A guide for in-house design of template-switch-based

Analytical Biochemistry 397 (2010) 227–232

Contents lists available at ScienceDirect

Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio

A guide for in-house design of template-switch-based 50 rapid amplification of cDNA ends systems Fernando Lopes Pinto, Peter Lindblad * Department of Photochemistry and Molecular Science, Ångström Laboratories, Uppsala University, SE-75120 Uppsala, Sweden

a r t i c l e

i n f o

Article history: Received 10 September 2009 Available online 1 November 2009 Keywords: 50 RACE PCR Template-switching

a b s t r a c t Rapid amplification of cDNA ends (RACE) is an established strategy used to determine the transcription start point(s) and the 50 untranslated region(s) of mRNA. Different approaches to perform 50 RACE are available, and one particularly simple and powerful strategy is based on a phenomenon called template-switching. We investigated different aspects of template-switch-based 50 RACE, and we describe the different steps leading to the in-house development of a complete 50 RACE system—from oligonucleotide design to polymerase chain reaction (PCR) amplification. We show that the resulting system is reliable, time-efficient, and inexpensive. Ó 2009 Elsevier Inc. All rights reserved.

Rapid amplification of cDNA ends (RACE)1 is an established strategy used to determine the transcription start point(s) (TSP) and the 50 untranslated region(s) of any given transcript [1–3]. This information is important for a number of reasons, including the facts that (i) knowledge of the upstream region from the 50 end might help to determine possible transcription regulation mechanisms and (ii) the untranslated regions can encode structural information that is important for mRNA stability, putative subcellular localization, or even translational efficiency [4]. Several commercial kits that perform 50 RACE are available, but most are geared toward the construction of full-length cDNA pools. These kits employ different approaches, as presented and described by Scotto-Lavino and coworkers [4], including a strategy that is both simple and powerful based on a phenomenon called template-switching. Clontech introduced this technique in 1996, when it was initially designated ‘‘CapFinder” but later renamed as the ‘‘SMART” product line. The procedure is based on the ability of the murine leukemia reverse transcriptase (M-MuLV) to add a few cytosine residues to the 30 end of newly synthesized cDNA on reaching the 50 end of the mRNA [5]. A template-switch oligonucleotide (TSO), containing a terminal 30 poly-G, can then pair with the cDNA 50 poly-C tail, itself becoming a template for reverse transcription (RT) (see Fig. 1).

Nevertheless, the TSO has been shown to prime cDNA synthesis itself, leading to a synthesis of unspecific products during polymerase chain reaction (PCR) [4,6–8]. To overcome this, the cDNA with the integrated TSO can be used as template for step-out PCR [6]. During step-out PCR, the TSO-primed cDNA becomes flanked by inverted terminal sequences that act as PCR suppressors [9] due to the use of a universal primer mix (UPM). The UPM is composed of a long primer and a short primer. As shown in Fig. 1, the long primer contains both the short primer sequence and part of the TSO. The long primer is specific for the cDNA produced by templateswitching but is inefficient during PCR because it is present in low concentration. However, the short primer is specific for the distal part of the long primer and is used in higher concentration. It is the short primer, together with a gene-specific antisense primer, that drives the PCR product amplification. The PCR products, including the mRNA 50 region, are then cloned and sequenced. In this work, we explored different aspects of template-switchbased 50 RACE, first to understand the technique and then to improve it. We combined aspects from previously described approaches [5,7,10,11] with additional modifications so as to (i) improve sensitivity, (ii) increase terminal M-MuLV transferase activity, (iii) minimize endogenous priming, (iv) perform fast and accurate two-step PCR, (v) reduce PCR background, and (vi) lower costs.

* Corresponding author. Fax: +46 18 4716844. E-mail address: [email protected] (P. Lindblad). 1 Abbreviations used: RACE, rapid amplification of cDNA ends; cDNA, complementary DNA; TSP, transcription start point; mRNA, messenger RNA; M-MuLV, murine leukemia reverse transcriptase; TSO, template-switch oligonucleotide; RT, reverse transcription; PCR, polymerase chain reaction; UPM, universal primer mix; EDTA, ethylenediaminetetraacetic acid; DTT, dithiothreitol; tRNA, transfer RNA.

