Wild-type and mutant alleles including the recombination hot spot allele ade6-M26. J. Mol. Biol. 204, 917–925 (1988).


1. 2.

letter


317