Clinical Chemistry 52:10 1864 –1870 (2006)
Molecular Diagnostics and Genetics
A Multiplex Assay for the Detection and Mapping of Complex Glycerol Kinase Deficiency Roger D. Klein,1* Erik C. Thorland,1 Patrick R. Gonzales,1 Patricia A. Beck,2 Daniel J. Dykas,2 James M. McGrath,2 and Allen E. Bale2 Background: Glycerol kinase deficiency (GKD) is an X-linked recessive disorder that presents in both isolated and complex forms. The contiguous deletion that leads to GKD also commonly affects NR0B1 (DAX1), the gene associated with adrenal hypoplasia congenita, and DMD, the Duchenne muscular dystrophy gene. Molecular testing to delineate this deletion is expensive and has only limited availability. Methods: We designed a multiplex PCR assay for the detection and mapping of a contiguous deletion potentially affecting the IL1RAPL1, NR0B1, GK, and DMD genes in a 29-month-old male patient with GKD. Results: Multiplex PCR detected a contiguous deletion that involved the IL1RAPL1, NR0B1, GK, and DMD genes. Although the patient had a creatine kinase concentration within the reference interval, further mapping with PCR revealed that exon 74 was the last intact exon at the 3ⴕ end of the DMD gene. Conclusions: Multiplex PCR is an effective and inexpensive way to detect and map the contiguous deletion in cases of complex GKD. The extension of a deletion to include DMD exon 75 in a patient with a creatine kinase concentration within the reference interval suggests that this region of the gene may not be essential for protein function. © 2006 American Association for Clinical Chemistry
1 Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, MN. 2 Department of Genetics, Yale University School of Medicine, New Haven, CT. *Address correspondence to this author at: 2720 Oshkosh Lane NW, Rochester, MN 55901. Fax 507-252-1018; e-mail
[email protected]. Received April 27, 2006; accepted July 6, 2006. Previously published online at DOI: 10.1373/clinchem.2006.072397
Glycerol kinase (GK)3 is a 553–amino acid protein (1 ) that catalyzes the phosphorylation of glycerol to glycerol 3-phosphate by ATP in a variety of tissues, most prominently liver and kidney. GK activity has also been identified in peripheral blood leukocytes, brain, cardiac and skeletal muscle, adipose tissue, adrenal and thyroid glands, intestinal mucosa, and lung. Glycerol 3-phosphate is a key intermediate in glucose and lipid metabolism. It serves as an important substrate in gluconeogenesis, particularly during prolonged starvation. Glycerol 3-phosphate is also a substrate for glycolysis and for the synthesis of triglycerides and glycerolipids. Because GK provides the major entryway of glycerol metabolism, loss of enzyme activity leads to hyperglycerolemia and hyperglyceroluria (2, 3 ). The 21-exon GK gene,4 which spans ⬃50 000 bp, is highly conserved throughout evolution (1, 4, 5 ). Glycerol kinase deficiency (GKD) is an X-linked recessive disorder that presents in both isolated and complex forms. Isolated GKD can be expressed as juvenile or adult (benign) subtypes (4 ). A range of phenotypes can occur, even within kindreds. These vary from asymptomatic hyperglycerolemia to life-threatening metabolic crises, including vomiting, ketoacidosis, and central nervous system decompensation, presumably attributable to hypoglycemia (2, 3, 6 – 8 ). In general, genotype is not predictive of phenotype (4, 6 – 8 ). Deficiency of GK enzyme function can also cause pseudohypertriglyceridemia, an artifact of methods of triglyceride measurements based on serum or plasma glycerol concentrations (2, 3 ). Complex GKD presents in infancy and is caused by a contiguous deletion in the Xp21 chromosomal region. The
3 Nonstandard abbreviations: GK, glycerol kinase; GKD, glycerol kinase deficiency; DMD, Duchenne muscular dystrophy; BMD, Becker muscular dystrophy; AHC, adrenal hypoplasia congenita; CGH, comparative genomic hybridization; BAC, bacterial artificial chromosome. 4 Human genes: NR0B1 (DAX1), nuclear receptor subfamily 0, group B, member 1; DMD, dystrophin (muscular dystrophy, Duchenne and Becker types); IL1RAPL1, interleukin 1 receptor accessory protein-like 1; GK, glycerol kinase; OTC, ornithine carbamoyl transferase.
