A genetic map of common bean to localize specific ...

A genetic map of common bean to localize specific resistance genes against anthracnose ANNE-FRANCOISE ADAM-BLONDON, MIREILLE SEVIGNAC, A N D MICHEL DRON' Dkpartement de Biologie Mole'culaire Vkgktale, Biit. 430, Universite' Paris-Sud,

91405 Orsay-Ckdex, France

AND

HUBERT BANNEROT

Genome Downloaded from www.nrcresearchpress.com by China University of Science and Technology on 06/04/13 For personal use only.

Statiorz Ame'l Plurztes, INRA-CNRA, Route de Suirzt-Cyr, 78026 Versailles-Ce'dex, France Corresponding Editor: R. Kemble Received March 14, 1994 Accepted May 26, 1994 M., DRON,M., and BANNEROT, H. 1994. A genetic map of common bean to ADAM-BLONDON, A.-F., SEVIGNAC, localize specific resistance genes against anthracnose. Genome, 37: 9 15-924. A bean genetic map was developed to locate resistance genes against anthracnose and genes involved in plant defense mechanisms. One hundred and fifty-seven markers (5 1 restriction fragment length polymorphism, 100 random amplified polymorphic DNA, 2 sequence characterized amplified regions, and 4 morphological markers) were used to construct a genetic map covering 567.5 cM of the bean genome. Morphological markers consisted in two resistance genes towards anthracnose (Are and RVI), a dominant gene for nuclear male sterility (Ms8) and a pod-shape character (SGou). This map was established by using a backcross population ( B C , ) of 128 individuals, derived from a cross between two European bean genotypes: Ms8E02 and Corel. Nine percent of the markers showed segregation distortions and mapped to three regions. Clusters of 2-10 markers were observed in every linkage group. The possible origin of these clusters is discussed. Nineteen markers shared with a previously published bean linkage map allowed us to establish a preliminary correspondence between the two maps. Finally, seven genes involved in plant defense mechanisms were located on this map. Key words: Phaseolus vulgaris L., random amplified polymorphic DNA, restriction fragment length polymorphism, Colletotrichum lindemuthianum, male sterility. M., DRON,M., et BANNEROT, H. 1994. A genetic map of common bean to ADAM-BLONDON, A.-F., SEVIGNAC, localize specific resistance genes against anthracnose. Genome, 37 : 915-924. Une carte gknktique du haricot a ktk ktablie afin de localiser des gknes de rksistance a l'anthracnose ainsi que des gknes impliquks dans les mkcanismes de dkfense des plantes. Cent cinquante-sept marqueurs (5 1 polymorphismes de longueur de fragments de restriction, 100 polymorphismes d'amplification alkatoire de I'ADN, 2 rkgions amplifikes dont la skquence est caractkriske et 4 caractkres morphologiques) ont kt6 utilisks pour ktablir une carte gknktique du haricot, couvrant 567,5 cM. Les marqueurs morphologiques comprenaient deux gknes de rksistance a l'anthracnose (Are et RVI), un gkne dominant de stkrilitk miile (Ms8) et un gkne contr8lant un caractkre architectural de la gousse (SGou). Cette carte a kt6 klaborke avec une population issue de rktrocroisement de 128 individus. Les parents utilisks pour gknkrer cette population sont deux gknotypes europkens de haricot, Ms8E0, et Corel. Des skgrkgations biaiskes ont kt6 observkes pour 9% des marqueurs analysks. Ces marqueurs sont regroupks dans trois rkgions de la carte. Des agrkgats de deux a dix marqueurs ont kt6 observks sur la majoritk des groupes de liaison. L'origine de ces particularitks est discutke. Dix-neuf marqueurs communs 2 notre carte et 2 une carte dkja publike ont permis d'ktablir un dkbut de correspondance entre elles. Enfin, sept gknes impliquks dans des mkcanismes de dkfense des plantes ont kt6 localisks sur cette carte. Mots clks : Phuseolus vulguris L., polymorphisme d'amplification alkatoire de I'ADN, polymorphisme de longueur de fragments de restriction, Colletotrichum lindemuthianum, stkrilitk mile.

Introduction Genetic maps are useful tools in crop breeding (Beckmann and Soller 1983; Tanksley et al. 1989; Gebhardt and Salamini 1992; Michelmore et al. 1992). They represent sources of identified markers to locate single or quantitative trait loci that can be used in marker-facilitated breeding programs (Gebhardt and Salamini 1992; Dudley 1993). Loci involved in developmental processes such as photoperiod sensitivity (Mackill et al. 1993), auxin-based transduction pathway (Lobler and Hirsch 1990), plant resistance to diseases (Paran et al. 1991; Van der Beek et al. 1992; Bubeck et al. 1993; Graner and Bauer 1993; Jahoor et al. 1993; Martin et al. 1993; Nodari et al. 1993b; Timmerman et al. 1993), and other agromorphological characters such as fruit or seed ' ~ u t h o rto whom all correspondence should be sent.

Pr~nredIn Canada / Irnpr~rnCau Canada

quality (Paterson et al. 1988; Ahn et al. 1992) have now been located on genetic maps. The construction of saturated genetic maps requires the combined use of different sets of genetic markers (morphological, isozymes, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), etc. (Rafalsky and Tingey 1993) and of appropriate genetic material (F,, haploids, aneuploids, backcross, recombinant inbred lines, near isogenic lines, etc.) (Melchinger 1990). Saturated maps representing more than 500 markers with a maximum distance between two markers of 5 cM have been reported for several crops (Tanksley et al. 1992; Gardiner et al. 1993; Kleinhofs et al. 1993). Other linkage maps with more than 100 markers scattered over the different linkage groups are available for most crops (Kesseli et al. 1990; Landry et al. 1991 ; Ellis et al. 1992; Pillen et al. 1992; Kiss et al. 1993; Nodari et al. 1 9 9 3 ~ ) .

916

G E N O M E , VOL. 3 7 , 1004

TABLE1. Interactions between two races of Colletotrichum lindemuthianum and the different genotypes of the BC, progeny derived from the cross involving Ms8E0, and Corel Genotype of BC, individuals


Fungal: Race:

Are, are RVI, rVI

Are, are rVI, rVI

are, are RVI, rVI

NOTE: -, incompatible reaction (plant resistance); (plant susceptibility).