Materials and methods

0003-2697/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2009.10.022

Cyanobacteria growth conditions Anabaena sp. PCC 7120 was grown at 25 °C in BG110 liquid medium [12] under continuous illumination (40 lmol photons m2 s1)

228

In-house design of 50 RACE systems / F.L. Pinto, P. Lindblad / Anal. Biochem. 397 (2010) 227–232

cDNA synthesis

The extraction of RNA was carried out as described previously [14]. Briefly, 1 ml of extraction buffer was added to a cyanobacterial cell pellet. After resuspending the cells, the tubes were incubated at 95 °C for 5 min before being placed on ice for 5 min. After the addition of 100 ll of bromochloropropane and incubation at room temperature, the extraction mix was centrifuged (12,000g, 15 min) to promote phase separation. The aqueous phase was then retrieved and mixed with an equal volume of isopropanol, incubated at room temperature, and centrifuged (12,000g, 10 min) to concentrate the precipitated RNA. The RNA pellet was washed using 75% ethanol, after which it was air-dried and then finally dissolved in nuclease-free water.

All incubations were performed with a thermal cycler in 0.2-ml tubes using primers given in Table 1 and buffer compositions given in Table 2. Briefly, RNA denaturation took place at 65 °C, for 5 min, in the presence of dNTPs. The temperature was then lowered to either 42 or 50 °C, depending on how the cDNA extension and template-switch phases were performed. If performed in a single step, 17.5 ll of the prewarmed mastermix was added to the denatured RNA and the reaction proceeded for 90 min at 42 °C. If performed in two steps, 7.5 ll of prewarmed cDNA elongation mastermix was added to the denatured RNA. After incubation at 50 °C for 60 min, 10 ll of prewarmed template-switching mastermix was added, the temperature was lowered to 42 °C, and the reactions were incubated for an additional 90 min. After elongation and template-switching, 80 ll of 2.3 mM ethylenediaminetetraacetic acid (EDTA) was added to the reactions and the reverse transcriptase was inactivated by incubation for 10 min at 70 °C. For the reverse transcriptase selection tests, cDNA elongation and template-switching took place in distinct steps and as described above. The reverse transcriptases tested were SuperScript II (Invitrogen), RevertAid H minus (Fermentas), RevertAid Premium (Fermentas), and RevertAid M-MuLV (Fermentas). To test additive compatibility, trehalose (0.3 M) and/or betaine (0.6 M) were used during the cDNA extension step. These tests were performed for SuperScript II, RevertAid H minus, and RevertAid M-MuLV. The template-switch duration tests followed the compositions given in Table 2 for cDNA extension and template-switching phases, but with varying times for the template-switching phase (20–240 min). These experiments used either SuperScript II or RevertAid H minus as reverse transcriptase. During the reverse transcriptase addition tests, trials were carried out using a ‘‘nonideal” buffer (50 mM Tris–HCl [pH 8.5], 75 mM KCl, 40 mM (NH4)2SO4, 6 mM MgCl2, and 10 mM dithiothreitol [DTT]) instead of the ‘‘Buffer 5” in Table 2. In addition, reverse transcriptase was excluded from the template-switch phase for some of the experiments. Only RevertAid H minus was used for these tests.

Oligo sequence generation and selection

cDNA amplification and cloning

The sequence selection was carried out by combined use of our previously published tools and software. From WebTag [15], we obtained tags that were simultaneously absent from the genomes of Synechocystis sp. PCC 6803, Anabaena sp. PCC 7120, and Nostoc punctiforme ATCC 29133. To generate TSO candidates, a 5-baselong poly-G was concatenated at the 30 end to each tag obtained from WebTag. To construct UPM long oligonucleotide, a second tag sequence was appended to the 50 end of the TSO tag. For all oligonucleotides generated, subroutines from Tagenerator [16] were used to calculate putative secondary structure-free energies.