1864
Clinical Chemistry 52, No. 10, 2006
genes surrounding the GK gene, from telomere to centromere, are Xpter-interleukin 1 receptor accessory protein-like 1 (IL1RAPL1); nuclear receptor subfamily 0, group B, member 1 (NR0B1); GK, dystropin (DMD); and ornithine carbamoyltransferase (OTC)-cent. Phenotypes in patients with complex GKD depend on the genes included within the deletions (2, 3, 9 ). Genes frequently involved in complex GKD include DMD, variations in which cause Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), and NR0B1 (DAX1), which is responsible for adrenal hypoplasia congenita (AHC) (2, 3 ). DAX1 is a 2-exon, 470 –amino acid protein that plays an important role in development of the adrenal gland and hypothalmic–pituitary– gonadal axis. A C-terminal region of DAX1 is homologous to the ligand-binding domain in the nuclear hormone receptor superfamily but contains an atypical DNA-binding domain at its N-terminal region that lacks a characteristic zinc-finger DNA-binding domain (10 ). The most commonly reported phenotypes include AHC, GKD, and DMD (2, 3 ). Patients with GKD and AHC usually present during the neonatal period with feeding problems, vomiting, hypoglycemia, failure to thrive, hyperpigmentation, and hyponatremic-hyperkalemic dehydration. These infants are usually developmentally delayed and have characteristic dysmorphic features. Hypogonadotropic hypogonadism manifests during adolescence, a consequence of luteinizing hormone and follicle-stimulating hormone deficiencies secondary to both hypothalamic and pituitary dysfunction (11 ). Cryptorchidism is associated with AHC (11–15 ) and therefore may also be observed in complex GK deficiency in patients in whom the deletion involves NR0B1. Patients with deletions extending into the DMD gene generally have signs and symptoms of classic DMD. Evaluation for adrenal insufficiency is important in patients with evidence of GKD because death may occur as a result of Addisonian crises in those who also have AHC (2, 3 ). Complex GKD deletions that extend into the OTC gene, leading to OTC deficiency, have also been reported (2, 3 ). In addition, deletions have been identified that extend into the IL1RAPL1 gene, possibly producing or contributing to developmental delay in affected patients (9, 16, 17 ). Clinical testing for complex GKD by use of cytogenetic techniques such as fluorescence in situ hybridization or comparative genomic hybridization (array CGH) is available on a limited basis (18, 19 ). We describe a multiplex PCR assay for the detection and mapping of complex GKD in a 29-month-old male patient with presumptive GKD.
patient history and hospital course A 29-month-old male patient with global developmental delay and hypoglycemia was admitted to Yale–New Haven Hospital. The patient did not walk until 23 months of age, and spoke only 5 to 10 words. When the patient was 1 month old, he experienced feeding problems, and
1865
failure to thrive was diagnosed. However, his feeding difficulties appeared to resolve with a change in formula. The patient’s history was also important because of surgery to repair bilateral undescended testes, performed ⬃4 months before the most recent admission. Results of prior karyotyping by conventional cytogenetic methods had been unremarkable. Family history was notable only for a learning disability in the patient’s mother, who failed to walk until age 18 months. Before the patient’s admission to Yale–New Haven Hospital, he had suffered a period of illness of ⬃6 weeks that began with gastroenteritis and decreased oral intake, accompanied by an episode of hypoglycemia and acidosis. The patient was taken to the emergency department at an outside hospital, where his glucose was found to be 1 mmol/L (18 mg/dL). The patient was admitted for 1 week for treatment of hypoglycemia and metabolic acidosis. Urine organic acids during this admission showed increased glycerol, leading to a presumptive diagnosis of GKD. Shortly after the patient’s discharge, he developed flu-like symptoms with fever. His oral intake was poor, and he experienced weight loss, a cough with congestion, and intermittent irritability; he then suffered 2 generalized seizures at home and was again brought to the emergency department of the referring hospital, where another seizure occurred. Magnetic resonance imaging of the brain demonstrated evidence of acute and subacute infarctions in the right frontal and parietal lobes and right hippocampus. The patient continued to have poor oral