are, are rVI, rVI

+. compatible reaction

In common bean ( P h a s e o l u s vulgaris L.), two genetic maps have now been reported (Vallejos et al. 1992; Nodari et al. 1993a; Gepts et al. 1993). Both were established with RFLP, isozymes, protein, and phenotypic markers. In both cases, the parents of the segregating populations were cultivars from the two major gene pools of l? vulgaris (Koenig and Gepts 1989; Vallejos et al. 1992; Nodari et al. 1 9 9 3 ~ ) . In addition, one of the parents of the cross set up by Vallejos et al. (1992) was the result of an earlier interspecific cross between a l? coccineus accession and a l? vulgaris genotype from the Mesoamerican gene pool. RFLP levels were high (Chase e t al. 199 1; Nodari e t al. 1992) between the two gene pools. These two maps are still incomplete, as both (Vallejos et al. 1992; Gepts et al. 1993) cover approximately 1000 c M instead of the 1250 c M expected (genome size estimated with both data sets using the formula of Hulbert et al. 1988). Nevertheless, they were demonstrated to be useful tools to locate some important characters in common bean breeding: seed size (Vallejos and Chase 199 1; Gepts et al. 1993), seed color (Vallejos et al. 1992; Nodari et al. 1993a), resistance to common bacterial blight, and Rhizobium nodulation (Nodari et al. 19936). Our group studies the genetic and molecular basis of the resistance of P. vulgaris towards Colletotrichum lindemuthianum, the causal agent of bean anthracnose (Gantet et al. 199 1; Mahk et al. 1992, 1993; Adam-Blondon et al. 1994). In this regard, we are interested in mapping genes for anthracnose resistance. Seven single dominant genes for anthracnose resistance have now been characterized in bean (Fouilloux 1979; B e e b e and Pastor-Corrales 199 1). An intraspecific backcross progeny was set up. The present data concern the development of a Phaseolus vulgaris genetic map with RFLP and RAPD markers. Two major genes for anthracnose resistance, a gene for male sterility and a gene for pod shape were located on this map.

Materials and methods Plant and fungal material, morphological markers A backcross progeny (BC,) of 128 individuals was obtained

from a cross between cultivars Ms8E02 and Corel (recurrent parent). Ms8E02 and Corel were chosen because they discriminated two different races of C . lindemuthianum (Table 1) and because they presented phenotypic differences such as plant structure, leaf morphology, and pod characteristics. Ms8E0, is a version of a bean genotype, EO,, in which it has been introgressed a dominant gene for male sterility, Ms8 (Bannerot et al. 1987). Ms8E02 is maintained by backcrosses with EO, (15 backcrosses had been performed before we crossed it with Corel). Ms8E02 is homozygous for two genes for anthracnose resistance, Are (Mastenbroek 1960) and RVI, heterozygous for a dominant gene

for nuclear male sterility, and homozygous for an elliptic pod section. Elliptic pod section is monogenic and dominant over round section (SGou, present results). Corel is susceptible to anthracnose, fertile, and its pod section is round. Half of the F, individuals from a cross between Ms8E0, and Corel were male sterile. These sterile F l were backcrossed with Corel to generate the BC, progeny. BC, individuals were scored for sterility after observation of four or five flowers per plant. A complete absence of pollen released from the anthers defined sterility. The pod section character was scored on dried pods. Plants were grown in a greenhouse under controlled conditions as described by Gantet et al. ( 199 1 ). Single spore isolates of C . lindemuthianum races 1 and 21 were provided by F. Legrand and J. Tailler (Laboratoire de Cryptogamie, Universite d'Orsay, France). Race 1 corresponds to race a, previously described by Charrier and Bannerot (1970). I t specifically interacts with the Are gene (Table I). Race 21 is a Colombian isolate that specifically interacts with RVI (Table 1). The culture of the fungus and in vitro tests for pathogenicity (on leaves) were performed with each race independently on the backcross progeny as described by Gantet et al. ( 1 99 1). DNA extraction a n d R F L P analysis Isolation of total D N A was performed as described by Dellaporta et al. (1983) with the addition of a CsCl density gradient step. For RFLP analysis, bean DNA was digested with EcoRI, EcoRV, HaeIII, and HindIII restriction enzymes according to the manufacturer (GIBCO BRL, Gaithersburg, Maryland). The D N A fragments were separated on 0.8% (wlv) agarose gels for EcoRI, EcoRV, and HindIII digests and 1% (wlv) agarose gels for Hue111 digests, in Tris-borate EDTA (TBE) buffer (Maniatis et al. 1989). Gels were blotted o n t o positiveTM nylon membranes (Appligkne, lllkirch, France) by a modified alkaline procedure (Reed and Man 1985): after depurination, gels were incubated for 45 min in 0.4 M NaOH and then sprayed with 20X SSC during the v a c u u m transfer ( P h a r m a c i a L K B B i o t e c h n o l o g y Inc., Piscataway, N.J.). Sources of RFLP probes were random low copy number sequences from a bean genomic library of M b o I f r a g m e n t s ( A d a m e t a l . 1 9 9 3 ) inserted i n t o a pBluescriptIIsk vector (Stratagene Cloning Systems, La Jolla, Calif.) and from a PstI bean genomic library (Nodari et al. 1992) a generous gift from P. Gepts ( U C Davis, Calif.). These PstI and MboI libraries represent genomic clones selected for single or low copy sequences. DNA sequences from common bean with known functions were also used a s probes. A genomic D N A c l o n e corresponding t o the phenylalanine ammonia lyase (gPal2, Cramer et al. 1989) and cDNA clones coding for chalcone synthase (pChS114, Ryder et al. 1987), chitinase (pCh4, Hedrick et al. 1988), and two hydroxyproline-rich glycoproteins (Hyp2-13 and Hyp4-1, Corbin et al. 1987) were provided by C.J. Lamb (Salk Institute, San Diego, Calif.). A glucanase (Gluc) cDNA clone ( p G l O l , Edington et al. 1991) was a gift from R.A. Dixon (Noble Foundation, Ardmore, Okla.). An elongation factor cDNA clone (Efl-a, Axelos et al. 1989) was provided by B. Lescure (Universitk P. Sabatier, Toulouse, France). A genomic DNA clone coding for a phaseolin storage protein (Phs, Slightom et al. 1983) was provided by T. Hall (Texas A & M University, Austin, Tex.) and a genomic DNA corresponding to a lipoxygenase gene (Lox) was isolated in our laboratory by P. Bettini. Inserts were obtained by the following polymerase chain reaction ( P C R ) procedure: Escherichia coli clones were grown on Petri dishes of 2XTYagar medium (Maniatis et al. 1989). A single colony was transferred into a sample tube containing 5 0 p L of PCR

917

ADAM-BLONDONET AL.


buffer and was overlayed with one drop of mineral oil. The PCR buffer composition was as follows: 1 X enzyme buffer (Appligitne), 50 FM of each dNTP, 0.1 FM of each primer, and 1 unit of Taq polymerase (Appligitne). One of the primers was the M13 sequencing primer and the other was derived from the M13 reverse sequence primer (5' GGAAACAGCTATGACCATG 3'). Amplification was performed in a Braun thermocycler (Braun Diessel Biotech GmbH, Melsungen, Germany) programmed for 35 cycles of 1 min at 94°C. 1 min and 30 s at 45"C, and 2 min at 72°C. Probes were labeled by primer extension with random hexanucleotide primers (Maniatis et al. 1989). The prehybridization and hybridization steps were performed at 62°C in a solution containing 7% SDS, 250 mM Na-phosphate buffer (pH 7.2), 1 mM EDTA (Church and Gilbert 1984). Three washing steps of 30 min each were performed at 55°C in a solution containing 40 mM phosphate buffer pH 7.2 and 1% SDS. Filters were then exposed (X OMAT-AR Kodak films, Rochester, N.Y.) for 3-4 days at -80°C with an intensifying screen. RA PD analy.sis RAPD analysis were carried out with 10-mer primers (Operon Technologies Inc., Alameda, Calif.) according to the procedure of Operon, except that 2 units of Taq DNA polymerase (Appligitne) were used in each sample. In this case, the thermocycler was programmed as follows: 5 min at 92°C and 35 steps of 1 min at 92"C, 1 min at either 35"C, or 42"C, and 1 min at 72°C. Products were analysed on 1.4% agarose gels in TBE and revealed by ethidium bromide staining.