All incubations were performed with a thermal cycler in 0.2ml tubes using primers given in Table 1. For PCR, 1 ll of cDNA was used as template in a 20-ll reaction according to the guidelines for Phire DNA polymerase (Finnzymes) use. Briefly, an initial denaturation step took place at 98 °C for 30 s, followed by 42 cycles of 98 °C for 5 s plus 72 °C for 20 s and a final extension step at 72 °C for 1 min. For the amplifications concerning the determination of the ideal reaction time for template-switching, the number of cycles was 36. To evaluate the 30 C3-spacer TSO blocking, the UPM was replaced by the U_SENSE oligo during PCR.

Fig. 1. Basic mechanism of template-switching. A schematic representation of the template-switch-based 50 RACE is shown. Synthesis of cDNA is primed by a genespecific primer (GSP), and as the reverse transcriptase reaches the 50 end of the mRNA, a few cytosines are added to the cDNA. The 30 poly-G tail of the TSO then pairs with the cDNA poly-C and is used as template for reverse transcriptase. During polymerase chain reaction (PCR), a gene-specific antisense primer upstream of the GSP is combined with a TSO-specific sense primer, resulting in a PCR product that includes the 50 terminal sequence of the target mRNA.

and sparged with air. As described previously [13], dark anaerobic conditions were achieved by replacing the air with 100% argon and covering the culture with aluminum foil. Synechocystis sp. PCC 6803 cells were grown at 25 °C in BG11 medium [12] at a light intensity of 40 lmol m2 s1 and sparged with air. RNA extraction

Table 1 Primers used in this study. Description

Name

Sequence (50 –30 )

RT reaction template-switch oligonucleotides PCR-specific sense primer PCR-specific UPM long component PCR-specific UPM long component Synechocystis PCC 6803 lexA antisense Synechocystis PCC 6803 hoxE antisense Anabaena PCC 7120 hoxU antisense

TSO U_SENSE UPM_LONG UPM_SHORT lexA_AS68 hoxE_AS68 hoxU_AS68

GTCGCACGGTCCATCGCAGCAGTCACAGGGGG GTCGCACGGTCCATCGCAGCAGTC ACGCTGACGCTGAGCCTACCTGACGTCGCACGGTCCATCGCAGCAGTC ACGCTGACGCTGAGCCTACCTGAC CCAGTTCACCGCCTTTGAGTTCGCCAATGACG ACGCTTGTCTCCACTAGGATGGGCCG ACACAGCCGACAAGCACCCACATCACC

Note. All oligonucleotides presented here are deoxynucleotide based and nonmodified except for the TSO that contains a 30 C3-spacer.

In-house design of 50 RACE systems / F.L. Pinto, P. Lindblad / Anal. Biochem. 397 (2010) 227–232

229

Table 2 Reverse transcription reaction-optimized formulations. RNA denaturation (ll)

Combined elongation and switching (ll)

cDNA elongation (ll)

Templateswitching (ll)

RNA (H2O) GSP (10 lM) dNTP (10 mM) Buffer 5 Water MgCl2 (25 mM) MnCl2 (100 mM) Trehalose (1.2 M) Betaine (5 M) RNase inhibitor (40 U/ll) TSO (10 lM) RT (200 U/ll)

1.0 0.5 1.0 – – – – – – –

– – – 4.0 4.1 1.6 0.6 2.5 1.2 0.5

– – – 2.0 – 0.8 – 2.5 1.2 0.5

– – – 2.0 4.1 0.8 0.6 – – –

– –

2.0 1.0

– 0.5

2.0 0.5

UPM versus single sense primer use

Final volume (ll)

2.5

17.5

7.5

10.0

Because the TSO that we used is blocked at its 30 end, we tested to determine the extent to which TSO elongation was prevented. As seen in Fig. 3, the use of only the U_SENSE results in the amplification of a specific product—the same as that observed when the UPM is used.

Note. Detailed component use for each reaction moment is shown. The RNA denaturation is common to both procedures, and the amount of RNA used varied between 1 and 3 lg for all experiments shown. The reaction continues either with a single-step combined elongation and switching or by separating into cDNA elongation followed by template-switching. Ideally, mastermixes should be produced just prior to use so as to save time and minimize pipetting errors. GSP is genespecific primer. Buffer 5 corresponds to the buffer supplied by Fermentas with the reverse transcriptase RevertAid H minus (250 mM Tris–HCl [pH 8.3 at 25 °C], 250 mM KCl, 20 mM MgCl2, and 50 mM DTT). The RNase inhibitor used was the RiboLock RNase inhibitor from Fermentas.