intake, with a 1.5-kg weight loss, and he experienced several hospitalizations, until he was transferred to Yale– New Haven Hospital. On admission to our hospital, the patient did not appear acutely ill. He was afebrile but tachypneic to 56 with a pulse of 144. Hyperpigmentation was not apparent. Physical examination findings were otherwise noncontributory. Laboratory values were remarkable for sodium of 124 mmol/L, chloride of 94 mmol/L, potassium of 4.7 mmol/L, and CO2 of 17.7 mmol/L. Blood urea nitrogen, creatinine, and glucose were within reference intervals at 2.9 mmol/L (8 mg/dL), 44.2 mol/L (0.5 mg/dL), and 5.1 mmol/L (91 mg/dL), respectively. The patient’s creatine kinase was 80 units/L (reference interval, 24 –195 units/L). His urine glycerol concentration was 384.37 mol/L (reference interval, 0 – 40 mol/L), and his triglycerides were reported to be extremely increased at 8.2 mmol/L [726 mg/dL; reference interval, 0.3–1.7 mmol/L; (30 –150 mg/dL)]. The remainder of the urine organic acid analysis demonstrated only mildly increased ethylmalonic acid. A follow-up urine acylglycine profile was within reference limits. Plasma amino acid and plasma acylcarnitine profiles were also unremarkable. Morning cortisol was 110.4 nmol/L (4 g/dL), which was below the lower reference limit (reference interval, 7–25 g/dL). A corticotropin stimulation test yielded preand postadministration cortisol concentrations of 85.5
1866
Klein et al.: Complex Glycerol Kinase Deficiency
nmol/L (3.1 g/dL) and 171.1 nmol/L (6.2 g/dL), consistent with adrenal insufficiency. The patient was treated with intravenous fluids, hydrocortisone, and fludrocortisone. Nocturnal hypoglycemia was not observed; nevertheless, the patient was treated prophylactically with 15 g of cornstarch in 1 oz of milk at bedtime to prevent the development of nocturnal hypoglycemia. Throughout the patient’s hospitalization at Yale, his creatine kinase remained within reference values. The patient’s lethargy and poor appetite resolved with steroid therapy, and he was discharged on hospital day 7.
Materials and Methods polymerase chain reaction The 50-L reaction contained 100 ng of DNA; 200 mol/L dNTPs; 20 pmol of primers GKPROMF and GKPROMR; 12 pmol of primers DMD79F and DMD79R; and 8 pmol of primers DAX1PRF, DAX1PRR, IL1RAPL1F, IL1RAPL1R, PTCHEX7F, and PTCHEX7R (Table 1); 5 L ⫻10 PCR buffer II (500 mmol/L KCl, 100 mmol/L Tris-HCl, pH 8.3; Roche); 0.25 mmol/L spermidine; 1.5 mmol/L MgCl2; 0.25 units of Taq DNA polymerase (Amplitaq®, Roche); and 34 L of H2O. PCR was performed with an initial denaturation for 2 min at 97 °C; followed by 35 cycles of denaturation at 96 °C for 30 seconds, annealing at 55 °C for 30 seconds, and extension for 40 seconds at 72 °C; and a final extension at 72 °C for 5 min. PCR products were assayed on a 3% GPG/LE™ and 1% Suprasieve (American Bioanalytical) agarose/ethidium bromide gel and photographed under ultraviolet light.
primers The orientation of the included genes is: Xpter-IL1RAPL1 (5⬘ 3 3⬘) NR0B1 (3⬘ 4 5⬘) GK (5⬘ 3 3⬘) DMD (3⬘ 4 5⬘)-cent. Primers were designed to flank the termination codon of the IL1RAPL1 coding sequence and junction, the start codon of the NR0B1 gene and junction, the GK promoter region, and the termination codon within DMD exon 79 and the accompanying 3⬘ junction with the untranslated region (Table 1, Fig. 1). Exon 7 of patched homolog (Drosophila) (PTCH) (20 ), which is located at chromosome
9q22.3, was used as a PCR amplification control gene. The primer sequences were as previously described (Table 1) (21 ).
array cgh We performed array CGH with Spectral Genomics Constitutional Chip™ 2.0, a commercially available 434 bacterial artificial chromosome (BAC) clone array targeted toward more than 40 specific chromosomally mediated syndromes. Patient genomic DNA was extracted from peripheral blood leukocytes by recognized methods (22, 23 ). Two Cy5/Cy3 signal intensity experiments were performed. For each experiment, 1 g of patient DNA and 1 g of control DNA obtained from a healthy female were differentially labeled with Cy3-dUTP and Cy5-dUTP by use of the Enzo BioArray CGH labeling system in accordance with the manufacturer’s instructions. The fluorochrome labels were reversed in each experiment. We purified the labeled DNA with the QIAquick PCR Purification Kit; otherwise, we followed the chip manufacturer’s instructions for the hybridization procedure and performed analyses with the manufacturer’s SpectralWare Web™ molecular karyotype analysis software.