TABLE 2. Sequence of the two 24-mers oligonucleotide primers derived from the sequence of RoF3

Primers

Sequence

SCF3- 1 SCF3-2

5' CCTGATCACCTTTATGCATGAGAT 3' 5' CCTGATCACCACACAACTCATATA 3'

N o r t : The underlined sequence represents the initial RAPD primer (F3 from Operon Technologies Inc.).

Linkage unuly.sis The segregation ratio (1: 1 for a single locus) and the suspected linkage between genetic markers was analysed using the GeneLink software (X. Montagutelli, Institut Pasteur, France), which performs analysis ( p < 0.01). Markers order and genetic distances were estimated using MapMaker version 2.0 (Lander et al. 1987). A framework was constructed with a LOD score >3 and recombination fraction threshold of 0.28 using "three points" and "compare" commands. Markers were then added with the "Try" command. For each addition of marker, the "Ripple" command and the "Compare" command were used to check the order suggested by the "Try" command. The order of the whole linkage group was chosen with LOD score >2. Recombination fractions were transformed by the Kosambi map function to estimate the map distance (Kosambi 1944).

Results and discussion Polymorphism anulysis RFLP and RAPD techniques were used to search for polymorphism between Ms8E0, and Corel, the two parents of the SCAR analysis BC, population. We used the same four restriction enzymes Individual RAPD bands to be cloned were purified either as Nodari et al. (1993a), while Vallejos et al. (1992) used on a 5% acrylamide gel in 1 X TAE (Maniatis et al. 1989) or subset of three of these enzymes. Forty-six percent of the in a 2% (w/v) agarose gel in 1 X TAE. After ethidium broRFLP probes detected polymorphism between MsSEO, and mide staining, the band was excised. When the fragment Corel. This corresponds to 33% of probe-enzyme combiwas excised from an acrylamide gel, a purification was nations (153 of 459). The percentages of polymorphism carried out as described by Maniatis et al. (1989) to release among the four enzymes were similar. This level of RFLP acrylamide, and then the sample of DNA was reamplified. polymorphism was lower than those reported by Chase et al. When the band was excised from an agarose gel, the fragment (199 l), 60%, and Nodari et al. (1993a), 80-85%. The origin of Ms8E0, and Corel, which are both European improved of agarose was directly processed for a second amplification. The second amplification was carried out using RAPD-PCR bean genotypes, might be the source of this discrepancy. A phaseolin seed storage protein analysis demonstrated that conditions as above, except that the primer concentration EO, possesses Middle American ancestors (S type), while was reduced by twofold. Filling and phosphorylation of the Corel is probably of Andean origin (T type) as are most termini of the DNA fragment were performed using the European snap beans (A.F. Adam and C. Neema, not shown). Klenow fragment of E. coli DNA polymerase and the T, DNA kinase according to Maniatis et al. (1989). After purifiHowever, EO, also has Andean genotypes in its genealogy. cation by chromatography on a s e p h a r o s e R column Thus, the lower level of polymorphism between them is (Pharmacia, Uppsala, Sweden), it was blunt-end ligated into certainly the result of common introgressions during the the SmaI site of a pBluescript plasmid. The R e c E. coli course of their selection process. When compared with other strain DH5a was transformed. Clones were selected and crops, the amount of RFLP (46%) with four restriction tested as probes to detect polymorphism on Southern blots enzymes falls near an average value of previously reported of amplification products. Double-stranded sequencing of results (Helentjaris et al. 1985; Landry et al. 1987; McCouch the cloned PCR product was carried out (T7~equencingTM et al. 1988; Nodari et al. 1992). kit, Pharmacia) by the dideoxy-chain termination method RAPD primers provided two times more polymorphisms using the T7 and KS primers. Two specific oligonucleotides (87%) than RFLP probes. Of the 208 RAPDs distinguishing were then synthesized. Their sequences contained the RAPD MsSE0, and Corel, 54 were analysed in the progeny. While primer at the 5 ' termini and the 14 adjacent nucleotides six primers did not provide reliable polymorphisms, the (Table 2). These two 24-mer oligonucleotides were used in 48 others allowed the analysis of 102 RAPD markers (two a PCR procedure as described by Paran and Michelmore markers per primer in average). This rate is lower than those (1993), except that the annealing temperature of the PCR between genotypes of common bean originating from different reaction was 65°C. Synthetic oligonucleotides and Taq polygene pools: 5.6 (Haley et al. 1993) and 5 (Skroch et al. merase were supplied by Appligitne. 1993). However, similar levels were obtained with

58.5 1 +RoD4c/RoEl Od

30.5

RoH7c

RoE19a

/RoF5 b* /RoG3e* /RoH 1 1 b* RoH 1 1C* RoHl ld*

P9

RoE2c

a

PI0

D 1 290

ROE1Oa

ofjz;;

4

10.0

4.5

3''$T~:1

12.5

10.0 RoG5d Non assigned: ChS. * &P1040*, P2 RoESb, RoE9a, RoE20b, RoJ 1b P8 P12 FIG. 1 . Genetic map of Pl~u.seolusvulgaris. Distances on the left of linkage groups are Kosambi cM. P1002-P4018 are RFLP probes from the MbaI library ("P" is for Paris). D1003-Dl327 are RFLP probes from the PstI library ("D" is for Davis). "Ro" is for RAPD markers and "SC" is for a SCAR marker; the following letters and numbers correspond to the code of the Operon primer. Lowercase suffix letters indicate the various markers detected with a single probe or a single primer. Arrows indicate preliminary results (in these cases a large part of the progeny was not scored). Thicker bars on the linkage groups indicate that the relative order of loci could not be determined with a LOD score >2. In these regions, marker names separated by a solidus represent different loci, while markers not separated by a solidus indicate that no recombinant was observed among them. The names of linkage groups were chosen based on correspondence between this map and the map of Gepts (1993). Common markers between these two maps are underlined.

P3036


919

ADAM-BLONDON ET AL.