Fig. 3. Blocked oligonucleotide eliminates PCR background. A comparison of PCRspecific oligonucleotides is shown. PCR products from the use of UPM show slightly higher molecular weight because the UPM long oligonucleotide is double the size of the U_SENSE primer.

Selecting adequate RT enzyme

PCR products were cloned using the CloneJET PCR Cloning Kit (Fermentas). All sequencing reactions were carried out by Macrogen.

We tested different commercially available M-MuLV-derived reverse transcriptases, with only RevertAid M-MuLV having unsatisfactory results (see Fig. 4). Even in the presence of trehalose (0.3 M) for thermal protection [20], and after having repeated the experiments, we still did not observe the expected product after PCR. The PCR products obtained were cloned and sequenced, and the TSP identified matches previously published data [13].

Results

Testing additive compatibility

The following data represent a subset of all our experiments that reflects our overall results. All results shown are the product of at least three replicates.

After testing trehalose, we decided to test another effective RT additive, namely betaine [21]. As seen in Fig. 5, trehalose (0.3 M), betaine (0.6 M), and the simultaneous use of both are compatible with template-switching.

Procedure application and reproducibility for selected examples Overcoming low enzyme activity due to long reaction times To test the designed oligonucleotides (see Table 1) and system, we used Synechocystis sp. PCC 6803 lexA mRNA as target (see Fig. 2). The resulting PCR products are specific, and the sequencing data obtained are in accordance with the information published previously [13,17–19].

As seen in Fig. 6, adding reverse transcriptase during the template-switch phase improves yield during the subsequent PCR (see also Table 2). That effect becomes clearer when a buffer that is not ideal for RT is used. In this instance, the addition of reverse

Fig. 2. PCR product is the result of template-switching. Specificity and validation of template-switching 50 RACE is shown. (A) Different cDNA synthesis or amplification strategies were used to demonstrate PCR product specificity, having Synechocystis sp. PCC 6803 lexA mRNA as template. (B) Use of the suggested three-phase procedure on previously described mRNA targets: Synechocystis sp. PCC 6803 hoxE, Synechocystis sp. PCC 6803 lexA, and Anabaena sp. PCC 7120 hoxU.

230

In-house design of 50 RACE systems / F.L. Pinto, P. Lindblad / Anal. Biochem. 397 (2010) 227–232

Fig. 4. Selection of appropriate M-MuLV reverse transcriptase. Testing of different reverse transcriptase enzymes and the effect of trehalose (0.3 M) are shown. SSII, SuperScript II; H, RevertAid H minus; P, RevertAid Premium; H+, RevertAid M-MuLV. Reactions shown had Anabaena sp. PCC 7120 hoxU as template during RT.

Fig. 5. Template-switching is compatible with the use of additives. Templateswitching is compatible with known RT additives: trehalose (0.3 M) and betaine (0.6 M). Reactions shown had Anabaena sp. PCC 7120 hoxU as template during RT.

transcriptase has an even higher impact on the downstream PCR yield.

Fig. 6. Overcoming prolonged reaction time effects on RT activity. Effect of the addition of reverse transcriptase during the template-switching phase is shown. RA, buffer 5; HM, nonideal buffer (350 mM Tris–HCl [pH 8.5], 375 mM KCl, 200 mM (NH4)2SO4, 30 mM MgCl2, and 50 mM DTT); +, no addition of reverse transcriptase during template-switch phase; ++, additional reverse transcriptase added just prior to template-switch phase. Reactions shown had Anabaena sp. PCC 7120 hoxU as template during RT.