Results Multiplex PCR results showed a deletion involving the IL1RAPL1 gene at the telomeric end of the deletion and extending into the DMD gene at its centromeric end (Fig. 2). Further mapping of the deletion with PCR revealed exon 74 to be the last intact exon at the 3⬘ end of the DMD gene (Fig. 3). These findings were confirmed by array CGH. Array CGH demonstrated a deletion involving, at its ends, BAC RP11-487M22, which includes 19 919 nucleotides at the 5⬘ end of the IL1RAPL1 gene (1 369 270 total bp), and BAC RP11-46A23, which extends into intron 63 of the DMD gene (Figs. 1 and 4). These findings are consistent with the results obtained by PCR. Because these 19 919 nucleotides represent a small fraction of the total BAC (175 553 nucleotides), it appears that the deletion eliminated the entire IL1RAPL1 gene. No other known genes are within the additional chromosomal region covered by BAC RP11-487M22.
Table 1. Multiplex and mapping primers I. Multiplex primers (telomeric to centromeric) IL1RAPL1F CCAGTGTGATATGGTGACAG DAX1PRF AAGGAAGGAAAAGAAACAGC GKPROMF TTTGAAAGCCCTTAGAACAC DMD79F CAATAAAGCACGCAGTTATG PTCH EX7F GTGACCTGCCTACTAATTCCC II. Primers for mapping the extent of the deletion in DMD DMDEX76F GGGCTTCTAAAGTAGGAAGG DMDEX74F CCCCCAAAGCAAAATAAGG DMDEX70F CACCATGATCTCCCTTTTAG
ILRAPL1R DAX1PRR GKPROMR DMD79R PTCH EX7R
AAAACAGGAGGACACTGATG GCAGTGAGAAATTTTGATCC TTCCTCTATCGACCATTCAG GGAAGGGGTAGTTAGGAGTG GGCTAGCGAGGATAACGGTTTA
DMDEX76R DMDEX74R DMDEX70R
GACAACAAAATCTGAGAGTAGC TGCATACCAATGACAAAGC CAAACAAGAGTGTGTTCTGC
Clinical Chemistry 52, No. 10, 2006
1867
Fig. 1. Regions of human chromosome Xp21.1–21.3 containing, from telomere to centromere, genes IL1RAPL1, NROB1, GK, and DMD. Long dashed line with arrowhead represents position of deletion. Small arrowheads represent primer positions oriented in direction of gene (5⬘ to 3⬘). Short dashed lines represent positions of BACs RP11-487M22 (arrowhead) and RP11-46A23.