Arabidopsis thaliana or Picea glauceae, with approximately 1.5 polymorphic band per polymorphic primer (Reiter et al. 1992; Tulsieram et al. 1992). Two sequence characterized amplified region (SCAR) markers (Paran and Michelmore 1993) were derived from RAPD markers. The construction and the analysis of SCH20 have already been reported (Adam-Blondon et al. 1994). SCF3 was also designed (see Materials and methods) to start long range physical mapping analysis by pulse field gel electrophoresis (Creusot et al. 1992) in the Are genomic region. These two SCARs displayed the same polymorphism as the RAPD markers from which they were derived. SCH20 behaved as a codominant marker, while SCF3 (Table 2) was a dominant marker. Dominance and codominance for SCARs have already been discussed by Paran and Michelmore (1993). Nevertheless, SCARs are much more reliable markers that can be used between different laboratories and will be essential to construct integrated maps when RAPDs are used. Progeny analysis The presence of a gene for male sterility in the EO, background prevented selfing and eliminate the need for additional markers to discard selfed products (Vallejos et al. 1992) in the BCl progeny. The dominant allele Ms8 induces a degeneration of tetrads just after meiosis (Bannerot et al. 1987). No mature pollen is observed in anthers and male sterility is complete. This gene does not affect female fertility (Bannerot et al. 1987). Very few necrotic individuals were observed among backcross populations (less than 4%) and no Fl hybrid weakness was observed. This occurs sometimes in F l progenies from parents derived from two common bean gene pools (Gepts 1988). Four phenotypic markers were scored in the progeny. Two single dominant resistance genes towards anthracnose distinguished Ms8E0, (Are, RVI) from Corel (are, rVI). The presence of RVI was discovered during the analysis of the first set of BC, individuals (J. Grisvard, unpublished data) after the isolation of a race from contaminated seeds from Colombia (J. Tailler and M. Dron, unpublished results) and was confirmed in the present work. As a consequence, only 83 individuals were scored for the RVI gene. Three of the probes (P108 1, P3040, and D 1287) showed several segregating bands, suggesting the existence of duplicated sequences. These sequences were scattered throughout the genome (Fig. 1). Duplicated sequences have also been reported for other crops, such as maize (Helentjaris et al. 1988), Brassicacae (Landry et al. 1991; Song et al. 1991), and pea (Ellis et al. 1992). In these cases, they were correlated with chromosomal translocations and inversions (Ellis et al. 1992; Kanian and Quiros 1992). Of 157 markers analysed in the backcross progeny, 9 1% fit the expected 1: 1 Mendelian ratio. A small proportion (9%) deviated significantly from the expected ratios ( p < 0.05, Table 3). Similar proportions of markers showing distorted segregations were reported in common bean, 7% by Vallejos et al. (1992) for 244 markers and 9% by Nodari et al. (1993a) for 143 markers. These rates are below those reported for rice (lo%, McCouch et al. 1988), potato (25.5%, Gebhardt et al. 1989), and lettuce (17%, Landry et al. 1987). However, Song et al. (1991) reported a smaller proportion in Brassica rapa (3%). Deviations from Mendelian ratios of isozymic markers have also been reported either in intraspecific or in interspecific crosses involving Lens, Capsicum, and Lycopersicon species (Zamir and Tadmor 1986). The average

TABLE3. Loci displaying deviations from Mendelian ratios ( 1 : 1). CIC and C/E represent the number of BC, individuals scored homozygous for the Corel allele (CIC) or heterozygous (CIE); differences in the totals of the two classes between markers are the results of missing data

Group

Locus

CIC

CIE

X2

(1: 1 )

RoD15c RoE3b RoE12b RoJle RoF5b RoC3e RoHll b RoHll c RoHl Id Dl327 RoH7a RoJ17d PI040 ChS

distortion rate was always significantly higher in interspecific crosses (54%) than in intraspecific crosses (13%). The proportion observed in our work obviously falls into the intraspecific category. The distorted markers were the last markers to be integrated in the framework during the map construction. They were concentrated into at least three regions. Eight markers were located within two regions of linkage group P8, three markers on linkage group P1, and two markers were still unassigned (Table 3). Such regions with distorted markers have already been reported in numerous cases (Song et al. 1991; Heun et al. 199 1 ; Landry et al. 199 1 ; Vallejos et al. 1992; Nodari et al. 1993a). Here, the excess of heterozygotes observed for all distorted markers of linkage group P8 could be the result of a particular selection pressure during mating events (Nakamura 1988) and failure of correct transmission of genetic factors in these regions (Zamir and Tadmor 1986). To a lesser extent, this may involve mechanisms related to generation of sterility in interspecific crosses (Guo et al. 1991). Except for ChS, in the present report, the cause of the distortion does not appear to be relevant to the size of the segregating population (1 28 individuals for RAPD markers and 72 for RFLP markers). The larger proportion of RAPD markers presenting deviation from Mendelian ratio ( 1 11102) was not significantly different from the proportion of distorted RFLP markers (3151). In addition, as already discussed, the overall deviation ratio is not significantly higher with RAPDIRFLP mapping than with RFLP only (Vallejos et al. 1992; Nodari et al. 1993a). The RAPD technique should therefore not be responsible for this phenomenon. Linkage analysis Of 157 markers, 150 were mapped in 131 loci and 12 linkage groups (the haploid number of chromosomes in bean is 11; Table 4). Seven were not assigned (Fig. I). Located markers include 96 RAPDs, 2 SCARs, 48 RFLPs, and 4 morphologic traits (Table 4). RFLPs include 13 PstI clones, 26 MboI clones, and 9 known genes (see Materials and methods). The total length of our map was 567.5 cM Kosambi (Table 4). The number of mapped loci for each

GENOME. VOL. 37,

1994

TABLE 4. Characteristics of linkage groups No. of markers


Linkage group

RFLP

RAPD, SCAR

Length of total

Oh,

Morphological

Totallgroup

No. ofloci

of total

Distance between two loci (cM)

%

cM

Average

Maximum

P1 P2 P3 P4 P5 P6

P7 P8 P9 P 10 PI 1 PI 2

Total *Average distance between two loci for the whole map.

linkage group varies between 2 and 27, comprising genetic distances of 10-165 cM. The average interval between two loci was 4.8 cM, with a maximum of 28.5 cM between two markers on linkage group PI. Eighty-eight percent of the intervals between markers were smaller than 10 cM. Our estimation of expected total length of bean genome, using the "method 3" described by Chakravarti et al. (1991), was of 900 cM instead of 1250 cM reported by Gepts et al. (1993) and 1200 cM reported by Vallejos et al. (1992). The latter extrapolations were performed as described by Hulbert et al. (1988). Considering these estimations, this map should represent 46-60% of bean genome. Nineteen RFLP markers (Fig. 1) are common to this map and the map developed in Davis (Gepts 1993; Gepts et al. 1993). Nevertheless, direct correlations between linkage groups of the two maps should be avoided for linkage groups P2, P10, and P12. In these cases no common marker was located. Our results are quite comparable with those reported by . two maps share a lot of resemNodari et al. ( 1 9 9 3 ~ )The blance and some intriguing differences. They both include a similar number of markers and similar ratios of unassigned markers (4.4 and 6%, respectively). Both maps are still incomplete ( 12 linkage groups in Paris and 15 in Davis) (Nodari et al. 1 9 9 3 ~ )However, . while using the same mapping function (Kosambi 1944), the Davis map covered 827 cM (Nodari et al. 1993a) and the Paris map 567.5 cM. To illustrate this discrepancy, four common markers (P 109 1, P2027, D l 3 15, and D1327) to linkage group PI and D l (Gepts et al. 1993; Fig. 1) allowed a preliminary comparison of distances in both maps. Distance between P1091 and P2027 was 3 cM in both cases (Fig. 1, Gepts et al. 1993). D l 3 15 and D 1327 defined the same locus in the Davis map (Gepts et al. 1993) and could not be ordered on the Paris map although recombinants were observed (5.5 cM, Fig. 1). Distances between P2027 and D 13 15 were very different when the two maps were compared, with 42 cM on our map and 114 cM on the Davis map (Gepts et al. 1993). A region showing a high number of recombination events seemed to exist between these two markers on linkage group Dl and not on linkage group PI. Significatively larger distances between