Determining optimal reaction times As seen in Fig. 7, 90 min seems to be the preferred time for template-switching given that it results in increased yield during PCR when compared with 30- and 60-min incubations. Longer reaction times did not result in increased yield. Discussion TSO design As a starting point for TSO design, we defined the following set of essential properties: (i) the sequence should be absent from the genomes of the model organisms that we typically use, (ii) the 30 poly-G should be 5 bases long, (iii) the 50 section should have a melting temperature of 68 ± 1 °C, (iv) any putative secondary structures should have free energy values above 4 kcal/mol, and (v) the TSO should contain only deoxynucleotides. The length of the poly-G used was based on the estimated yield of tailing of the cDNA during RT [10]. Within the TSO, the initial 24-base-long region corresponds to the tag U_SENSE and has a melting temperature of 69 °C, a minimum dimer free energy of 3.24 kcal/mol, and a minimum hairpin free energy of 1.17 kcal/mol. The sequence comprising the full length of the TSO has a minimum free energy value of 3.54 kcal/mol for the dimer and 1.76 kcal/mol for the hairpin. The values for the full TSO and its tag portion are quite similar. However, these could be achieved only after introducing a 3base-long ‘‘bridge” between the tag region and the poly-G. In Table 3, we show secondary structure free energies for the tag (top row), the tag with appended poly-G (second row), the final

Fig. 7. Optimal duration of template-switch phase. Determination of the ideal reaction time for template-switching after cDNA extension, having Anabaena sp. PCC 7120 hoxU mRNA as target during RT and 36 cycles of PCR performed using U_SENSE plus hoxU_68AS as primers, is shown.

TSO (final row), and some other combinations that we tested and discarded. The bridge region might not be needed, depending on the sequence of the tag chosen and the length of the poly-G. UPM design To construct the UPM long oligonucleotide (UPM_LONG), a second tag sequence (UPM_SHORT) was appended to the 50 end of the U_SENSE. The UPM_SHORT was selected to (i) have a melting temperature of 68 ± 1 °C, (ii) possess low sequence similarity to U_SENSE, and (iii) result in a UPM_LONG having free energy values for secondary structures above 8 kcal/mol. The UPM_SHORT oligonucleotide has a melting temperature of 67 °C. The resulting UPM_LONG oligonucleotide has 7.44 and 4.91 kcal/mol free energy values for the strongest putative dimer and hairpin interactions found, respectively.

In-house design of 50 RACE systems / F.L. Pinto, P. Lindblad / Anal. Biochem. 397 (2010) 227–232

231

Details of reverse transcriptase use

Table 3 Free energies for different TSO-related oligonucleotides. Oligonucleotide sequence (50 –30 )

Dimer (kcal/ mol)

Hairpin (kcal/ mol)

GTCGCACGGTCCATCGCAGCAGTC GTCGCACGGTCCATCGCAGCAGTCGGGGG GTCGCACGGTCCATCGCAGCAGTCAGGGGG GTCGCACGGTCCATCGCAGCAGTCAAGGGGG GTCGCACGGTCCATCGCAGCAGTCAAAGGGGG GTCGCACGGTCCATCGCAGCAGTCTGGGGG GTCGCACGGTCCATCGCAGCAGTCTTGGGGG GTCGCACGGTCCATCGCAGCAGTCTTTGGGGG GTCGCACGGTCCATCGCAGCAGTCTGGGGG GTCGCACGGTCCATCGCAGCAGTCTAGGGGG GTCGCACGGTCCATCGCAGCAGTCTATGGGGG GTCGCACGGTCCATCGCAGCAGTCAGGGGG GTCGCACGGTCCATCGCAGCAGTCATGGGGG GTCGCACGGTCCATCGCAGCAGTCATAGGGGG GTCGCACGGTCCATCGCAGCAGTCACGGGGG GTCGCACGGTCCATCGCAGCAGTCACAGGGGG

3.24 7.72 3.54 4.72 3.78 8.94 6.74 5.86 8.94 4.72 7.24 3.54 7.78 3.78 8.34 3.54

1.17 2.82 2.19 2.19 1.76 3.87 3.64 3.64 3.87 2.19 3.64 2.19 3.64 1.76 2.45 1.76

Note. Oligonucleotide sequences from the tag (top) to the final TSO (bottom) are shown. Minimum free energies were calculated for putative dimers and hairpins. Simply adding 5 dGTP at the 30 end of the tag (second row) would result in higher secondary free energies than observed when including a 3-base-long bridge sequence (ACA).