Discussion Complex GKD is a rare disorder but one that is important to recognize because of the potential for life-threatening Addisonian crises in patients whose deletions extend into the NR0B1 gene. GKD in both isolated and complex forms is indicated by an increased glycerol peak on urine organic acid testing. Another clue to GKD is the presence of pseudohypertriglyceridemia, an artifact of methods of triglyceride measurements that are based on serum or plasma glycerol concentrations (2, 3 ). Molecular assays for complex GKD are not readily available. The 2 laboratories listed on http://genetests. org as providing testing for complex GKD use cytogenetic techniques such as fluorescence in situ hybridization, which requires the application of multiple expensive probes, or array CGH (18 ), a promising new technique that is expensive and offered by very few providers. Moreover, there is limited experience with array CGH for use in the diagnosis of complex GKD. PCR-based assays are inexpensive and easy to perform. They potentially yield more information than do currently available cytogenetics-based assays. The PCR assay that we designed maps the gene deletion to the 4 loci most commonly associated with complex GKD (IL1RAPL1, NR0B1, GK, and DMD). This multiplex assay demonstrated extension of our patient’s deletion from IL1RAPL1 at its telomeric end to the 3⬘ end of exon 79 of DMD. Additional mapping revealed exon 74 to be the last intact
exon at the 3⬘ end of the DMD gene. IL1RAPL1 has been implicated in mental retardation (9, 16, 17 ), suggesting that disruption of this gene may play a role in the developmental delay observed in the patient we describe. DMD, the largest known human gene, contains 79 exons. Approximately 60% of cases of DMD are attributable to large deletions in the 5⬘ and central regions of DMD (24 –27 ). Point variations have been found in ⬃30% of patients (24 ). Few central region deletions extending 3⬘ beyond exon 60 have been found in DMD or BMD patients. However, causative point variations, internal deletions, and contiguous gene deletions involving the most 3⬘ dystropin exons or the 3⬘ untranslated region of the gene have been reported in DMD and BMD patients (17, 27–34 ). Given creatine kinase concentrations within the reference interval, a dystrophinopathy is unlikely in our patient (35 ). Because the contiguous deletion extends to include all or part of exon 75, this patient must be contrasted with other reported patients who have DMD or BMD caused by variations in this region of the gene (17, 27–34 ). The finding calls into question the hypothesis that the 3⬘ exons of the DMD gene and the 3⬘ untranslated region of the gene are essential for protein function (27, 30 ). Moreover, our patient’s phenotype may be consistent with the reported phenotypic variability seen in affected patients, with variations in the most distal DMD exons (17, 27–29, 32 ).
Fig. 2. Multiplex PCR for complex GKD. Order of bands (from largest to smallest): PTCH exon 7 (295 bp), NR0B1 (262 bp), GK (231 bp), IL1RAPL1 (202 bp), DMD (175 bp)
1868
Klein et al.: Complex Glycerol Kinase Deficiency
Fig. 3. PCR mapping of deletion into DMD. PCR amplification of coding region and intron– exon junctions of DMD exons 76 (A), 75 (B), and 74 (C). Absence of DMD exon 75 and 76 PCR products in patient specimens, with presence in healthy controls and presence of exon 74 PCR products in patient specimen and healthy controls can be seen. Note the larger, faint band in patient lane (B). This is the result of nonspecific priming attributable to the loss of target sequence in the specimen.
In conclusion, we designed a simple, easy-to-perform, multiplex PCR assay for the detection and mapping of the responsible deletion in a patient with complex GKD. This assay can also be used for pre- or postnatal testing. Although in its present form the assay can be used only for detection of affected males, recently developed real-time
approaches to assess gene dosage offer the potential to change the amplification format to allow carrier testing (36 ). The finding of IL1RAPL1 as part of a complex GKD deletion in a patient with global developmental delay is consistent with prior reports of the possible role of this gene in mental retardation. The finding of a deletion that
Clinical Chemistry 52, No. 10, 2006
6.
7.
8.
9.
10.
11.
Fig. 4. Spectral Genomics Constitutional Chip 2.0. Array CGH analysis confirms deletion extending from DMD gene into IL1RAPL1 [arr cgh Xp21.3p21.2(RP11-487M223 RP11-46A23)x0]. Right, patient DNA has been labeled with Cy3 (control DNA is labeled with Cy5), producing a rightward deflection in the deleted region reflecting a Cy5/Cy3 signal intensity ratio of ⬎1. Left, evaluation with Cy5-labeled patient DNA. The deletion is delineated by the leftward deflection, indicating a Cy5/Cy3 signal ratio ⬍1.
leaves DMD exon 74 as the last intact exon in a patient who appears not to have DMD or BMD suggests that the 3⬘-most exons and untranslated region of the DMD gene may not be essential for protein function. Consequently, variations in these exons apparently do not inevitably produce a dystrophinopathy phenotype.
R.D.K. was supported by National Institutes of Health Training Grant 5T32GM008753.
12.
13.
14.
15.
16.
17.