two common markers were also observed on Davis map on linkage group D3 (P1002, D 1132) compared with linkage group P3 and linkage group D5 (D 1 157, D 1301) compared with linkage group P5. There might be different causes for this discrepancy. First, the genetic distance between the two parents of the cross could be involved. This, for example, could explain the existence of clusters in some regions of the map elaborated by Vallejos et al. (1992). Although this was not expected in the present case, which involved an intraspecific cross, an important number of clusters were observed. They were scattered on most linkage groups. These clusters involved different types of markers (RAPD, RFLP). They were constituted, either of markers between which no recombinant was found or of markers representing different loci that could not be ordered in a statistically significant way (Fig. 1). Because these clusters were numerous and dispersed, they are not suspected to correspond to introgressed regions from genetically more distant genotypes. In some cases they might be due to missing data. For example, RFLP markers were scored for 72 individuals. The small size of the populations was a possible cause of the observed clusters in sugar beet (Barzen et al. 1992). The type of progeny and the orientation (because of the use of Ms8) of crosses may also have influenced the observed recombination rate. In addition, although RAPD markers were dispersed all over our map, they might represent specific genomic regions when compared with RFLPs. Some RAPD markers have been reported to correspond to repeated or duplicated sequences (Reiter et al. 1992; Adam-Blondon et al. 1994). As RAPDs represent 75% of the present linkage map, they might lead to a bias that might explain the discrepancy in the estimated genetic size of the bean genome. However, the ratio of RAPDs (54198) involved in clusters is not significantly different from the proportion of RFLPs (18147). RAPDs have now been used in several cases to accelerate genetic mapping (Reiter et al. 1992; Martin et al. 1991; Kleinhofs et al. 1993) or to generate maps for species for which the RFLP technique was not applicable (Tulsieram et al. 1992). No bias in the distribution of RAPD markers has been reported in these cases. The observed suppression of recombination and its origin will be further investigated by different means. Additional

ADAM-BLONDON ET AL.


markers common to other reported maps (Vallejos e t al. 1992; Gepts et al. 1993) will be located. Recently, Gepts et al. (1993) reported a preliminary attempt towards an integrated map for common bean by inserting some molecular markers issued from both Paris (MboI library) and Gainesville (PstI library, Chase et al. 1991) genomic libraries onto their own map. This map consisted of 221 markers but was still incomplete (84% of genome coverage) as 13 linkage groups were observed instead of the expected eleven chromosomes per haploid genome in common bean. This means that additional markers need to be added on different types of progenies in a common effort between independent laboratories. The markers constituting clusters will be further analysed in a set of 47 recombinant inbred lines (F,) derived from a cross between EO, and Core1 (H. Bannerot, unpublished data). This kind of progeny increases the frequency of crossingover (Burr and Burr 199 1). Finally, some clusters located at the center of the linkage groups might be in the vicinity of the centromeres (P 1, P2, P3, P4, P5, P7, P8, P9, P 1 1, Fig. 1). However, information is missing concerning the structure of common bean chromosomes. Polytene chromosomes from I? coccineus suspensor cells are presently used to assign molecular markers to chromosomes (Durante et al. 1977; Schumann et al. 1990). This technique could be used in the future to investigate this hypothesis. Nine genes of known function were mapped. M o s t of them represent gene families. For example, in common bean, 3-10 genes have been reported for phaseolin storage protein (Slightom et al. 1983), at least six genes for chalcone synthase (Ryder et al. 1987), and four for phenylalanine ammonia lyase (Cramer et al. 1989). In all cases, only one member of the gene family was mapped using the present backcross progeny. Some members of these gene families (Ch, ChS, Gluc, P a l , P h s ) were mapped by Nodari e t al. ( 1 9 9 3 ~ ) . Reciprocal checks between the U C Davis and the Paris groups have led to the conclusion that Pa12 was located in the Paris maD while P a l l was located in the UC Davis maD (according to Cramer et al. 1991). The different genes for phaseolin storage protein are known to be clustered (Hall et al. 1983; Gepts 1988). The position of the P h s locus o n group P7 and D7 is in good agreement when the two data sets are compared (present data; Gepts et al. 1993). Several independent genes coding for chalcone synthase (ChS) were located at the same position on D 2 (Nodari et al. 1993a; Gepts 1993). The ChS locus could not be assigned to P2 or any other linkage group. However, at least half of the progeny was not scored for this probe (Table 3). We report here the first assignment for lipoxygenase (Lox), two hydroxyproline rich glycoproteins (Hyp2-13 and Hyp4-1), and one translation elongation factor (Ef) on the map of common bean. The four Mendelian macroscopic traits were located at the extremity of various linkage groups. Are (c2 = 0.03, p > 0.80 for a 1: 1 segregation) mapped at the extremity of P I , RVI (c2 = 0.01, p > 0.90) mapped at one end of P4, and SGou (c2 = 0.52, p > 0.3) mapped at the other end of the same linkage group. Ms8 (c2 = 0.46, p > 0.30) mapped at one extremity of P2. Whether these markers are really located close to chromosome ends requires mapping of telomeres (Burr et al. 1992; Tanksley et al. 1992; Wu and Tanksley 1993). However, comparison between the present data and those reported by Gepts (1993) strengthen their chromosome end location, at least for Are. The common markers, P2027 and P109 1, are located near one end of linkage group D LIP 1 1

92 1

and their order is consistent. Thus, the Are locus should also be close to the extremity of D 1. Numerous cases of genetic mapping of single dominant resistance genes have already been reported (Michelmore e t al. 1992; Tanksley e t al. 1992). Correlations between genetic and physical distances were more consistent away from centromeres and telomeres (Michelmore et al. 1992; Tanksley et al. 1992). In general, centromeric proximity tends to suppress recombination, while telomeric proximity would increase recombination (Ganal et al. 1989), but this is not a rule (Tanksley et al. 1992). The next step in this work will be to estimate a map distance between loci in this region using the already mentioned set of recombinant inbred lines. The correspondence between genetic and physical mapping in the Are region will then be estimated by long range mapping using pulsed field gel electrophoresis (Creusot e t al. 1992). The Pto gene determining single dominant gene resistance towards Pseudomonas syrirzgae pv. tomato was recently cloned by this walking strategy (Martin et al. 1993).