TSO modification and impact on UPM use The use of a nonblocked version of the TSO led to weak amplification of the specific target and/or amplification of ribosomal RNA (data not shown). To avoid cDNA synthesis primed by the TSO [4,6–8], we decided to block its 30 end. A common blocking strategy is to include a 30 phosphate terminus, but the 30 phosphate ester bond has been demonstrated to be unstable in both Tris– EDTA and water [22]. Even if a small portion of the TSO is unblocked, it might result in unspecific cDNA synthesis. To overcome this limitation, we opted for a different blocking strategy, namely the C3-spacer. The addition of this propyl group is not recognized by most enzyme active sites and has been shown not to degrade while in storage [22]. Therefore, the effective blocking of the TSO led to reduced PCR background and even allowed us to replace the UPM by a single primer, namely the U_SENSE (see Fig. 3). Moreover, we noticed that the single primer strategy can lead to a slight increase in both product amplification specificity and yield (data not shown).

Reverse transcriptase selection The use of an adequate reverse transcriptase enzyme is vital for 50 RACE using template-switching. The most important factor to take into consideration is that only enzymes with residual tailing activity can be used. All enzymes that we tested are genetically modified and differ from M-MuLV RT by their catalytic and/or structural properties. Because these modifications are proprietary, we recommend that users perform their own testing to ensure compatibility with their reverse transcriptase of choice. Nonetheless, we found that only RevertAid M-MuLV did not produce the expected results. Initially, we hypothesized that the lack of specific product observed in Fig. 4 could be the result of a deleterious effect of reaction temperature over time given that the optimal temperature of activity for RevertAid M-MuLV is 42 °C, not 50 °C as used in our multiple-step protocol for cDNA extension. Curiously, this is the only reverse transcriptase tested that still possesses RNase H activity. We do not know whether RNase activity is related to the results that we observed. We could speculate that this activity might give rise to an increased reduction in mRNA population and subsequent decreased probability of cDNA generation and tailing.

Compatibility with known RT additives was tested and demonstrated in Figs. 4 and 5. Targeting hoxU mRNA from Anabaena sp. PCC 7120, we showed that it is possible to use trehalose and/or betaine and still maintain template-switching. The decision to have distinct elongation and template-switching phases raised the problem of whether sufficient enzyme activity occurred during the full length of the experiment (>2.5 h). To evaluate and eventually overcome that impact, as a test we decided to add more reverse transcriptase at the beginning of the template-switching phase. The addition of reverse transcriptase proved to be useful (see Fig. 6) even when a nonideal buffer was used. In fact, the additional reverse transcriptase partially overturned the use of such buffer. We speculate that for less abundant transcripts, this can be a key strategy to increase cDNA yield. Fig. 7 supports our recommendation for a template-switch phase duration of 90 min. In our experience, increasing reaction time (up to 240 min) does not improve yield (data not shown). Incorporating known strategies The decision to include the dNTP during RNA denaturation is based on previously published results demonstrating increased yield [23]. Also previously demonstrated is the negative impact of endogenous priming during RT [11]. This results in synthesis of unspecific products and subsequent loss of yield. Therefore, during the described procedures, the reactions are always kept above 40 °C, avoiding tRNA or degraded RNA acting as primers. Because the tailing activity of reverse transcriptase plays a key role in this type of 50 RACE system, it was important to maximize it. For that, we decided to use manganese as a cofactor because it increases tailing activity (up to 5 cytosines included in the 30 end of the cDNA), as described previously [10]. Applying the system As a base for procedure design, we defined two overall goals: (i) a minimal number of steps should be considered and (ii) the procedure should be time-efficient. One strategy, based on Clontech’s SMART system, was considered [6] due to its reduced number of steps and was further modified. In Fig. 8, the single-step procedure A is close to the one recommended by Clontech. Procedure B includes two steps: separating cDNA extension and template-switching. This separation specifically prevents misincorporation of dNTPs due to the presence of manganese [24] (see Table 2), making procedure B the preferred one for gene sequence discovery applications. We tested both proposed systems and found that the PCR products obtained are a direct consequence of the template-switching mechanism. The example we included in the Results section (see Fig. 2) demonstrates that there is no amplification of putative contaminating genomic DNA, the only possible target for amplification due to the absence of M-MuLV during the RT phase. Moreover, if product amplification were independent of the template-switch effect, products would be observed when only the template-switch oligonucleotide is missing. Also avoided is endogenous priming [11]; the random priming by tRNA and/or degraded RNA was not sufficient to generate suitable cDNA for PCR amplification in the absence of gene-specific primers. One further test, using only UPM at double concentration, shows that this primer set is not the origin of the product that was amplified in the control experiment. ‘‘Hot start” associated with ‘‘touchdown” is the recommended approach for most template-switch-based 50 RACE PCR systems. In the system we designed, the oligonucleotides for PCR have a

