A Human Binding Site for Transcription Factor USF ... - Science Direct

Download PDF
9 downloads 0 Views 3MB Size Report
Comment
I III. FIG. 1. Schematic representation of the HIV-1 long terminal repeat and of the ... 1988; Clark eta/., 1990; (g) Wu eta/., 1988b; (h) Franza eta/., 1987; (k) Baldwin and Sharp, 1988; (I) Yano ef ...... FRANZA, B. R. J., JOSEPHS, S. F., GILMAN.
VIROLOGY

186, 133-147

(1992)

A Human Binding Site for Transcription Factor USF/MLTF Regulatory Element of Human lmmunodeficiency

Mimics the Negative Virus Type 1

MAURO GIACCA, MARIA INES GUTIERREZ, STEFANO MENZO,’ FABRIZIO D’ADDA DI FAGAGNA, AND ARTURO FALASCHI’ International

Centre for Genetic Engineering

and Biotechnology,

Received June 3, 199 1; accepted

Padriciano,

September

99-34012

Trieste, Italy

10, 199 1

Transcriptional regulation of the proviral form of the human immunodeficiency virus type 1 (HIV-l) is exerted by its 5 long terminal repeat (LTR), which contains recognition sites for several cell factors. By gel retardation and DNase I footprinting experiments we have identified a binding site for a human nuclear protein between nucleotides -152 to -174 upstream of transcription start site, in a region previously recognized as a negative regulator of transcription (negative regulatory element, NRE). The recognized sequence contains the dyad symmetry element CACGTG, which represents a binding motif, very conserved through evolution, present in a putative human DNA replication origin (pB48), in the upstream element of the major late promoter (MLP-UE) of adenovirus, and, as transcriptional element, upstream of many eukaryotic genes. Common binding activities exist in human nuclear extracts for pB48, MLP-UE and the HIV-1 LTR; at least three protein species recognize the LTR sequence, of 44 (corresponding to transcription factor USF/MLTF), 70, and 110 kDa, respectively. Chloramphenicol acetyltransferase assays suggest that the USF/MLTF binding site located in the HIV-l LTR acts as a negative regulator of transcription, and that it contributes to the overall negative function exerted by the NRE. An oligonucleotide corresponding to another characterized human USF/MLTF binding site can functionally replace part of the activity of the NRE. This negative function is exerted both in presence or absence of tat transactivation, in different cell lines, and after PMA stimulation. o 1992 Academic PWSS, IK.

INTRODUCTION

functionally present in several other viral and cellular genes. This observation suggests that these elements are used broadly in transcriptional regulatory circuits and have been exploited by HIV-l for its own benefit. The basal promoter region exerts a positive regulation on transcription; it includes a NF-l/CTF binding site (Jones et al., 1988), in correspondence to the 5’-untranslated leader region, a binding site for the LBP-l/ UBP-1 factor (Jones et a/., 1988; Wu et a/., 1988b), a TATAA box (Starcich et al., 1985; Wu et al., 1988a; Garcia et al., 1989), and three Spl -binding sites (Jones et al., 1986; Harrich et a/., 1989). The enhancer region of HIV-l is composed of two direct repeats of the sequence GGGACTITCC located between -104 and -81 (Nabel and Baltimore, 1987). It is active in both stimulated and unstimulated T-cells (Siekevitz et a/., 1987; Nabel and Baltimore, 1987), and in most of the cell lines tested so far, including HeLa cells (Rosen et al., 1985; Garcia et al., 1987; Dinter et a/., 1987). This region is able to support basal transcription from the downstream domains and it mediates enhancement of viral expression after treatment with stimuli which activate T cells, such as phorbol 12-myristate 13-acetate (PMA), phytohemagglutinin (PHA) (Nabel and Baltimore, 1987; Kaufman et al., 1987; Tong-Starksen et a/., 1987), cytokines (Siekevitz et a/., 1987; Duh et al., 1989; Lowenthal et a/., 1989; Osborn et a/., 1989), or monoclonal antibodies di-

Several human and viral proteins regulate gene expression andviral replication of the human immunodeficiencyvirus type 1 (HIV-l) by their interaction with viral sequences. The genetic elements which control expression of the integrated provirus are located in the long terminal repeats (LTRs), which consist in a complex, interdigitated array of multiple binding sites for human and viral proteins, whose concerted action determines the rate of transcription. Genetic analysis of the HIV-1 LTR has revealed at least three &-acting regions which are important for gene expression of the virus; these regions have been recognized as targets of sequence-specific DNA binding proteins (see Fig. 1 and references therein). These domains include a region corresponding to, and immediately upstream of, transcription start site (here referred to as basal promoter region), an enhancer element and a region exerting a negative role on the promotion of transcription (Garcia eta/., 1987; Rosen et al., 1985; Muesing et al., 1987). Most of the factors that contribute to viral transcription are constitutive and ubiquitous in many cell lines and types, and their DNA target sequences are ’ Present Address: Institute of Microbiology, University of Ancona, Italy. ’ To whom reprint requests should be addressed. 133

0042.6822/92

$3.00

CopyrIght 0 1992 by Academic Press, Inc. All rights of reproducilon in any form reserved.

GIACCA ET AL

134 100 I

I - 400 I

200 I - 300 I

I

300 I - 200 I

NegativeRegulatoryElement

500 I

400 I - 100 I

I

600 I

1

EnhancerBasalPromoter III

FIG. 1. Schematic representation of the HIV-1 long terminal repeat and of the human proteins that interact with it. Transcription is indicated by an arrow at the U3-R boundary; the lower scale indicates nucleotides upstream of transcription start site. (a) Franza ef a/., 1988; (b) Orchard et a/., 1990; (c) Guy et al., 1990; (d) Shaw ef al., 1988; (e) Garcia et a/., 1987; Smith and Greene, 1989; this paper; (f) Nabel and Baltimore, 1987; Kawakami eta/., 1988; Lenardo eta/., 1988; Clark eta/., 1990; (g) Wu eta/., 1988b; (h) Franza eta/., 1987; (k) Baldwin and Sharp, 1988; (I) Yano ef a/., 1987; (j) Korner eta/., 1990; (I) Jones et a/., 1986; Harrich eta/., 1989; (m) Wu eta/., 1988a; Garcia eta/., 1989; (n)Jones et a/., 1988; (0) Wu et a/., 1988b; (p) Jones er al., 1988.

rected against T-cell membrane antigens (Tong-Starksen et al,, 1989). Several factors interacting with the HIV-l enhancer have been identified and purified (see Fig. 1 and references therein); the relationship between these factors has not been yet elucidated. Since it has been demonstrated that the deletion of the region upstream of nucleotide -167 results in an increase in gene expression promoted by the downstream domains in CAT assay experiments (Rosen et a/., 1985) and that the deletion of the same region markedly augments viral replication in both Jurkat (Tcell lymphoma) and U-937 (monocytic) cell lines (Lu et a/., 1989) this region has been called negative regulatory element (NRE). Several binding sites for human nuclear proteins have been mapped within the NRE. Sequences between nucleotides -349 and -343, -337 and -371, -291 and -299 are similar to HeLa cell AP-1 binding sites and have been shown to interact with the Foscomplex and Fos-related antigens (Franza eta/., 1988). Two binding sites were located at positions from -379 to -361 and from -350 to -327, respectively, with extracts from activated Jurkat cells; the latter site is recognized by a ubiquitous protein and acts as a weak repressor of promoter activity (Orchard et a/., 1990). The region between nucleotides -216 and -254 constitutes the binding site for NFAT-1, a nuclear factor which plays a role in the activation of the LTR by PHA and monoclonal antibodies directed against T-cell surface proteins (Shaw et al., 1988; Crabtree, 1989; Siekevitz et al., 1987). Furthermore, regions highly homologous to motifs in the IL-2, IL-2 receptor (Starcich er

a/., 1985; Siekevitz er al., 1987; Bohnlein et a/., 1988), and -y-interferon (Fujita et al., 1986) regulatory elements are located between nucleotides -247 and -302. Very recently it has been demonstrated that several proteins interact with this region, one of which is sensitive to downregulation by the nef gene product (Guy et a/., 1990). In this paper, we focus our attention to a region located at position from -159 to -173 upstream of transcription start site. It has been demonstrated by in vitro (Garcia et a/., 1987) and in vivo (Hauber and Cullen, 1988) DNase I protection studies that this domain represents a binding site for host cellular factors. It has been recently demonstrated that deletion of this site results in a marked increase of both viral replication and reporter gene transcription as compared to the wild type (Lu et a/., 1990). This site is homologous to the sequence corresponding to the upstream element of the major late promoter (MLP-UE) of adenovirus 2 (Ad2), located between nucleotides -63 and -52 upstream of the start site of the late transcripts. This element is the target for a nuclear factor, called by different authors MLTF (Carthew et al., 1985), USF (Sawadogo and Roeder, 1985), or UEF (Moncollin et a/., 1986) present in several cell types and tissues with an abundance of about 1O,OOO-20,000 molecules/cell (Chodosh et a/., 1986; Sawadogo et a/., 1988). We have recently demonstrated that a binding site for USFIMLTF is present in a human DNA region replicated at the onset of S phase in synchronized HL60 cells and probably involved in the activation of an origin of DNA replication (plasmid pB48) (Tribioli et a/., 1987;