Acknowledgements This work was supported by the CNRS (LTRA 1128) and the Ministtre Franqais de 1'~ducationNationale. The authors thank J. Tailler (Laboratoire de Cryptogamie, Orsay, France) for help with plant pathogenicity tests. J. Grisvard (Dkpartement de Biologie Molkculaire Vkgktale, Orsay, France) was largely involved in early steps of this project. S . Santoni and D. De Vienne are gratefully acknowledged for laboratory facilities, helpful suggestions, and discussions. Authors thank P. Gepts for the communication of unpublished data and fruitful discussions. Adam, A.-F., Creusot, F., Grisvard, J., Sevignac, M., Choisne, N., and Dron, M. 1993. Reverse genetics as an approach to isolate a french bean resistance gene against anthracnose. In Mechanisms of plant defense responses. Edited by B. Fritig and M. Legrand. Kluwer Academic Publishers, The Netherlands. pp. 33-36. Adam-Blondon, A.-F., Sevignac, M., Bannerot, H., and Dron, M. 1994. SCAR, RAPD and RFLP markers linked to a dominant gene (Are) confemng resistance to anthracnose in common bean. Theor. Appl. Genet. In press. Ahn, S.N., Bollich, C.N., and Tanksley, S.D. 1992. RFLP tagging of a gene for aroma in rice. Theor. Appl. Genet. 84: 825-828. Axelos, M., Bardet, C., Liboz, T., Le Van Thai, A., Curie, C., and Lescure, B. 1989. The gene family encoding the Arabidopsis thaliana translation elongation factor EFl -a:molecular cloning, characterization and expression. Mol. Gen. Genet. 219: 106-1 12. Bannerot, H., Bell, J.-M., Bosc, B., and Camut, R. 1987. Un gkne dominant de stkrilitk mile chez le haricot (Phaseolus vulgaris L.). Agronomie (Paris), 7: 563-566. Barzen, E., Mechelke, W., Ritter, E., Seitzer, J.F., and Salamini, F. 1992. RFLP markers for sugar beet breeding+hromosomal linkage maps and location of major genes for Rhizomania resistance, monogermy and hypocotyl colour. Plant J. 2: 601-61 1. Beckmann, J.S., and Soller, M. 1983. Restriction fragment length polymorphisms in genetic improvement: methodologies, mapping and costs. Theor. Appl. Genet. 67: 35-43. Beebe, S.E., and Pastor-Corrales, M.A. 1991. Breeding for disease resistance in common beans. In Research for crop improvement. Edited by A. Van Schoonoven and 0 . Voysest. CAB International, Oxford. pp. 56 1-6 10. Bubeck, D.M., Goodman, M.M., Beavis, W.D., and Grant, D. 1993. Quantitative Trait Loci controlling resistance to gray leaf spot in maize. Crop Sci. 33: 838-847.


922

GENOME, VOL. 37. 1994

Burr, B., and Burr, F. 1993. Recombinant inbreds for molecular mapping in Maize: theoretical and practical considerations. Trends Genet. 7: 55-60. Burr, B., Burr, F.A., Matz, E.C., and Romarosevertson, J. 1992. Pinning down loose ends. Mapping telomeres and factors affecting their length. Plant Cell, 4: 953-960. Chakravarti, A., Lasher, L.K., and Reefer, J.E. 199 1. A maximum likelihood method for estimating genome length using genetic linkage data. Genetics, 128: 175- 182. Charrier, A., and Bannerot, H. 1970. Contribution h l'etude des races physiologiques de l'anthracnose du haricot. Ann. Amelior. Plant. 18: 17 1- 179. Chase, C.D., Ortega, V.M., and Vallejos, C.E. 199 1. DNA restriction fragment length polymorphisms correlate with isozyme diversity in Phaseolus vulgaris L. Theor. Appl. Genet. 81: 806-81 1. Church, G., and Gilbert, W. 1984. Genomic sequencing. Proc. Natl. Acad. Sci. U.S.A. 81: 199 1-1995. Corbin, D.R., Sauer, N., and Lamb, C.J. 1987. Differential regulation of a hydroxyprolin-rich glycoprotein gene family in wounded and infected plants. Mol. Cell. Biol. 7: 6337-6344. Cramer, C.L., Edwards, K., Dron, M., Liang, X., Dildine, S.L., Bolwell, G.P., Dixon, R.A., Lamb, C.J., and Schulh, W. 1989. Phenylalaline ammonia-lyase gene organization and structure. Plant Mol. Biol. 12: 367-383. Creusot, F., Sevignac, M., and Dron, M. 1992. Large-scale mapping using high-molecular-weight DNA from P. vulgaris. Plant Mol. Biol. Rep. 10: 207-218. Dellaporta, S.L., Wood, J., and Hicks, J.B. 1983. A plant DNA micro-preparation: version 11. Plant Mol. Biol. Rep. 1: 19-21. Dudley, J.W. 1993. Molecular markers in plant improvement: manipulation of genes affecting quantitative traits. Crop Sci. 33: 660-668. Durante, M., Cionini, P.G., Avanzi, S., Cremonini, R., and D'Amato, F. 1977. Cytological localization of the genes for the four classes of ribosomal RNA (25S, 18S, 5.8s and 5 s ) in polytene chromosomes of Phaseolus coccineus. Chromosoma, 60: 269-282. Edington, B.V., Lamb, C.J., and Dixon, R.A. 1991. cDNA cloning and characterization of a putative 1,3-P-glucanase transcript induced by fungal elicitor in bean cell suspension cultures. Plant Mol. Biol. 16: 81-94. Ellis, T.H.N., Turner, L., Hellens, R.P., Lee, D., Harker, C.L., Enard, C., Domoney, C., and Davies, D.R. 1992. Linkage maps in pea. Genetics, 130: 649-663. Fouilloux, G. 1979. New races of bean anthracnose and consequences on a breeding program. In Diseases of tropical food crops. Edited by H. Maraite and J.A. Mayer. Universitk Catholique de Louvain, Louvain-La-Neuve, Belgium. pp. 221 -235. Ganal, M., Young, N., and Tanksley, S.D. 1989. Pulse-field gel electrophoresis and physical mapping of large DNA fragments in the Tm-2a region of chromosome 9 in tomato. Mol. Gen. Genet. 215: 395-400. Gantet, P., Bettini, P., Grisvard, J., and Dron, M. 1991. Genetic linkage between Mexll, a specific resistance gene to anthracnose and Anp, a pod anthocyanin accumulation in bean. Plant Dis. 75: 94 1-942. Gardiner, J.M., Coe, E.H., Melia-Hancock, S., Hoisington, D.A., and Chao, S. 1993. Development of a core RFLP map in maize using an immortalized F, population. Genetics, 134: 9 17-930. Gebhardt, C., and Salamini, F. 1992. Restriction Fragment Length Polymorphism Analysis of plant genomes and its application to plant breeding. Int. Rev. Cytol. 135: 201-237. Gebhardt, C., Ritter, E., Debener, T., Schachtschabel, V., Wakemeier, B., Uhrig, A., and Salamini, F, 1989. RFLP analysis and linkage mapping in Solanum tuberosum. Theor. Appl. Genet. 78: 65-75. Gepts, P. 1988. Phaseolin as an evolutionary marker. Genetic