232

In-house design of 50 RACE systems / F.L. Pinto, P. Lindblad / Anal. Biochem. 397 (2010) 227–232

Fig. 8. Proposed alternative procedures to carry out 50 RACE. A diagram summarizing the two alternative procedures to synthesize cDNA containing the TSO from an RNA sample, followed by cDNA amplification, is shown. cDNA extension and template-switching can be condensed into one step (A) or can take place in different steps (B).

melting temperature of approximately 68 °C and we used Phire, a hot-start, high-yield enzyme form Finnzymes. This combination allowed us to obtain PCR products in approximately 60 min as opposed to several hours using the previously recommended PCR procedures [6].

[6]

[7] [8]

Conclusions The in-house designed template-switch-based 50 RACE system showed good performance and reliability while reducing both the required time and the cost. The use of the described procedures is independent of the template mRNA, and we applied them for studying other cyanobacterial strains and even green algae (data not shown). Different commercially available kits from companies such as Ambion, Clontech, and Invitrogen can be used to perform 50 RACE. The use of such kits implies a cost of at least 110 € (euros) (approx. 160 US$) per RT reaction assuming that 20 PCR reactions are performed using the obtained cDNA. The alternative procedures that we presented here have a maximum cost of 6.5 € (approx. 10 US$) for the same number of RT and PCR reactions.

[9]

[10]

[11]

[12]

[13]

[14]

[15]

Acknowledgments This work was supported by the Swedish Energy Agency, the Knut and Alice Wallenberg Foundation, the Nordic Energy Research Program (project BioH2), the EU/NEST FP 6 project BioModularH2 (contract 043340), and the EU/Energy FP 7 project SOLAR-H2 (contract 212508). The authors thank Stig Ravn (DNA Technology, Denmark) for his input concerning oligo blocking alternatives, Fermentas (Germany) for providing us with RevertAid Premium before the product was publicly available, and Jesper Svedberg, Susanne Bloch, Cecilia Blikstad, and Sven Erasmie for their contributions during development and testing.

[16]

[17]

[18]

[19]

[20]

References [1] M. Frohman, M. Dush, G. Martin, Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer, Proc. Natl. Acad. Sci. USA 85 (1988) 8998–9002. [2] E. Loh, J. Elliott, S. Cwirla, L. Lanier, M. Davis, Polymerase chain reaction with single-sided specificity: analysis of T cell receptor delta chain, Science 243 (1989) 217–220. [3] O. Ohara, R. Dorit, W. Gilbert, One-sided polymerase chain reaction: the amplification of cDNA, Proc. Natl. Acad. Sci. USA 86 (1989) 5673–5677. [4] E. Scotto-Lavino, G. Du, M. Frohman, 50 End cDNA amplification using classic RACE, Nat. Protoc. 1 (2007) 2555–2562. [5] A. Chenchik, Y. Zhu, L. Diatchenko, R. Li, J. Hill, P. Siebert, Generation and use of high-quality cDNA from small amounts of RNA by SMART PCR, in: Gene

[21] [22]

[23] [24]