DOWNREGULATION

OF HIV-1 TRANSCRIPTION

Falaschi eta/., 1988; Giacca eta/., 1989). Furthermore, we have demonstrated by South-Western experiments that several proteins specifically recognize this sequence in human cell extracts, suggesting that a family of nuclear factors exists, which share a common binding motif (Giacca et al., 1989). In this paper we present evidences showing that also the HIV-l LTR contains a sequence recognized by the human USF/MLTF family of proteins and we show that the role of this binding site is to downregulate transcription promoted by the downstream domains. MATERIALS

AND METHODS

Materials Restriction and modification enzymes were purchased from New England Biolabs (Beverly, MA) or Promega Corp. (Madison, WI). [-r32P]ATP, [n32P]dNTPs (all at 110 TBq/mmol), and [14C]chloramphenicol (at 2 GBqlmmol) were obtained from Amersham Corp. (UK). Cell cultures HeLa and COS-1 cells were cultured in Dulbecco’s modification of Eagle’s minimal essential medium (GIBCO) in monolayer cultures; H9 cells were grown in suspension in RPMI 1640 (GIBCO). All the cultures were additioned of 50 Fg/ml gentamicin, 10% fetal calf serum, and 2 mM glutamine. Plasmid constructions pC15CAT contains aXhol-HindIll fragment of HIV-l cDNA clone cl 5 (Arya et al., 1985) encompassing a portion of the nef gene, the whole U3, and most of the R regions of the 3’ LTR, cloned in the HindIll site of the pSVOCAT vector, upstream of the chloramphenicolacetyltransferase (CAT) gene. It was a gift of Dr. Robert Gallo, NIH, Bethesda, Maryland. For competition experiments, a band corresponding to the LTR was excised by HindIll digestion and purified from agarose gel. pEM0 was constructed by deletion of the fragment Aval (-159 upstream of transcription start site)-Aval (-424) of plasmid pC15CAT, Klenow filling, and ligation. The deleted fragment includes completely the negative regulatory element, as defined by several authors (Rosen et a/., 1985; Garcia et al., 1987; Lu et al., 1989; Tong-Starksen et al., 1989). pL15 is a pUC18-based plasmid containing a 106-bp Alul-Alul fragment from plasmid pB48, representing an early replicated fragment of human DNA (Tribioli et a/., 1987) from nucleotides 703 to 808, cloned by blunt-end ligation in the Smal site of the vector. It con-

135

tains a binding site (5’-TTCGTCACGTGATGCGA-3’) for the same factors interacting with the MLP-UE (Giacca et al., 1989). pEM1 and pEM2 were constructed by blunt-end ligation of the insert of pL15, recovered by AccllEcoRI digestion of the vector polylinker, to replace the AvalAval fragment of pC15CAT. All the extremities were filled with the Klenow fragment of Escherichia co/i polymerase I before ligation. The two plasmids differ for the relative orientation of the human insert, which was determined by restriction enzyme digestion and confirmed by sequencing with the dideoxynucleotide method @anger et al., 1977). pLTRCAT, pLTRACAT, pLTRABS 1CAT, and pLTRABS2CAT are pBlueScript KS (Stratagene, La Jolla CA) derivatives containing, respectively, the whole HIV-l LTR, the LTR deleted upstream of position -159, the (-159) deleted LTR with an upstream cloned oligonucleotide corresponding to pB48 binding site in both orientations. All these constructs were placed upstream of the CAT gene and its polyadenylation sites of plasmid pULB3574, a gift of Dr. Pierre Spegelaere (ULB, Bruxelles), obtained by cloning between the BarnHI-HindIll sites of the vector a 1600-bp PCR amplification product of the CATSV40 region of plasmid pSV2CAT. Detailed informations about the cloning strategy and the subcloning products are given in Fig. 2. pSV2-tat contains the first exon of the HIV-1 tat protein under the control of the SV40 early promoter. It was obtained by cloning of the HindIll-Kpnl fragment of HIV-1 (nucleotides 6026 to 6350 of clone HXB2) in the vector pSV2-gpt, to replace the first part of the gpt gene. It was a gift of Dr. A. Meyerhaus (Institut Pasteur, Paris). Oligonucleotides All the oligonucleotides were synthesized with an Applied Biosystems 380B DNA Synthesizer apparatus with reagents from the same company. For gel retardation experiments, 24 mer oligonucleotides were synthesized for both strands, with two 5’ protruding nucleotides, for pB48 binding site (5’-CCGGTCGCATCACGTGACGAAGAG-3’, oligo pB48BS), its mutated derivative (5’-CCGGTCGCATCATATGACGAAGAG-3’, oligo Mut Ill), the Ad2 major late promoter upstream element (5’ - GGTGTAGGCCACGTGACCGGGTGT - 3’, oligo AdMLP) and the HIV-1 LTR from nucleotides - 174 to - 151 (5’-GCAll-TCATCACGTGGCCCGAGAG-3’, oligo HIV), and annealed. Transient

transfection

assays

HeLa cells were transfected with recombinant plasmids by the calcium-phosphate precipitation tech-

GIACCA

136

ET AL.

BarnHI

Himll// !-fncN

\

HindIll Kpnl fragment

I

Hindlll Kpnl , K~nl M-rdlll

0

pULB3574

CAT gene and polyA-sites

Baml-ll

recovery

DOWNREGULATION

nique (Graham and van der Eb, 1973). Cells (5 x lo5 per dish) were plated the day before in DMEM. Recombinant plasmids (5-l 0 pg) with or without 5 pg of plasmid pSV2tat were used for each transfection. Fortyeight hours after transfection, cells were harvested and extracts were prepared. PMA treatment of HeLa cells was performed by adding 100 ng of PMA per ml to the cell culture 24 hr post-transfection; the cells were harvested 20 hr later. To normalize between groups, cotransfection was carried out with a second independent indicator plasmid, pCH1 10, which expresses /3-galactosidase activity under the control of the SV40 early promoter (purchased from Pharmacia/LKB, Uppsala, Sweden). For each sample, cell extracts were obtained by repeated freeze-thawing cycles and, subsequently, the CAT activity (according to the method of Gorman [Gorman et a/., 19821) the P-gal activity (as reported in Sambrook et a/., 1989) and the total protein concentrations were measured. Since protein concentrations were found to correlate positively with P-gal activities in several repeated experiments, cotransfection with pCH 110 was subsequently omitted and protein concentration was used for standardization. The cells extracts were diluted appropriately to ensure linear conversion of substrate in each reaction; reactions were carried out at 37” for 30 min with 0.5 &i of [‘4C]chloramphenicol. Quantitation of acetylation was performed by densitometric scanning of autoradiograms. Gel retardation

assay and competition

analysis

DNA fragments for gel retardation assays were isolated on agarose gels and extracted using DEAE membranes (Schleicher & Schuell, NA45 membranes). Oligonucleotides were purified from denaturing act-yamide gels and annealed. Binding reactions with endlabeled probes and HeLa cell nuclear extract were carried out as previously described (Falaschi et al., 1988). 32P-end-labeled oligonucleotide (1 O4cpm) were incubated with 5 pg of HeLa cells nuclear extract prepared by the method of Dignam (Dignam et al., 1983)

OF HIV-l

TRANSCRIPTION

137

and 3 pg of poly[d(l-C)]:poly[d(l-C)] (Boehringer-Mannheim) in 20 mM HEPES, pH 7.3, 50 mM NaCI, 5 mM MgCI,, 2 rnnll DlT, 0.2 mNi EDTA, 4 mM spermidine, 5% glycerol (final volume, 20 ~1). After 20 min incubation at room temperature, the protein-DNA complexes were resolved on a low-ionic strength 5% polyacrylamide gel. Competition experiments were carried out by mixing a lo- to 40-fold molar excess of cold plasmid inserts or 20- to 180-fold molar excess of cold oligonucleotides to the probe before incubation with the nuclear extract. A higher molar excess of oligonucleotide was required, since the affinity of the nuclear factor was lower for oligonucleotides, in agreement with what recently observed for USF (Sawadogo et al., 1988). DNase I footprinting The probe for DNase I footprinting experiments was obtained by PCR amplification of the HIV-1 LTR region of plasmid pC15CAT between nucleotides -1 and -223, with two 20 mer oligonucleotides. Oligonucleotides sequences were, respectively, 5’-GCAAGCTTGATGACCCTGAGAGA-3’ for the upper strand (carrying a 5’ HindIll site for cloning purposes) and 5’-GGGGATCCAGTACAGGCAAAAAG-3’ for the lower strand (carrying a 5’ BarnHI site). One of the two oligos was end-labeled with [T~~P]ATP and T4 polynucleotide kinase according to standard procedures (Sambrook et a/., 1989) before the PCR reaction. Only data concerning the upper, coding strand are presented in this paper. Amplifications were carried out in 0.5-ml microcentrifuge tubes containing 10 mM Tris (pH 8.0) 50 mAI KCI, 1.5 mn/l MgCI,, 0.01% gelatin, 200 puM each dNTP, 0.1 &I of both cold and labeled primers, 1 ng template plasmid DNA, 2.5 Units of Thermus aquaticus (Taq) DNA polymerase (Perkin Elmer Cetus). Reaction mixtures (100 ~1)were subjected to 30 cycles of amplification in a programmable thermal cycler (PREM III, LEP, UK) using the following sequence: 95” for 1 min, 65” for 1 min, and 72” for 2 min, plus a final extension step at 72” for 7 min. Aliquots containing lo5 cpm each of the amplification products were incubated with