References 1. Sargent CA, Young C, Marsh S, Ferguson-Smith MA, Affara NA. The glycerol kinase gene family: structure of the Xp gene, and related intronless retroposons. Hum Mol Genet 1994;3:1317–24. 2. Sjarif DR, Ploos van Amstel JK, Duran M, Beemer FA, Poll-The BT. Isolated and contiguous glycerol kinase gene disorders: a review [Review]. J Inherit Metab Dis 2000;23:529 – 47. 3. McCabe ERB. Disorders of glycerol metabolism. In: Scriver CR, Beaudet AL, Sly WS, Valle D, Childs B, Volgelstein B, eds. The Metabolic and Molecular Bases of Inherited Disease, 8th Ed. New York: McGraw-Hill, 2001;2217–37. 4. Sargent CA, Kidd A, Moore S, Dean J, Besley GTN, Affara NA. Five cases of isolated glycerol kinase deficiency, including two families: failure to find genotype:phenotype correlation. J Med Genet 2000;37:434 – 41. 5. Guo W, Worley K, Adams V, Mason J, Sylvester-Jackson D,
18.
19.
20.
21.
1869
ZhangY-H, et al. Genomic scanning for expresssed sequences in Xp21 identifies the glycerol kinase gene. Nat Genet 1993;4:367– 72. Walker AP, Muscatelli F, Stafford AN, Chelly J, Dahl N, Blomquist HK, et al. Mutations and phenotype in isolated glycerol kinase deficiency. Am J Hum Genet 1996;58:1205–11. Sjarif DR, Sinke RJ, Duran M, Beemer FA, Kleijer WJ, Ploos van Amstel JK, Poll-The BT. Clinical heterogeneity and novel mutations in the glycerol kinase gene in three families with isolated glycerol kinase deficiency. J Med Genet 1998;35:650 – 6. Dipple KM, Zhang YH, Huang BL, McCabe LL, Dallongeville J, Inokuchi T, Kimura M, Marx HJ, Roederer GO, Shih V, Yamaguchi S, Yoshida I, McCabe ERB. Glycerol kinase deficiency: Evidence for complexity in a single gene disorder. Hum Genet 2001;109: 55– 62. Zhang Y-H, Huang B-L, Niakan KK, McCabe LL, McCabe ERB, Dipple KM. IL1RAPL1 Is Associated with Mental Retardation in Patients with Complex Glycerol Kinase Deficiency Who Have Deletions Extending Telomeric of DAX1. Hum Mut 2004;24:273. Zanaria E, Muscatelli F, Bardoni B, Strom TM, Guioli S, Guo W, et al. An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita. Nature 1994;372:635– 41. Habiby RL, Boepple P, Nachtigall L, Sluss PM, Crowley WF, Jameson JL. Adrenal hypoplasia congenita with hypogonadotrophic hypogonadism: evidence that DAX-1 mutations lead to combined hypothalmic and pituitary defects in gonadotropin production. J Clin Invest 1996;98:1055– 62. Zachmann M., Illig R., Prader A. Gonadotropin deficiency and cryptorchidism in three prepubertal brothers with congenital adrenal hypoplasia. J Pediatr 1980;97:255–7. Kruse K, Sippell WG, Schnakenburg KV. Hypogonadism in congenital adrenal hypoplasia: evidence for a hypothalamic origin. J Clin Endocrinol Metab 1984;58:12–7. Muscatelli F, Strom TM, Walker AP, Zanaria E, Recan D, Meindl A, et al. Mutations in the DAX-1 gene give rise to both X-linked adrenal hypoplasia congenita and hypogonadotropic hypogonadism. Nature 1994;372:672– 6. Peter M, Viemann M, Partsch C-J, Sippell W. Congenital adrenal hypoplasia: clinical spectrum, experience with hormonal diagnosis, and report on new point mutations of the DAX-1 gene. J Clin Endocrinol Metab 1998;83:2666 –74. Carrie A, Jun L, Bienvenu T, Vinet M-C, McDonell N, Couvert P, et al. A new member of the IL-1 receptor family highly expressed in hippocampus and involved in X-linked mental retardation. Nat Genet 1999;23:25–31. Jin H, Gardner RJ, Viswesvaraiah R, Muntoni F, Roberts RG. Two novel members of the interleukin-1 receptor gene family, one deleted in Xp22.1–Xp21.3 mental retardation. Eur J Hum Genet 2000;8:87–94. GeneTests: medical genetics information resource (database online). Copyright, University of Washington, Seattle; 1993–2006. Available at http://www.genetests.org (accessed May 2006). Worley KC, Lindsay EA, Bailey W, Wise J, McCabe ERB, Baldini A. Rapid molecular cytogenetic analysis of X-chromosomal microdeletions: fluorescence in situ hybridization (FISH) for complex glycerol kinase deficiency. Am J Med Genet 1995;57:615–9. Hahn H, Wicking C, Zaphiropoulous PG, Gailani MR, Shanley S, Chidambaram A, et al. Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 1996;85:841–51. Klein RD, Dykas DJ, Bale AE. Clinical testing for the nevoid basal cell carcinoma syndrome (NBCCS) in a DNA diagnostic laboratory. Genet Med 2005;7:611–9.