resources of Phaseolus beans. In Current plant science and biotechnology in agriculture. Edited by P. Gepts. Kluwer Academic Publishers, Dordrecht, The Netherlands. pp. 215-241. Gepts, P. 1993. Linkage map of common bean (Phaseolus vulgaris L.) 2N = 22. In Genetic maps. Locus maps of complex genomes. 6th ed. Edited by S.J. O'Brien. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. pp. 6.101-6.109. Gepts, P., Nodari, R., Tsai, S.M., Koinange, R.M.K., Llaca, V., Gilbertson, R., and Guzmhn, P. 1993. Linkage mapping in common bean. Annu. Rep. Bean Improv. Coop. 36: 24-38. Graner, A., and Bauer, E. 1993. RFLP mapping of the ym4 virus resistance gene in barley. Theor. Appl. Genet. 86: 689-693. Guo, M., Lightfoot, D.A., Mok, M.C., and Mok, D.W.S. 199 1. Analysis of Phaseolus vulguris L. and P. coccineus Lam. hybrids by RFLP: preferential transmission of P. vulgaris alleles. Theor. Appl. Genet. 81: 703-709. Haley, S.D., Miklas, P.N., Stavely, J.R., Byrum, J., and Kelly, J.D. 1993. Identification of RAPD markers linked to a major rust resistance gene block in common bean. Theor. Appl. Genet. 86: 505-5 12. Hall, T.C., Slightom, J.L., Ersland, D.R., Murray, M.G., Hoffman, L.M., Adang, M.J., Brown, J.W.S., Ma, Y., Matthews, J.A., Cramer, J.H., Barker, R.F., Sutton, D.W., and Kemp, J.D. 1983. Phaseolin: nucleotide sequence explains molecular weight and heterogeneity of a small multigene family and also assists vector construction for gene expression in alien tissue. In NATO Advanced Science Institutes Series. Vol. 63. Edited by 0 . Ciferri and L. Dure. Plenum, N.Y. pp. 123-142. Hedrick, S.A., Bell, J.N., Boller, T., and Lamb, C.J. 1988. Chitinase cDNA cloning and mRNA induction by fungal elicitor, wounding and infection. Plant Physiol. 86: 182-1 86. Helentjaris, T., King, G., Slocum, M., Siedenstrand, C., and Wegman, S. 1985. Restriction fragment length polymorphism as probes for plant diversity and their development as tools for applied plant breeding. Plant Mol. Biol. 5: 109-1 18. Helentjaris, T., Weber, D., and Wright, S. 1988. Identification of genomic locations of duplicate nucleotide sequences in maize by analysis of restriction fragment length polymorphisms. Genetics, 118: 353-363. Heun, M., Kennedy, A.E., Anderson, J.A., Lapitan, N.L.V., Sorrells, M.E., and Tanksley, S.D. 1991. Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare). Genome, 34: 437-447. Hulbert, S.H., llott, T.W., Legg, E.J., Lincoln, S.E., Lander, E.S., and Michelmore, R.W. 1988. Genetic analysis of the fungus, Bremiu lactucae, using restriction fragment length polymorp h i s m ~ Genetics, . 120: 947-958. Jahoor, A., Jacobi, A., Schiiller, C.M.E., and Fischbeck, G. 1993. Genetical and RFLP studies at the Mla locus conferring powdery mildew resistance in barley. Theor. Appl. Genet. 85: 713-718. Kanian, S.F., and Quiros, C.F. 1992. Generation of a Brassica oleracea composite RFLP map: linkage arrangements among various populations and evolutionary implications. Theor. Appl. Genet. 84: 544-554. Kesseli, R.V., Paran, I., and Michelmore, R.W. 1990. Genetic linkage map of lettuce (Lactuca saliva, 2N = 18). In Genetics maps. 5th ed. Edited by S.J. O'Brien. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. pp. 6.100-6.103. Kiss, G.B., Csanhdi, G., Khlmhn, K., Kalo, P., and okrksz, L. 1993. Construction of a basic genetic map of alfalfa using RFLP, RAPD, isozyme and morphological markers. Mol. Gen. Genet. 238: 129-1 37. Kleinhofs, A., Kilian, A., Maroof, M.A.S., Biyashev, R.M., Hayes, P., Chen, F.Q., Lapitan, N., Fenwick, A., Blake, T.K., Kanazin, V., Ananiev, E., Dahleen, L., Kudrna, D., Bollinger, J., Knapp, S.J., Liu, B., Sorrells, M., Heun, M., Franckowiak, J.D., Hoffman, D., Skadsen, R., and Steffenson, B.J. 1993. A molecular, isozyme and morphological map of the barley

ADAM-BLONDON ET AL.


(Hordeum vulgare) genome. Theor. Appl. Genet. 86: 705-7 12. Koenig, R.L., and Gepts, P. 1989. Allozyme diversity in wild Phaseolus vulgaris: further evidence for two major centers of genetic diversity. Theor. Appl. Genet. 78: 809-8 17. Kosambi, D.D. 1944. The estimation of map distances from recorrtbination values. Ann. Eugen. 12: 172-1 75. Lander, E.S., Green, P., Abrahamson, J., Barlow, A., Daly, M., Lincoln, S.E., and Newburg, L. 1987. MapMaker: an interactive computer package for constructing primary genetic linkage maps of experimental and natural population. Genomics, 1: 174-181. Landry, B.S., Kesseli, R.V., Farrara, B., and Michelmore, R.W. 1987. A genetic map of lettuce (Lactuca sativa L.) with restriction fragment length polymorphism, isozyme, disease resistance and morphological markers. Genetics, 116: 33 1-337. Landry, B.S., Hubert, N., Takeomi, E., Harada, J.J., and Lincoln, S.E. 199 1. A genetic map for Brassica napus based on Restriction Fragment Length Polymorphism detected with expressed DNA sequences. Genome, 34: 543-552. Lobler, M., and Hirsch, A.M. 1990. RFLP mapping of the abpl locus in maize (Zea mays L.). Plant Mol. Biol. 15: 5 13-5 16. Mackill, D.J., Salam, M.A., Wang, Z.Y., and Tanksley, S.D. 1993. A major photoperiosensitivity gene tagged with RFLP and isozyme markers in rice. Theor. Appl. Genet. 85: 536-540. MahC, A., Grisvard, J., Desnos, T., and Dron, M. 1992. Bean Colletotrichum lindemuthianum compatibles interactions: time course of plant defense response depends on race. Mol. PlantMicrobe Interact. 5: 472-478. MahC, A., Grisvard, J., and Dron, M. 1993. Two avirulent races of Colletotrichum lindemuthianum trigger different time-course of plant defense reaction in bean. Mol. Plant-Microbe Interact. 6: 423-428. Maniatis, T., Fritsch, E.F., and Sambrook, L. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Martin, G.B., Williams, M.C., and Tanksley, S.D. 1991. Rapid identification of markers linked to a Pseudomonas resistance gene in tomato by using random primers and near-isogenic lines. Proc. Natl. Acad. Sci. U.S.A. 88: 2336-2340. Martin, G.B., Brommonschenkel, S.H., Chungwongse, J., Frary, A., Ganal, M.W., Spivey, R., Wu, T., Earle, E.D., and Tanksley, S.D. 1993. Map-based cloning of a protein kinase gene conferring disease resistance in tomato. Science (Washington, D.C.), 262: 1432-1436. Mastenbroek, C. 1960. A breeding program for resistance to anthracnose in dry shell haricots beans, based on a new gene. Euphytica, 9: 177-258. McCouch, S., Kochert, G., Yu, Z.W., Khush, G., Coffman, W., and Tanksley, S. 1988. Molecular mapping of rice chromosomes. Theor. Appl. Genet. 76: 815-829. Melchinger, A.E. 1990. Use of molecular markers in breeding for oligogenic disease resistance. Plant Breed. 104: 1-19. Michelmore, R.W., Kesseli, R.V., Francis, D.M., Paran, I., Fortin, M.G., and Young, C.H. 1992. Strategies for cloning plant disease resistance genes. In Molecular plant pathology, a practical approach. Vol. 2. Edited by S. Gurr. IRC Press, Oxford. pp. 233-287. Nakamura, R.R. 1988. Seed abortion and seed size variation within fruits of Phaseolus vulgaris: pollen donor and resource limitation effects. Am. J. Bot. 75: 1003-1010. Nodari, R.O., Koinange, E.M.K., Kelly, J.D., and Gepts, P. 1992. Towards an integrated linkage map of common bean. 1. Development of genomic DNA probes and levels of restriction fragment length polymorphism. Theor. Appl. Genet. 84: 186-192. Nodari, R.O., Tsai, S.M., Gilbertson, R.L., and Gepts, P. 1993a. Towards an integrated linkage map of common bean. 2. Development of an RFLP-based linkage map. Theor. Appl. Genet. 85: 5 13-520.