FIG. 2. Cloning strategy for plasmids pLTRCAT, pLTRACAT, pLTRABS1 CAT, and pLTRABS2CAT. Several subcloning steps were utilized. Plasmids pUCBS1 and pUCB2 were obtained by cloning in the BarnHI site of pUCl8 a double-stranded oligonucleotide corresponding to the DNase l-protected 17 bp of pB48 binding sate (BS) (Giacca et a/., 1989) plus MooI (BarnHI-compatible) sticky ends (5’.GATCTCGCATCACGTGACGAA-3’ upper strand and 5’-GATCTTCGTCACGTGATGCGA-3’ lower strand), in the two orientations (indrcated by opposite arrows). The Hindlll-AvaN59) fragment of HIV-1 LTR was obtained from plasmid pCl SCAT and, after Klenow-filling of the Aval end, it was cloned between the Hincll-HindIll sites of pUC18, pUCBS1, and pUCBS2. in order to obtain pLTRA, pLTRABS1, and pLTRABS2, respectively. The final plasmids were constructed using plasmid pULB3574 as a vector. It is a pBlueScript KS-derivative in which the CAT gene and its polyadenylation sites were obtained by PCR amplification of the corresponding regions of plasmid pSV2CAT with primers containing compatible tails (Dr. Pierre Spegelaere, ULB Bruxelles) and cloned between the HindIll-BamHI sites of the vector. The fragments containing the deleted LTR and pB48BS were obtained by cutting with Kpnl and HindIll the pUCl8 polylinker and cloned between the corresponding sites of pULB3574. The nondeleted LTR was directly cloned from pC15CAT using the unique Kpnl site in the nef sequence and the HindIll site In the R region. The nucleotide sequences of final constructs were confirmed by sequencing with the dideoxynucleotide method (Sanger et a/., 1977).

GIACCA

138

increasing amounts of HeLa cell nuclear extract (120, 240, 480 fig of proteins) for 30 min at room temperature. Freshly diluted DNase I was then added at a final concentration of 5, 10, and 10 ng/pl, respectively, and the digestion was allowed to proceed 60, 90, and 120 set at room temperature. The products of the reactions were purified and analyzed as described by Car-thew (Carthew et a/., 1985). A G + A chemical cleavage sequence ladder was obtained from the same fragment according to Maxam and Gilbert (1980) and used to align the DNase I digestion products. Detection of DNA-binding Western analysis

proteins

by South-

South-Western experiments were performed as described (Giacca et al., 1989). Briefly, 200 to 600 pg of HeLa cell nuclear extract were submitted to SDSPAGE in a polyacrylamide Laemmli gel. After electrophoresis, the gel was soaked for 1 hr in 200 ml of renaturation buffer (10 mM Tris-HCI, pH 7.2, 50 mM NaCI, 20 mM EDTA, 1 mM DlT, 4 M urea), and then the proteins were electrophoretically transferred to nitrocellulose in 25 mM Tris base and 190 mh/l glycine. After transfer, the nitrocellulose strips were incubated for 1 hr in 100 ml binding buffer (10 mM Tris-HCI, pH 7.2, 50 mM NaCI, 5 rnn/l MgCI,, 0.1 mM EDTA, 1 rnM DlT) containing 5% of nonfat dry milk. After two washes in 100 ml each of binding buffer, the filters were incubated for 1 hr in binding buffer containing 5 X 1O5 cpm/ml of the [32P]end-labeled, double-stranded oligonucleotide, 20 pg/ml of denatured and 20 pg/ml of nondenatured sonicated salmon sperm DNA. The filters were then submitted to four subsequent washes in 100 ml of binding buffer each, for a total amount of time not exceeding 30 min. The strips were then dried for 15 min and exposed overnight with an intensifying screen. All the binding and washing procedures were performed at room temperature. For competition experiments, a 20-, loo-, and 500fold molar excess, respectively, of cold, doublestranded competitor oligonucleotide was included in the binding reaction. RESULTS A common nuclear binding activity exists for the HIV-l LTR, the Ad2 MLP, and a human USF/MLTF binding site We have previously demonstrated that a HeLa cell nuclear factor is able to bind specifically to a palindromic sequence (5’-CATCACGTGGCC-3’) present in a region of human DNA (pB48) replicated within the first 2 min of S-phase and probably corresponding to a DNA

ET AL

replication origin (Tribioli et al., 1987; unpublished data). The pB48 binding site is located in a highly transcribed region, which gives rise to several different transcripts; it is included at one boundary of a -6OObp region highly enriched in the CpG dinucleotide, with the features of an HTF island (Bird, 1986). Furthermore, a DNA fragment encompassing this site is able to promote transcription when placed upstream of a reporter gene (Falaschi et al., 1988); the active fragment can be reduced down to 100 bp (unpublished data). A striking sequence similarity exists between pB48 binding site, the upstream element of the major late promoter of adenovirus, at position from -66 to -50 upstream of the start site of the late transcripts, and a sequence located at one boundary of the NRE of the LTR of HIV-1 (Starcich et al., 1985; Rosen et a/., 1985; Bram and Kornberg, 1987) at position from -172 to -156 upstream of transcription start site (see Fig. 3A) (Giacca et a/., 1989). In order to establish whether common binding activities exist for these sequences, oligonucleotides were synthesized for both strands and used in gel retardation and competition experiments. A double-stranded oligonucleotide corresponding to pB48 binding site (oligo pB48BS) is specifically recognized by a HeLa cell nuclear factor in a gel retardation experiment, generating a retarded complex (Fig. 3B, lane 2). This complex can be competed by the addition of increasing amounts of the same cold oligo (Fig. 3B, lanes 3-4) of an oligonucleotide corresponding to the MLP upstream element (oligo AdMLP, (Fig. 3B, lanes 5-6) and of a 720-bp HindIll-HindIll DNAfragment excised from plasmid pC15CAT, and corresponding to most of the HIV-l LTR and upstream nefcoding region (Fig. 3B, lanes 7-9). Increasing amounts of a cold oligonucleotide with the same sequence as pB48BS except for the core CpG dinucleotide mutated to TpA (oligo Mut Ill) do not compete for binding (Fig. 3B, lanes 1o-1 1). A labeled oligonucleotide corresponding to the region of homology of HIV-1 LTR (oligo HIV) is also able to form a retarded complex after incubation with HeLa cell nuclear extract (Fig. 3C, lane 2). As expected from the results so far described, the same cold oligonucleotide and the oligonucleotides pB48BS and AdMLP are able to compete for the formation of the retarded complex (Fig. 3C, lanes 3-5, 6-8, and 12-l 4, respectively), while the oligo Mut III is not (Fig. 3C, lanes 9-l 1). The exact boundaries of the sequence recognized by the nuclear factor within the HIV-l LTR were mapped by DNase I footprinting, using a 224-bp probe encompassing the region of homology, obtained by PCR amplification with an end-labeled primer. Results

DOWNREGULATION

(- 172) (-86) (46)

TlTCATCACGTGGCCCi TCGCATCACCTGACGAA GTAGGCCACGTGACCGG

f-156) HIV-1 LTR C-70) pB48 k50) Ad2 MLP

OF HIV-1 TRANSCRIPTION

139

3-5, respectively), a 23-bp protected region appears between nucleotides -152 and -174 upstream of transcription start site. The protected region contains in its center the dyad symmetry element 5’-CACGTG-3’. Since the adenovirus MLP-UE is the target for an already characterized protein, named by different authors USF (Sawadogo and Roeder, 1985), MLTF, (Carthew et a/., 1985) or UEF (Moncollin er al., 1986) also the homologous region on the HIV-1 LTR will be referred to as USF/MLTF binding site. A human USF/MLTF binding site substitutes for the entire NRE for downregulation of transcription

B PB48BS

AdULP

HIV LTR

YUT III

The role of the USF/MLTF binding site on the HIV-1 LTR was investigated with respect to its ability to modulate transcription within the cell. Since this site is located at the 3’ boundary of a large region known to exert a negative regulation on transcription (NRE) (Rosen et al., 1985; Garcia et al., 1987) the question whether the USF/MLTF site could account for this negative regulation was addressed. For this reason, two series of plasmids were constructed; a schematic representation of these plasmids is reported in Fig. 5F. The first set derives from piasmid pC15CAT (Arya ef al., 1985) which contains most of the LTR and the nef