1870
Klein et al.: Complex Glycerol Kinase Deficiency
22. Ciulla TA, Sklar RM, Hauser SL. A simple method for DNA purification from peripheral blood. Anal Biochem 1988;174:485– 8. 23. Jeanpierre M. A rapid method for the purification of DNA from blood. Nucleic Acids Res 1987;15:9611. 24. Yan J, Feng J, Buzin CH, Scaringe W, Liu Q, Mendell JR, et al. Three-tiered noninvasive diagnosis in 96% of patients with Duchenne muscular dystrophy (DMD). Hum Mutat 23:203– 4. 25. Den Dunnen JT, Grootscholten PM, Bakker E, Blonden LAJ, Ginjaar HB, Wapenaar MC, et al. Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications. Am J Hum Genet 1989;45:835– 47. 26. Koenig M, Beggs AH, Moyer M, Scherpf S, Heindrich K, Bettecken T, et al. The molecular basis for Duchenne versus Becker muscular dystrophy: correlation of severity with type of deletion. Am J Hum Genet 1989;45:498 –506. 27. Prior TW, Bartolo C, Pearl DK, Papp AC, Snyder PJ, Sedra MS, et al. Spectrum of small mutations in the dystrophin coding region. Am J Hum Genet 1995;57:22–33. 28. Darras BT, Francke U. Myopathy in complex glycerol kinase deficiency patients is due to 3⬘ deletions of the dystrophin gene. Am J Hum Genet 1988;43:126 –30. 29. McCabe ER, Towbin J, Chamberlain J, Baumbach L, Witkowski J, van Ommen GJ, et al. Complementary DNA probes for the Duchenne muscular dystrophy locus demonstrate a previously undetectable deletion in a patient with dystrophic myopathy, glycerol
30.
31.
32.
33.
34.
35.
36.
kinase deficiency, and congenital adrenal hypoplasia. J Clin Invest 1989;83:95–9. Nigro V, Nigro G, Esposito MG, Comi LI, Molinari AM, Puca GA, et al. Novel small mutations along the DMD/BMD gene associated with different phenotypes. Hum Mol Genet 1994;3:1907– 8. Greener MJ, Sewry CA, Muntoni F, Roberts RG. The 3⬘-untranslated region of the dystrophin gene— conservation and consequence of loss. Eur J Hum Genet 2002;10:413–20. Suminaga R, Takeshima Y, Wada H, Yagi M, Matsuo M. C-terminal truncated dystrophin identified in skeletal muscle of an asymptomatic boy with a novel nonsense mutation of the dystrophin gene. Pediatr Res 2004;56:739 – 43. Hofstra RMW, Mulder IM, Vossen R, de Koning-gans PAM, Kraak M, Ginjaar IB, et al. DGGE-based whole gene mutation scanning of the dystrophin gene in Duchenne and Becker muscular dystrophy patients. Hum Mutat 2004;23:57– 66. Buzin CH, Feng J, Yan J, Scaringe W, Liu Q, den Dunnen J, et al.. Mutation rates in the dystrophin gene: a hotspot of mutation at a CpG dinucleotide. Hum Mutat 2005;25:177– 88. Zatz M, Rapaport D, Vainzof M, Passos-Bueno MR, Bortolini ER, Pavanello RDCM, et al. Serum creatine-kinase (CK) and pyruvatekinase (PK) activities in Duchenne (DMD) as compared with Becker (BMD) muscular dystrophy. J Neurol Sci 1991;102:190 – 6. Regis S, Grossi S, Lualdi S, Biancheri R, Filocamo M. Diagnosis of Pelizaeus-Merzbacher disease: detection of proteolipid protein gene copy number by real-time PCR. Neurogenetics 2005;6:73– 8.