923

Nodari, R.O., Tsai, S.M., Guzman, P., Gilbertson, R.L., and Gepts, P. 19936. Toward an integrated linkage map of common bean. 111. Mapping genetic factors controlling host-bacteria interactions. Genetics, 134: 341-350. Paran, I., and Michelmore, R.W. 1993. Development of reliable PCR-based markers linked to downy mildew resistance genes in lettuce. Theor. Appl. Genet. 85: 985-993. Paran, I., Kesseli, R., and Michelmore, R. 1991. Identification of restriction fragment length polymorphism and random amplified polymorphic DNA markers linked to downy mildew resistance genes in lettuce, using nearisogenic lines. Genome, 34: 1021-1027. Paterson, A.H., Lander, E.S., Hewitt, J.D., Peterson, S., Lincoln, S.E., and Tanksley, S.D. 1988. Resolution of quantitative traits into Mendelian factors by using a complete linkage map of restriction fragment polymorphisms. Nature (London), 335: 72 1-726. Pillen, K., Steinriicken, G., Wricke, G., Herrmann, R.G., and Jung, C. 1992. A linkage map of sugar beet (Beta vulgaris L.). Theor. Appl. Genet. 84: 129-135. Rafalski, J.A., and Tingey, S.V. 1993. Genetic diagnostics in plant breeding: RAPDs, microsatellites and machines. Trends Genet. 9: 275-279. Reed, K.C., and Man, D.A. 1985. Rapid transfer of DNA from agarose gels to nylon membranes. Nucleic Acids Res. 13: 7207-722 1. Reiter, R.S., Williams, J.G.K., Feldmann, K.A., Rafalski, J.A.; Tingey, S.V., and Scolnik, P.A. 1992. Global and local genome mapping in Arabidopsis thaliana by using recombinant inbred lines and random amplified polymorphic DNAs. Proc. Natl. Acad. Sci. U.S.A. 89: 1477-1481. Ryder, T.B., Hedrick, S.A., Bell, J.N., Liang, X., Clouse, S.D., and Lamb, C.J. 1987. Organization and differential activation of a gene family encoding the plant defense enzyme chalcone synthase in Phaseolus vulgaris. Mol. Gen. Genet. 210: 219-233. Schumann, K., Baumann, A., and Nagl, W. 1990. Localization of phaseolin genes in the polythene chromosomes of Phaseolus coccineus (Leguminosae). Genetica (The Hague), 83: 73-76. Skroch, P., Tivang, J., and Nienhuis, J. 1993. Analysis of genetic relationships using RAPD marker data. In Application of RAPD technology to plant breeding. Joint plant breeding symposia series, November 1, 1992, Minneapolis, Minnesota. Slightom, J.L., Sun, S.M., and Hall, T.C. 1983. Complete nucleotide sequence of a French bean storage protein gene: Phaseolin. Proc. Natl. Acad. Sci. U.S.A. 80: 1887-1901. Slocum, M.K., Fidgore, S.S., Kennard, W.C., Suzuki, J.Y., and Osborn, T.C. 1990. Linkage arrangement of restriction fragment length polymorphisms loci in Brassica oleracea. Theor. Appl. Genet. 80: 57-64. Song, K., Osborn, T.C., and Williams, P.H. 1991. Brassica taxonomy based on nuclear restriction fragment length polymorphism (RFLPs). 3. Genome relationships in Brassica and related genera and the origin of B. oleracea and B. napa (syn. campestris). Theor. Appl. Genet. 79: 497-506. Tanksley, S.D., Young, N.D., Paterson, A.H., and Bonierbale, M.W. 1989. RFLP mapping in plant breeding: new tools for an old science. BioITechnology, 7: 257-264. Tanksley, S.D., Ganal, M.W., Prince, J.P., de Vincente, M.C., Bonierbale, M.W., Broun, P., Fulton, T.M., Giovannoni, J.J., Grandillo, S., Martin, G.B., Messeguer, R., Miller, J.C., Miller, L., Paterson, A.H., Pineda, O., Roder, M.S., Wing, R.A., Wu, W., and Young, N.D. 1992. High density molecular linkage maps of tomato and potato genomes. Genetics, 132: 1 141-1 160. Timmerman, G.M., Frew, T.J., Miller, A.L., Weeden, N.F., and Jermyn, W.A. 1993. Linkage mapping of sbm-I, a gene conferring resistance to pea seed-borne mosaic virus, using molecular markers in Pisum sativum. Theor. Appl. Genet. 85: 609-615. Tulsieram, L.K., Glaubitz, J.C., Kiss, G., and Carlson, J.E. 1992.

924

GENOME, VOL. 37, 1994


Single tree genetic linkage mapping in conifers using haplo'id DNA from megagametophytes. BioITechnology, 10: 686-690. Vallejos, C.E., and Chase, C.D. 1991. Linkage between isozyme markers and a locus affecting seed size in Phaseolus vulgaris L. Theor. Appl. Genet. 81: 41 3-419. Vallejos, C.E., Sakiyama, N.S., and Chase, C.D. 1992. A molecular marker-based linkage map of Phaseolus vulgaris L. Genetics, 131: 733-740. Van der Beek, J.G., Verkerk, R., Zabel, P., and Lindhout, P.

1992. Mapping strategy for resistance genes in tomato based on RFLPs between cultivars - C f 9 (resistance to Cladosporium jiulvurn) on chromosome- 1. Theor. Appl. Genet. 84: 106-1 12. Williams, J.G.K., Hanafey, M.K., Rafalski, J.A., and Tingey, S.V. 1993. Genetic analysis using Random Amplified Polynlorphic DNA markers. Methods Enzymol. 218: 704-740. Zamir, D., and Tadmor, Y. 1986. Unequal segregation of nuclear genes in plants. Bot. Gaz (Chicago), 147: 355-358.