Nuclear sz 1

2

3

4

5 6

7

8

9 10 11 12 13 14

FIG. 3. Gel retardation experiments (A) Schematic representation of the HIV-l LTR with some of the relevant restriction sites utilized for this work; the sequences of the homologous regions are reported for the LTR, plasmld ~548, and the adenovirus MLP upstream element. Nucleotides are numbered according to the position upstream of transcription start site. The arrows indicate the dyad symmetry element CACGTG. (B) Gel retardation experiment with pB48BS oligonucleotide as probe and HeLa nuclear extract. Lane 1, probe alone; lanes 2-l 1, probes plus nuclear extract. Competition with a 60-and 180-fold molar excess of cold pB48BS oligo (lanes 3-4). AdMLP oligo (lanes 5-6). Mut Ill oligo (lanes 10-l 1) or a lo-, 20.. 40-fold molar excess, respectively, of a cold HindIll-HindIll DNA fragment from plasmid pC15CAT, containing most of the HIV-l LTR (lanes 7-9). Lower band, free probe; upper band, retarded complex. (C)Gel retardation experiment with HIV oligonucleotide as probe and HeLa nuclear extract. Lane 1, probe alone; lanes 2-l 4, probe plus nuclear extract. Competition with a 20.. 60-, 180.fold molar excess, respectively, of cold HIV oligo (lanes 3-5), pB48BS oligo (lanes 6-8) Mut III oligo (lanes 9-l l), and AdMLP oligo (lanes 12-l 4).

are presented only for the upper, coding strand. Upon addition of increasing amounts of HeLa nuclear extract (120, 240, and 480 pg of proteins, Fig. 4, lanes

FIG. 4. DNase I footprinting. An end-labeled 224.bp DNAfragment (nucleotides -1 to -223 of HIV-l LTR), obtained by PCR, was digested with DNase I either in absence (lane 2) or presence of increasing amounts of HeLa nuclear extract (lane 3, 120 rg; lane 4, 240 pg; lane 5, 480 rg of total proteins). The digestion products were purified, denatured, and run under denaturing conditions. Lane 1, G + A sequence ladder. The protected sequence from -152 and -174 is shown alongside.

140

GIACCA

ET AL

F

-462

+76

-CAT

1.59 == =hl=.

@%%?

pLTRCAT pLTRACAT pLTRACATBS1 pLTRACATsS2

FIG. 5. CAT activity of some deletion/reconstitution derivatives of HIV-1 LTR. (A, B) Transfection of HeLa cells with the indicated plasmids without (A) or with cotransfection (B) of a fat expression plasmid. Under the photographs, the relative promoter activity of each construct is reported, as compared to that of pCl!XAT, derived by densitometric scanning of autoradiograms. The lower parts of the Figures report the P-galactosidase activity driven by the cotransfected plasmid pCH 1 10 plotted against the total protein concentration for each cell extract. Each sample can be identified by the number reported in the graph. Since in these experiments, as well as in several others, the total protein concentration of extracts was found to correlate linearly with the P-gal activity, cotransfection was subsequently omitted and protein concentration was used to normalize between different samples within the same experiment. Lane 1 in both (A, B): acetylation control (E. co/i CAT enzyme). Lane 2 in (A) and lane 6 in (B): transfection of pSV2CAT, carrying the SV40 early promoter upstream of CAT gene. (C-E) Transfection of HeLa cells (C), COS-1 cells (D) and PMA-treated HeLa cells (E) and with the indicated plasmids. Results are averages of at least three independent transfections and are reported as relative to the activity of pLTRCAT. (F) Schematic representation of the constructs utilized in CAT assay experiments. pC15CAT contains the -452 to +76 fragment of the HIV-l LTR upstream of the CAT gene; pEM0, the -159 to +76 fragment; pEM1 and pEM2, as pEM0 with an upstream cloned 100.bp human DNA fragment containing pB48 binding site (BS) in either orientation. pLTRCAT and pLTRACAT, as pC 15CAT and pEM0, respectively, but in different vectors; pLTRACATBS1 and pLTRACATBS2, as pLTRACAT with an upstream cloned oligonucleotide corresponding to pB48 binding site (BS) in either orientation. See Material and Methods and legend to Fig. 2 for detailed explanations of the cloning strategy for these plasmids.

DOWNREGULATION

OF HIV-1 TRANSCRIPTION

open reading frame cloned upstream of the CAT gene in plasmid pSVOCAT. Three derivatives were constructed, containing an Aval-Aval deletion which removes the whole NRE upstream of position -159, with simple ligation (pEMO), or by cloning a 100-bp fragment of human origin containing the pB48 binding site in the two possible orientations (pEM1 and pEM2). The activities of the four plasmids were tested after transfection in HeLa cells without or with cotransfection of an expression plasmid for the HIV-1 tat protein (Figs. 5A and 5B, respectively). The experiments were performed with cotransfection of another independent plasmid (pCH1 lo), coding for the ,&galactosidase gene under the control of the SV40 early promoter, in order to take into account differences in transfection efficiencies. As expected, the coexpression of tat protein enhances the CAT activity driven by the LTR construct by an appreciable factor, close to 50 in this particular experiment, as shown by the comparison with the activity of pSV2CAT corrected for protein concentration. The results show that the deletion of the NRE results in an increase of CAT activity, evident in presence of tat transactivation (compare Fig. 5B, lanes 5 and 4) confirming the expected negative role that this region exerts on transcription. This negative effect can be, to a great extent, replaced by the lOO-bp human fragment containing the USF/MLTF binding site, when cloned in one orientation (pEM1, Fig. 5A, lane 4 and Fig. 5B, lane 3) but not in the opposite one (pEM2, Fig. 5A, lane 5 and Fig. 5B, lane 2). Since the USF/MLTF site is placed asymmetrically within the 100-bp fragment which functionally replaces the NRE, it is not possible from these data to argue whether it is active only in one orientation due to a real polarity of the binding site, despite of its sequence symmetry, or to a position effect of the site itself. For this reason, another set of plasmids was constructed, derived from another vector for cloning opportunities. These include a plasmid containing the Kpnl-HindIll fragment of pC15CAT placed upstream of the CAT gene (pLTRCAT), its A - 159 derivative (pLTRACAT), and its A - 159 derivative with an oligonucleotide corresponding to pB48 binding site cloned upstream in the two orientations (pLTRACATBS1 and pLTRACATBS2, see Materials and Methods for plasmid constructions). These constructs were always tested after cotransfection with a tat-expressing plasmid. The results presented in Figs. 5C-5E) are representative of three to five different experiments. Differences in transfection efficiencies between different samples within the same experiment were standardized by measuring the protein concentration of the cell extracts used for the CAT assays, since this measurements were previously found to correlate very closely with the P-galac-

141

tosidase Deletion

activity (see Figs. 5A and 5B, lower parts). of the NRE upstream of position -159 (pLTRACAT) results in a five to six times increase of CAT activity after transfection of HeLa (Fig. 5C) or COS-1 (Fig. 5D) cells. The oligonucleotide with the human USF/MLTF site is able, at least partially, to restore most of the negative function of the NRE when cloned upstream of the deletion in both cell lines (plasmids pLTRACATBS1 and pLTRACATBS2). The same result was obtained in HeLa cells after treatment with PMA (Fig. 5E), although the overall effect of the deletion of the NRE resulted lower in comparison to untreated cells.

More than one polypeptide binds to the USF/MLTF binding site of HIV-1 LTR The binding specificity of the HIV oligonucleotide was tested also in South-Western experiments with nuclear extracts from HeLa and H9 cells, where the proteins, resolved on an SDS-polyacrilamide gel and transferred to a nitrocellulose filter, are probed with an end-labeled oligonucleotide in the presence of a large excess of cold, unspecific DNA. As shown in Fig. 6A, at least three polypeptides are specifically recognized by the HIV oligo as probe in both extracts, a picture which resembles very closely the one obtained with the pB48BS oligonucleotide (Giacca et a/., 1989). The apparent size of the three reactive proteins is 44, 70, and 1 10 kDa, respectively (~44, ~70, and ~110). The p70 protein seems to be the most abundant (or, at least, the most reactive in this assay) of the three species, especially in HeLa cells extracts. Another band with intermediate size between p70 and pl 10 is visible in Fig. 6A, lane 2, with nuclear extracts from HeLa cells but not from H9 cells; this band, which is not constantly observed in our extracts, most likely represents a proteolysis product of ~110. Under the same experimental conditions, the oligonucleotide Mut III is not able to detect any protein within the same nuclear extracts (Fig. 6B). Furthermore, it is possible to compete for the specific binding of the HIV oligonucleotide by the addition of a 20-, loo-, and 500-fold molar excess, respectively, of the same cold oligonucleotide (Fig. 6C, tracks b to d) to the incubation mixture.