Cloning and Analysis by RT-PCR, BioTechniques Press, Natick, MA, 1998, pp. 305–319. M. Matz, D. Shagin, E. Bogdanova, O. Britanova, S. Lukyanov, L. Diatchenko, A. Chenchik, Amplification of cDNA ends based on template-switching effect and step-out PCR, Nucleic Acids Res. 27 (1999) 1558–1560. G. Schramm, I. Bruchhaus, T. Roeder, A simple and reliable 50 -RACE approach, Nucleic Acids Res. 28 (2000) e96. W. Ni, Z. Lei, X. Chen, D. Oliver, C. Xiang, Construction of a plant transformation-ready expression cDNA library for Thellungiella halophila using recombination cloning, J. Integr. Plant Biol. 49 (2007) 1313–1319. P. Siebert, A. Chenchik, D. Kellogg, K. Lukyanov, S. Lukyanov, An improved PCR method for walking in uncloned genomic DNA, Nucleic Acids Res. 23 (1995) 1087–1088. W. Schmidt, M. Mueller, CapSelect: a highly sensitive method for 50 CAPdependent enrichment of full-length cDNA in PCR-mediated analysis of mRNAs, Nucleic Acids Res. 27 (1999) e31. A. Agranovsky, Exogenous primer-independent cDNA synthesis with commercial reverse transcriptase preparations on plant virus RNA templates, Anal. Biochem. 203 (1992) 163–165. R. Stanier, R. Kunisawa, M. Mandel, G. Cohen-Bazire, Purification and properties of unicellular blue-green algae (order Chroococcales), Microbiol. Mol. Biol. Rev. 35 (1971) 171–205. J. Sjöholm, P. Oliveira, P. Lindblad, Transcription and regulation of the bidirectional hydrogenase in the cyanobacterium Nostoc sp. strain PCC 7120, Appl. Environ. Microbiol. 73 (2007) 5435–5446. F. Lopes Pinto, A. Thapper, W. Sontheim, P. Lindblad, Analysis of current and alternative phenol based RNA extraction methodologies for cyanobacteria, BMC Mol. Biol. 10 (2009) 79. F. Lopes Pinto, H. Svensson, P. Lindblad, WebTag: a new web tool providing tags/anchors for RT-PCR experiments with prokaryotes, BMC Biotechnol. 7 (2007) 73. F. Lopes Pinto, H. Svensson, P. Lindblad, Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR, BMC Biotechnol. 6 (2006) 31. F. Domain, L. Houot, F. Chauvat, C. Cassier-Chauvat, Function and regulation of the cyanobacterial genes lexA, recA, and ruvB: lexA is critical to the survival of cells facing inorganic carbon starvation, Mol. Microbiol. 53 (2004) 65–80. K. Gutekunst, S. Phunpruch, C. Schwarz, S. Schuchardt, R. Schulz-Friedrich, J. Appel, LexA regulates the bidirectional hydrogenase in the cyanobacterium Synechocystis sp. PCC 6803 as a transcription activator, Mol. Microbiol. 58 (2005) 810–823. P. Oliveira, P. Lindblad, LexA, a transcription regulator binding in the promoter region of the bidirectional hydrogenase in the cyanobacterium Synechocystis sp. PCC 6803, FEMS Microbiol. Lett. 251 (2005) 59–66. P. Carninci, Y. Nishiyama, A. Westover, M. Itoh, S. Nagaoka, N. Sasaki, Y. Okazaki, M. Muramatsu, Y. Hayashizaki, Thermostabilization and thermoactivation of thermolabile enzymes by trehalose and its application for the synthesis of full length cDNA, Proc. Natl. Acad. Sci. USA 95 (1998) 520– 524. A. Spiess, R. Ivell, A highly efficient method for long-chain cDNA synthesis using trehalose and betaine, Anal. Biochem. 301 (2002) 168–174. K. Cradic, J. Wells, L. Allen, K. Kruckeberg, R. Singh, S. Grebe, Substitution of 30 phosphate cap with a carbon-based blocker reduces the possibility of fluorescence resonance energy transfer probe failure in real-time PCR assays, Clin. Chem. 50 (2004) 1080–1082. L. Huang, J. Lee, K. Sitaraman, A. Gallego, A. Rashtchian, A new highly sensitive two-step RT-PCR system, Focus 22 (2000) 6–7. J. Vartanian, M. Sala, M. Henry, S. Wain-Hobson, A. Meyerhans, Manganese cations increase the mutation rate of human immunodeficiency virus type 1 ex vivo, J. Gen. Virol. 80 (1999) 1983–1986.