DISCUSSION The LTRs of HIV-l are a complex, unidimensional mosaic of binding sites for several human nuclear proteins. This complexity, indeed, does not differ from that of most of the other eukaryotic and viral transcription control elements so far characterized (for review, see Johnson and McKnight, 1989). More than 15 different

GIACCA

142

ET AL

- 42.7

-49

-49

- 31.0 -21.5 a

b'c

d

123

FIG. 6. Southwestern experiments. (A, B) 200 pg of HeLa cells (lane 1) or H9 cells (lane 2) nuclear extracts were resolved on a 7.5% Laemli gel, renatured and blotted to nitrocellulose; after blotting, the filters were probed with [32P]labeled, double-stranded HIV (A) or Mut Ill (6) oligonucleotides. The three polypeptides (pl 10. ~70, and ~44) reactive with the HIV probe are indicated. Lane 3 in (A, B): radioactive rainbow markers (Amersham, UK). (C) Competition experiment. Four 500.pg aliquots of HeLa cell nuclear extract were resolved on a 7.5% polyacrylamide gel, renatured. and blotted to nitrocellulose; after blotting, the filter was cut and each strip was probed with the HIV oligonucleotide, without competitor (lane a) or with a 20 (lane b), 100 (lane c), and 500 (lane d) fold molar excess, respectively, of the same cold oligonucleotide.

factors of cellular origin, which specifically interact with the LTR sequence, have been identified so far (see Fig. l), and most of them have been purified and characterized. Genetic and clinical data suggest that the overall rate of virus expression is regulated also by negative elements; in particular, the rate of transcription initiation is determined also by negative functions provided by domains present within the LTRs. An NRE has been originally defined upstream of nucleotide -167 with respect to transcription start site, since the deletion of nucleotides -423 to -167 results in an increase in gene expression promoted by the downstream domains in CAT assay experiments (Rosen et a/., 1985); however, the exact boundaries of this element have not been defined precisely so far (Siekevitz et al., 1987). Recently, in an in vitro transcription system, a gradual enhancement of basal transcriptional level was demonstrated with several deletions from the 5’ LTR, with a maximum effect obtained by deletion up to -1 17 (Okamoto et al., 1990). This probably suggests that the overall negative effect cannot be ascribed to the action of a single factor. Several binding sites for human nuclear proteins, with either positive or negative function, have been located within the NRE (Franza et a/., 1987; Orchard et a/., 1990; Shaw et a/., 1988; Crabtree, 1989; Siekevitz et al., 1987; Guy et al., 1990) suggesting a functional heterogeneity of this region and a potentially complex mechanism of regulation, involving a balance between positive and negative cellular factors. In particular, it has been recently demonstrated that

deletion of the sequence between -173 and -159 results in an increased rate of expression of a heterologous gene driven by the viral LTR and in more rapid viral replication compared to the parental strain (Lu et a/., 1990). In this region, we have identified a binding site for a HeLa cell nuclear factor between nucleotides -174 and -152 by DNase I footprinting experiments, also in accordance to previously published results (Garcia et al., 1987). The center of the 23-bp protected region contains the dyad symmetry element CACGTG (position -166) identical to the sequence present in the upstream element of the adenovirus MLP, located between nucleotides -63 and -52 upstream of the start site of the late transcripts. The MLP-UE is a target for the human transcription factor USF/MLTF (Sawadogo and Roeder, 1985; Carthew et al., 1985) a 4344 kDa ubiquitous protein (Sawadogo et al., 1988). We have described the presence of a binding site for this factor in an early-replicated human DNA sequence (pB48 binding site), possibly involved in the control of initiation of DNA replication (Tribioli et a/., 1987; Falaschi et al., 1988; Giacca et al., 1989). Gel retardation and competition experiments indicate that a common binding activity is present in human cells for oligonucleotides corresponding to the HIV-1 LTR sequence between - 174 and - 15 1, to pB48 binding site and to the MLP-UE, but not for an oligonucleotide with the same sequence of pB48 binding site except for a double point mutation of the core CpG dinucleotide. The functional role of the USF/MLTF binding site within the HIV-1 LTR was investigated with relation to the efficiency of promotion of transcription by deletion/

DOWNREGULATION

replacement mutants. A lOO-bp fragment of human origin, containing pB48 binding site at one extremity, is acting as a negative regulator of transcription when cloned upstream of deletion - 159 after transfection in HeLa and COS-1 cells. This effect is entirely due to the USF/MLTF binding site, since it can be obtained also by a 17-bp oligonucleotide corresponding exclusively to pB48 binding site. The downregulation of transcription is observed in presence or absence of tat transactivation and after HeLa cell stimulation with PMA, an activator of the protein kinase C pathway, which is able to augment viral expression through the NF-KB and NFAT-1 binding sites (Siekevitz et a/., 1987; Crabtree, 1989). The pB48 binding site oligonucleotide is effective when cloned in both orientations, which is expected since the core of the recognized DNA sequence is the dyad symmetry element CACGTG. Furthermore, this result is also in agreement with what observed for the adenoviral genome, where the late transcription units and the IVa2 gene are transcribed in opposite directions, and, nevertheless, they share overlapping control regions including two USF/MLTF binding sites with stimulatory activity in both directions (Moncollin et a/., 1990a). On the contrary, the human 100-bp fragment is active only in one orientation, namely, the one containing the binding site close to the downstream domains. The most likely explanation for this result is that the protein interacting with the USF/MLTF site acts through direct protein-protein interaction with other proteins bound downstream. This hypothesis is in agreement with an observation made by Garcia et a/. (1987) from DNase I footprinting data, showing that the deletion of the NRE (including the USF/MLTF site) results in decreased protection over the enhancer region. Sequences identical or very similar to the core CACGTG motif have been identified, besides the adenovirus MLP, pB48 and HIV-1 LTR, also in the upstream regions of several genes of mammals, birds, amphibians, and plants, and in most of these cases constitutive and ubiquitous nuclear binding activities have been recognized, that interact with these sequences. Table 1 reports the binding sites containing this motif for which a binding activity was identified. The presented data suggest a strict conservation of the dyad symmetry DNA target sequence through evolution, albeit in different genetic contexts, and a corresponding large heterogeneity of the cognate DNA binding proteins. We have previously shown that the human binding site of pB48 is indeed the target of at least three human proteins of apparent molecular weight of -44 kDa (probably corresponding to USFIMLTF), of -70 kDa, and of - 110 kDa (Giacca eta/., 1989). Here we show that proteins of similar size recognize also the

OF HIV-1 TRANSCRIPTION

143

HIV-1 LTR binding site in South-Western type experiments. Very similar results were independently obtained using a probe corresponding to the pE3 site in the immunoglobulin heavy-chain (IgH) enhancer (which bears a remarkable similarity to the USF/MLTF binding site), in Southwestern (Beckman et a/., 1990) or cross-linking (Peterson and Calame, 1989) experiments. The three proteins species have been recently purified in our laboratory; while the protein-DNA complex formed by p44 can be easily resolved in gel retardation experiments, the interaction of p70 and ~110 with their binding sites can be detected in South-Western or uv-cross-linking experiments, but, surprisingly, it is almost not detectable in gel retardation assays (Czordas-Toth et a/., in preparation). All these data argue in favor of the presence of a family of mammalian nuclear proteins with the same binding specificity. The cDNAs for three members of this family were recently cloned. They include the cDNAs for two factors which bind to the pE3 site of the immunoglobulin heavy chain enhancer and to the MLP-UE (TFE3, of 59 kDa (Beckmann et a/., 1990) and TFEB, greater than 55 kDa (Carr and Sharp, 1990)), and for USF (Gregor et a/., 1990). Very similarly, also the data obtained from the purification (Bram and Kornberg, 1987; Baker et al., 1989; Jiang and Philippsen, 1989) and cloning (Cai and Davis 1990) of the DNA binding proteins interacting with the CDEI sequence of yeast centromeres suggest the existence of multiple proteins. These proteins belong to the c-myc-related family of DNA-binding proteins, structurally defined by the presence of a helix-loop-helix domain and a basic region required for binding to the DNA target sequence (Murre et al., 1989). The members of this family have been shown to interact with the CAXXTG motif. However, as observed by several authors and reported in Gregor et al. (1990) a subset of these members, including USFIMLTF and TFE3, seems to be specific for the CACPuTG motif, present in the MLP upstream element and in the pE3 site, while the same proteins do not bind to the slightly different KEY site found within the immunoglobulin light chain enhancer. On the contrary, other HLH proteins like El 2 and E47, bind to the KEY site and to a closely related sequence in the muscle-specific creatin-kinase promoter but not to pE3 (Murre et al., 1989). Altogether, these data suggest the existence of a large family of nuclear proteins, probably structurally related, with slightly different DNA binding specificities, a situation which resembles that of the CCAlT binding and of the CREB/ATF families (Hai et al., 1988) of DNA-binding proteins. The conservation of the binding domains of these proteins and of their cognate DNA target sequences although in the context of dif-

GIACCA

144

ET AL.

TABLE 1 SEQUENCESCARRYINGTHE CONSERVEDCACPuTG DYAD SYMMETRYBINDING MOTIF Source

Sequence

Mammals pB48 Binding Site

CGTCACGTGATG

-84

Mouse Hox 1 .l gene upstream region Mouse IgH enhancer - site rE3

ACCCACGTGACC GCCCACGTGACC GGGCAAGTGAC GACCCCGTGACC CACCACGTGACT GCGCACGGGGCA ACTCCCGTGGTT GGTCACGTGCCG GGTCATGTGGCA

-267 -47 -68 -84 -50 -168 -157 -128

Mouse metallothionein

GGGCGCGTGACT

Birds Duck histone H5 gene promoter Amphibians X. laevis TFIIIA gene promoter X. laevis Hox 1 .l gene upstream region

Human growth hormone gene promoter Human heme oxygenase gene promoter Human Ul snRNA gene promoter Rat r-fibrinogen gene promoter Rat heme oxygenase gene promoter Rat pyruvate kinase gene promoter

Yeasts S. cerevisiae (CDEI)

centromere

I gene promoter

DNA element I

S. cerevisiae GAL2 gene promoter S. cerevisiae MET25, MET2, SAM2, MET3 genes upstream regions S. cerevisiae PtiO5 gene upstream region S. cerevisiae QH2; cytochrome c oxydoreductase subunits VI, VIII, and FeS genes upstream regions Viruses Adenovirus major late promoter upstream element

Adenovirus IVa2 gene promoter Adeno-associated virus P5 promoter Human cytomegalovirus 2.7-kb RNA promoter HIV-l long terminal repeats Plants Arabidopsis thaliana and tomato RBCS genes promoters Petroselinum crispum chalcone synthase gene promoter Antirrhinum majus chalcone synthase gene promoter Nicotiana plumbaginifolia cab-E gene promoter Arabidopsis thaliana adh gene promoter

Factors identified

Position

Three proteins of 44, 70, and 110 kDa USF M LTF HOTF (40 KDa) UEF; two proteins of 52 and 115 kDa

References

Tribioli et a/. (1987); Giacca et al (1989) Lemaigre et al. (1989) Sat0 et al. (1990) Gunderson et al. (1988) Chodosh et al. (1987) Sato et al. (1989) Vaulont et al. (1989)

-104

NF-qE3, C2-binding protein (42-45 kDa), TFE3 (59 KDa), TFEB (-60 kDa); a yeast homologue identified (YEBB, 33-41 kDa) MLTF

Giacca et al. (1989) Peterson and Calame (1988); Sen and Baltimore (1988); Beckmann and Kadesh (1989); Beckman ef a/. (1990); Carr and Sharp (1990) Carthew ef a/. (1987)

GTCCACGTCACC

f505

USF

During et al. (1990)

TATCACGTGCTCC GATCACGTGGCC

-272 -145

USF

Scotto et a/. (1989) Giacca et al. (1989)

CPl (58 kDa), CDEI-binding proteins (64 and 37 kDa), CBFl (39 kDa)

Bram and Kornberg (1987); Baker et a/. (1989); Jiang and Philippsen (1989); Cai and Davis (1990) Bram and Kornberg (1987) Thomas and Kornberg (1989)

APuTCACPuTGATA

GGTCACGTGATC CACPuTG TAGCACGlTlX TCACACGTGGGA PuTCACGTG

CPl (57-64 kDa) --200 --300 -368 -256

PH04

Vogeland ef al. (1989)

GFII

Dorsman et a/. (1988)

USF, MLTF, UEF (43-46 kDa); TFEB (-60 kDa); yeast homologues identified; yUEF (60 kDa). MRF

Chodosh at al. (1989); Chodosh et al. (1986); Sawadogo and Roeder (1988); Moncollin et a/. (1987); Moncollin er al. (1990b) Moncollin et a/. (1990) Chang et a/. (1989) Klucher and Spector (1990)

GGCCACGTGACC

-63

AGACACATGTCG GGTCACGTGAGT CGTCACGTGAAA

-116 -83 -114

UEF M LTF USF/MLTF

CATACGTGGCC

-169

Three factors of 44, 70, and 1lOkDa

This paper

GBF; a yeast homologue identified (yGBF)

Giuliano er al. (1988); Donald et al. (1990) Schulze-Lefer et a/. (1989)

C/A-CACGTGGCA

--250

TTCCACGTGCCA

-170

TGTCACGTGCCA

-136

CG-1

Staiger er al. (1989)

TCAGACGTGGCA

-245

GBF

Sc(!ignr$r and Cashmore

CCACGTGGGA

-210

McKendree

et al. (1990)

Note. Only sequences for which a nuclear binding activity was identified are listed and the cognate binding factors are indicated. Matches to the CACGTG motif are shown by bold typed letters; the positions upstream of transcription start sites (where available and appropriate)are indicated.

DOWNREGULATION

ferent functions represents an intriguing example of evolutionary tinkering. ACKNOWLEDGMENTS We thank Dr. R. Gallo (NIH, Bethesda) for the gift of plasmid pC15CAT, Dr. P. Spegelaere (ULB, Bruxelles) for plasmid pULB3574 and Dr. A. Meyerhaus (Institut Pasteur, Paris) for plasmid pSV2-tat. We are very grateful to Prof. Silvano Riva (IGBE, Pavia) for his comments and suggestions. This work was partially supported by a grant of the AIDS program of the lstituto Superiore di Sanita’ (Rome).

REFERENCES ARYA, S. K., Guo, C., JOSEPH% S. F., and WONG-STAAL, F. (1985). Trans-activator gene of human T-lymphotropic virus type Ill (HTLVIll). Science 229, 69-73. BAKER,R. E., FITZGERALD-HAYES,M., and O’BRIEN, T. C. (1989). Purification of the yeast centromere binding protein CPl and a mutational analysis of its binding site. J. Viol. Chem. 264, 10,84310,850. BALDWIN, A. S. I., and SHARP, P. A. (1988). Two transcriptions factors, NF-KB and H2TF1, interact with a single regulatory sequence in the class I major histocompatibility complex promoter. froc. Nat/. Acad. Sci. USA 85, 723-727. BECKMANN, H., and KADESCH,T. (1989). Identification of a yeast protein with properties similar to those of the immunoglobulin heavychain enhancer-binding protein NF-wE3. Mol. Cell. Biol. 9, 45354540. BECKMANN, H., Su, L.-K., and KADESCH,T. (1990). TFEB: A helix-loophelix protein that activates transcription through the immunoglobulin enhancer pE3 motif. Genes Dev. 4, 167-l 79. BIRD, A. P. (1986). CpG rich islands and the function of DNA methylation. Nature 321, 209-213. B~HNLEIN, F., LOWENTHAL, 1. W., SIEKEVITZ, M., BALLARD, D. W., FRANZA, B. R., and GREENE,W. C. (1988). The same inducible nuclear protein(s) regulates mitogen activation of both the interleukin-2 receptor (Y gene and type 1 HIV. Cell 53, 827-836. BRAM, R. I., and KORNBERG,R. D. (1987). Isolation of a Saccharomyces cerevisiae centromere DNA-binding protein, its human homolog, and its possible role as a transcription factor. Mol. Cell. Biol. 7, 403.~409. CAI, M., and DAVIS, R. W. (1990). Yeast centromere binding protein CBF-1, of the Helix-Loop-Helix protein family, is required for chromosome stability and methionine prototrophy. Cell 61, 437-446. CARR, C. S., and SHARP, P. A. (1990). A helix-loop-helix protein related to the immunoglobulin E box-binding proteins. Mol. Cell. Biol. 10,4384-4388. CARTHEW, R. W., CHODOSH, L. A.. and SHARP, P. A. (1985). An RNA polymerase II transcription factor binds to an upstream element in the adenovlrus major late promoter. Cell 43, 439-448. CARTHEW.R. W., CHODOSH, L. A., and SHARP, P. A. (1987). The major late transcription factor binds to and activates the mouse metallothionein I promoter. Genes Dev. 1, 973-980. CHANG, L-S., SHI, Y.. and SHENK, T. (1989). Adeno-associated virus P5 promoter containing an adenovirus El a-inducible element and a binding site for the major late transcription factor. J. Krol. 63, 3479-3488. CHODOSH, L. A., CARTHEW, R. W., and SHARP, P. A. (1986). A single polypeptide possesses the binding and transcription activities of the adenovirus major late transcription factor. Mol. Cell. Biol. 6, 4723-4733. CHODOSH, L. A., CARTHEW, R. W., MORGAN, I. G.. CRABTREE,G. R., and SHARP, P. A. (1987). The adenovlrus major late transcription

OF HIV-1 TRANSCRIPTION

145

factor activates the rat y-fibrinogen promoter. Science 236, 684688. CHODOSH, L. A., BURATOWSKI,S., and SHARP, P. A. (1989). A yeast protein possesses the DNA-binding properties of the adenovirus major late transcription factor. Mol. Cell. Biol. 9, 820-822. CLARK, L., MATTHEWS, J. R., and HAY, R. T. (1990). Interaction of enhancer-binding protein EBPl (NF-KB) with the human immunodeficiency virus type 1 enhancer. /. l&o/. 64, 1335-l 344. CRABTREE, G. R. (1989). Contingent genetic regulatory events in T lymphocyte activation. Science 243, 355-361, DIGNAM, J. D., LEBOVITZ, R. M., and ROEDER, R. G. (1983). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, 14751491. DINTER, H., CHIU. R., IMAGAWA,M.. KARIN, M., and JONES.K. A. (1987). In vitro activation of the HIV-1 enhancer in extracts from cells treated with a phorbol ester tumor promoter. EMBO /. 6, 40674071. DONALD, R. G. K.. SCHINDLER, U., BATSCHAUER.A., and CASHMORE. A. R. (1990). The plant G box promoter sequence activates transcription in Saccharomyces cerevisiae and is bound in vifro by a yeast activity similar to GBF, the plant G box binding factor. EM50 J. 9, 1727-l 735. DORSMAN, J. C., VAN HEESWIJK,W. C., and GRIVELL,L. A. (1988). Identification of two factors which bind to the upstream sequences of a number of nuclear genes coding for mitochondrial proteins and to genetic elements important for cell division in yeast. Nucleic Acids Res. 16,7287-7301. DUH. E. J.. MAURY, W. J., FOLKS,T. M., FAUCI, A. S., and RABSON.A. B. (1989). Tumor necrosis factor a activates human immunodeficiency virus type 1 through induction of nuclear factor binding to the NF-KB sites in the long terminal repeat. Proc. Nat/. Acad. Sci. USA 86, 5974-5978. DURING, F., GERHOLD, H., and SEIFART, K. H. (1990). Transcription factor USF from duck erythrocytes transactivates expression of the histone H5 gene in vitro by interacting with an intragenic sequence. Nucleic Acids Res. 18, 1225-l 231. FALASCHI, A., BIAMONTI, G., COBIANCHI, F., CSORDAS-TOTH, E., FAULKNER,G., GIACCA, M., PEDACCHIA, D., PERINI, G., RIVA, S.. and TRIBIOLI, C. (1988). Presence of transcription signals in two putative DNA replication origins of human cells. Biochem. Biophys. Acta 951, 430-442. FRANZA, B. R. J., JOSEPHS,S. F., GILMAN. M. Z., RYAN, W., and CLARKSON, B. (1987). Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay. Nature 330, 391-395. FRANZA, B. R. J., RAUSCHER,F. J. I., JOSEPH%S. F., and CURRAN, T. (1988). The fos complex and fos-related antigens recognize sequence elements that contain AP-1 binding sites. Science 239, 1150-l 153. FUJITA,T., SHIBUYA, H., OHASHI, T., YAMANISHI, K., and TANIGUCHI, T. (1986). Regulation of human interleukin-2 gene: Functional DNA sequences in the 5’ flanking region for the gene expression in activate T lymphocytes. Cell 49, 401-408. GARCIA, J. A., Wu. F. K.. MITSUYASU, R., and GAYNOR. R. B. (1987). Interactions of cellular proteins involved in the transcriptional regulation of the human immunodeficiency virus. EMBO J. 6, 37613770. GARCIA, J. A., HARRICH, D.. SOULTANAKIS,E., Wu. F., MITSUYASU, R., and GAYNOR, R. B. (1989). Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation. EMBO /. 8, 765-778. GIACCA, M., GUTIERREZ,M. I., DEMARCHI, F., DIVIACCO, S., BIAMONTI, G., RIVA, S., and FALASCHI, A. (1989). A protein target site in an

146

GIACCA

early replicated human DNA sequence: a highly conserved binding motif. Biochem. Biophys. Res. Commun. 165, 956-965. GIULIANO, G., PICHERSKY,E., MALIK, V. S., TIMKO, M. P., SCOLNIC, P. A., and CASHMORE, A. R. (1988). An evolutionarily conseved protein binding sequence upstream of a plant light-regulated gene. Proc. Natl. Acad. Sci. USA 85, 7089-7093. GORMAN, C. M., MOFFAT, L. F., and HOWARD, B. H. (1982). Recombinant genomes which expresses chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2, 1044-l 051. GRAHAM, F. L., and VAN DEREs, A. 1. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA Virology 52,456467. GREGOR,P. D., SAWADOGO,M., and ROEDER,R. G. (1990). The adenovirus major late transcription factor USF is a member of the helixloop-helix group of regulatory proteins and binds to DNA as a dimer. Genes Dev. 4, 1730-l 740. GUNDERSON,S. I., MURPHY, J. T., KNUTH, M. W.. and STEINBERG,T. H. (1988). Binding of transcription factors to the promoter of the human Ul RNA gene studied by footprinting. J. Biol. Chem. 263, 17,603-17,610. GUY, B., ACRES, R. B., KIENY, M. P., and LECOCO, J.-P. (1990). DNA binding factors that bind to the negative regulatory element of the human immunodeficiency virus type 1: Regulation by nef. 1. Acq. Immun. Defic. Syndrome 3, 797-809. HAI, T. Y.. LIU, F., ALLEGRETTO,E. A., KARIN, M.. and GREEN, M. R. (1988). A family of immunologically related transcription factors that includes multiple forms of ATF and AP-1. Genes Dev. 2, 1216-1226. HARRICH. D.. GARCIA, J., Wu, F., MITSUYASU, R., and GAYNOR, R. B. (1989). Role of Spl -binding domains in in vivo transcriptional regulation of the human immunodeficiency virus type 1 long terminal repeat. J. Viral. 63, 2585-2591. HAUBER, J., and CULLEN, B. R. (1988). Mutational analysis of the trans-activation-responsive region of the human immunodeficiency virus type I long terminal repeat. J. Viral. 62, 673-679. JIANG, W., and PHILIPPSEN,P. (1989). Purification of a protein binding to the CDEI subregion of Saccharomyces cerevisae centromere DNA. Mol. CeN. Biol. 9, 5585-5593. JOHNSON, P. F., and MCKNIGHT, S. L. (1989). Eukaryotic transcriptional regulatory proteins. Annu. Rev. Biochem. 56, 799-839. JONES, K. A., KADONAGA, J. T., LUCIW, P. A., and TJIAN, R. (1986). Activation of the AIDS retrovirus promoter by the cellular transcription factor, Spl. Science 232, 755-759. JONES, K. A.. Lucm, P. A., and DUCHANGE, N. (1988). Structural arrangements of transcription control domains within the 5’-untranslated leader regions of the HIV-l and HIV-2 promoters. Genes Dev. 2,1101-1114. KAUFMAN, J. D., VALANDRA, G., RODERIQUEZ,G., BUSHAR, G.. GIRI, C., and NORCROSS,M. A. (1987). Phorbol ester enhances human immunodeficiency virus-promoted gene expression and acts on a repeated 1O-base-pair functional enhancer element. Mol. Cell. Biol. 7, 3759. KAWAKAMI,K., SCHEIDEREIT,C., and ROEDER,R. G. (1988). Identification and purification of a human immunoglobulin-enhancer-binding protein (NF-KB) that activates transcription from a human immunodeficiency virus type 1 promoter in vitro. Proc. Nat/, Acad. Sci. USA 85,4700-4704. KLUCHER,K. M., and SPECTOR,D. H. (1990). The human cytomegalovirus 2.7.Kilobase RNA promoter contains a functional binding site for the adenovirus major late transcription factor. J. Viral. 64, 4189-4198. KORNER, M., BELLAN, A. H., BRINI, A. T., and FARRAR,W. L. (1990). Characterization of the human immunodeficiency virus type 1 en-

ET AL. hancer-binding proteins from the human T-cell line Jurkat. Biothem. J. 265, 547-554. LEMAIGRE, F. P., COURTOIS, S. J., LAFONTAINE, D. A., and ROUSSEAU, G. G. (1989). Evidence that the upstream stimulatory factor and the Spl transcription factor bind in vitro to the promoter of the human-growth-hormone gene. Eur. J. Biochem. 181, 555-561. LENARDO. M. J., KUANG, A., GIFFIRD, A., and BALTIMORE, D. (1988). NF-KB protein purification from bovine spleen: Nucleotide stimulation and binding site specificity. Proc. Nat/. Acad. Sci. USA 85, 8825-8829. LOWENTHAL,J. W., BALLARD, D. W., BOHNLEIN, E., and GREENE,W. C. (1989). Tumor necrosis factor a induces proteins that bind specifically to &like enhancer elements and regulate interleukin 2 receptor a-chain gene expression in primary human T-lymphocytes. Proc. Nat/. Acad. SC;. USA 86, 2331-2335. Lu, Y., STENZEL, M., SODROSKI,J. G., and HASELTINE, W. A. (1989). Effects of long terminal repeat mutations on human immunodeficiency virus type 1 replication. J. Viral. 63, 41 15-41 19. Lu, Y. C., TOUZJIAN, N.. STENZEL, M., DORFMAN, T., SODROSKI,J. G., and HASELTINE,W. A. (1990). Identification of cis-acting repressive sequences within the negative regulatory element of human immunodeficiency virus type-l. J. Viral. 64, 5226-5229. MAXAM, A. M., and GILBERT,W. (1980). Sequencing end-labeled DNA with base-specific chemical cleavages. /n “Methods in Enzymology” (L. Grossman and K. Moldave, Eds.), Vol. 65, pp. 499-560. Academic Press, New York. MCKENDREE, W. L., PAUL, A.-L., DELISLE, A. J., and FERL, R. J. (1990). In vivo and in vitro characterization of protein interactions with the dyad G-box of the Arabidopsis adh gene. P/ant Cell, 2, 207-221. MONCOLLIN, V., MIYAMOTO, N. G., SHENG, X. M., and EGLY, J. M. (1986). Purification of a factor specific for the upstream element of the adenovirus-2 major late promoter. EMBO J. 5, 2577-2584. MONCOLLIN, V., KEMPF, A., and EGLY, J.-M. (1990a). The mammalian upstream element factor recognizes two sites in the adenovirus type 2 IVa2-major late promoter intergenic region and stimulates both promoters. /. firol. 64, 3199-3206. MONCOLLIN, V., STALDER, R., VERDIER,J.-M., SENTENAC,A., and EGLY. J-M. (1990b). A yeast homolog of the human UEF stimulates transcription from the adenovirus 2 major late promoter in yeast and in mammalian cell-free systems. Nucl. Acids Res. 18, 4817-4823. MUESING, M. A., SMITH, D. H., and CAPON, D. J. (1987). Regulation of mRNA Accumulation by a Human lmmunodeficiency Virus TransActivator Protein. Ce// 48, 691-701, MURRE, C., SCHONLEBER-MCCAW, and BALTIMORE, D. (1989). A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell 56, 777783. NABEL, G., and BALTIMORE, D. (1987). An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature 326, 7 1 l-7 13. OKAMOTO, T., BENTER,T., JOSEPHS,S. F., REZASADAIE, M.. and WONGSTAAL, F. (1990). Transcriptional activation from the long-terminal repeat of human immunodeficiency virus in vitro. Virology 177, 606-614. ORCHARD, K., PERKINS,N., CHAPMAN, C., HARRIS,J., EMERY,V., GOODWIN, G., LATCHMAN, D., and COLLINS, M. (1990). A novel T-cell protein which recognizes a palindromic sequence in the negative regulatory element of the human immunodeficiency virus long terminal repeat. J. Viral. 64, 3234-3239. OSBORN, L., KUNKEL, S., and NABEL, G. J. (1989). Tumor necrosis factor (Y and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor KB. Proc. Narl. Acad. Sci. USA 66,2336-2340.

DOWNREGULATION PERITZ, L. N., FODOR, E. J. B., SILVERSIDES,D. W., CAT~NI, P. A., BAXTER. J. D., and EBERHARDT, N. L. (1988). The human growth hormone gene contains both positive and negative control elements. J. Biol. Chem. 263, 5005-5007. PETERSON,C. L., and CALAME, K. (1989). Proteins binding to site C2 (mE3) in the immunoglobulin heavy-chain enhancer exist in multiple oligomenc forms. Mol. Cell. Biol. 9, 776-786. ROSEN,C. A., SODROSKI,J. G., and HASELTINE,W. A. (1985). The location of cis-acting regulatory sequences in the human T cell lymphotropic virus type Ill (HTLV-lII/LAV) long terminal repeat. Ce//41, 813-823. SAMBROOK, J., FRITSCH, E. F., and MANIATIS, T. (1989). “Molecular Cloning: A Laboratory Manual,” 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. SANGER,F., MIKLEN, S., and COULSON, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proc. Nat/. Acad. Sci. USA 74, 5463-5467. SATO, M., FUKUSHI,Y., ISHIZAWA.S., OKINAGA, S., MOLLER, R. M., and SHIBAHARA,S. (1989). Transcriptional control of the rat heme oxygenase gene by a nuclear protein that interacts with adenovirus 2 major late promoter. I. Ho/. Chem. 264, 10,251-l 0.260. SATO, M., ISHIZAWA,S., YOSHIDA. T., and SHIBAHARA,S. (1990). Interaction of upstream factor with the human heme oxygenase gene promoter. Eur. J. Biochem. 188, 231-237. SAWADOGD,M., and ROEDER.R. G. (1985). Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region. Cell 43, 165-l 75. SAWADOGO,M., VAN DIKE, M. W., GREGOR.P. D., and ROEDER, R. G. (1988). Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region. J. Biol. Chem. 263, 11,985-l 1,993. SCHINDLER, U.. and CASHMORE, A. R. (1990). Photoregulated gene expression may involve ubiquitous DNA binding proteins. EMBOJ. 9, 3415-3427. SCHULZLEFERT, P.. DANGL, J. L.. BECKER-ANDRE,M.. HAHLBROCK,K.. and SCHULZ. W. (1989). Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene. EM/30 /. 8, 651-656. Scorro, K. W., KAULEN, H., and ROEDER, R. G. (1989). Positive and negative regulation of the gene for transcription factor IIIA in Xenopus laevis oocytes. Genes Dev. 3, 651-662. SEN, R., and BALTIMORE, D. (1986). Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell46, 705-716. SHAW, J. P., UTZ. P. J., DURAND, D. B.. TOOLE, S. S., EMMER, E. A., and CRABTREE, D. R. (1988). Identification of a putative regulator of early T cell activation genes. Science 241, 202-205.

OF HIV-l

TRANSCRIPTION

147

SIEKEVIZ M., JOSEPHS,S. F., DUKOVICH, M., PEFFER,N., WONG-STAAL, F., and GREENE,W. C. (1987). Activation of the HIV-l LTR byT cell mitogens and the trans-activator protein of HTLV-I. Science 238, 1575-1578. SMITH, M. R., and GREENE,W. C. (1989). The same 50 kDa cellular protein binds to the negative regulatory elements of the interleukin-2 receptor a-chain gene and the HIV-1 LTR. Proc. Nat/. Acad. Sci. USA 86,8526-8530. STAIGER, D., KAULEN, H., and SCHELL, J. (1989). A CACGTG motif of the Antiurrhinum majus chalcone synthase promoter is recognized by an evolutionarily conserved nuclear protein. Proc. Nat/. Acad. Sci. USA 86,6930-6934. STARCICH, B., RATNER, L., JOSEPHS,S. F., OKAMOTO, T., GALLO, R. C., and WANG-STAAL, F. (1985). Characterization of long terminal repeat sequences of HTLV-III. Science 227, 538-540. THOMAS, D., CHEREST, H., and SURDIN-KEFUAN,Y. (1989). Elements involved in S-adenosylmethionine-mediated regulation of Saccharomyces cerevisiae MET25 gene. Mol. Cell. Biol. 9, 3292-3298. TONG-STARKSEN,S. E.. LUCIW, P. A., and PETERLIN,B. M. (1987). Human immunodeficiency virus long terminal repeat responds to Tcell activation signals. Proc. Nat/. Acad. Sci. USA 84, 6845-6849. TONG-STARKSEN,S. E., LUCIW, P. A., and PETERLIN,B. M. (1989). Signaling through T lymphocyte surface proteins, TCRICD3 and CD28, activates the HIV-1 long terminal repeat. J. Immunol. 142, 702-707. TRIBIOLI, C., BIAMONTI, G., GIACCA, M.. COLONNA, M., RIVA, S., and FALASCHI, A. (1987). Characterization of human DNA sequences synthesized at the onset of S-phase. Nucleic Acids Res. 15, lo,21 l-10.232. VAULONT. S.. PUZENAT, N., LEVRAT. F., COGNET, M., KAHN, A., and RAYMONDJEAN,M. (1989). 1. Mol. Biol. 209, 205-219. VOGEL, K., H~Rz, W., and HINNEN, A. (1989). The two positively acting regulatory proteins PH02 and PH04 physically interact with P/-f05 upstream activation regions. MO/. Cell. Biol. 9, 2050-2057. Wu, F.. GARCIA, J., MITSUYASU, R., and GAYNOR, R. (1988a). Alterations in binding characteristics of the human immunodeficiency virus enhancer factor. J. Viral. 62, 218-225. Wu, F. K., GARCIA, J. A., HARRICH, D., and GAYNOR, R. B. (1988b). Purification of the human immunodeficiency virus type 1 enhancer and TAR binding proteins EBP-1 and UBP-1. EMBO J. 7, 21 172129. YANO. 0.. KANELLOPOULOS,J., KIERAN, M., LE BAIL, O., ISRAEL,A., and KOURILSKY,P. (1987). Purification of KBFl, a common factor binding to both H-2 and 02.microglobulin enhancers. EM60 J. 6, 3317-3324.