A new DNA binding protein highly conserved in ... - Semantic Scholar

Virology 363 (2007) 387 – 396 www.elsevier.com/locate/yviro

A new DNA binding protein highly conserved in diverse crenarchaeal viruses Eric T. Larson a,b , Brian J. Eilers a,b , Dirk Reiter a,c , Alice C. Ortmann a,d , Mark J. Young a,d,e , C. Martin Lawrence a,b,⁎ a Thermal Biology Institute, Montana State University, Bozeman, MT 59717, USA Department of Chemistry and Biochemistry, Montana State University, Bozeman, MT 59717, USA Physiologisch-Chemisches Institut der Universität Tübingen, Hoppe-Seyler-Strasse 4, D-72076 Tübingen, Germany d Department of Plant Sciences and Plant Pathology, Montana State University Bozeman, MT 59717, USA e Department of Microbiology, Montana State University Bozeman, MT 59717, USA b

c

Received 22 November 2006; returned to author for revision 26 December 2006; accepted 18 January 2007 Available online 2 March 2007

Abstract Sulfolobus turreted icosahedral virus (STIV) infects Sulfolobus species found in the hot springs of Yellowstone National Park. Its 37 open reading frames (ORFs) generally lack sequence similarity to other genes. One exception, however, is ORF B116. While its function is unknown, orthologs are found in three additional crenarchaeal viral families. Due to the central importance of this protein family to crenarchaeal viruses, we have undertaken structural and biochemical studies of B116. The structure reveals a previously unobserved fold consisting of a five-stranded betasheet flanked on one side by three alpha helices. Two subunits come together to form a homodimer with a 10-stranded mixed beta-sheet, where the topology of the central strands resembles an unclosed beta-barrel. Highly conserved loops rise above the surface of the saddle-shaped protein and suggest an interaction with the major groove of DNA. The predicted B116–DNA interaction is confirmed by electrophoretic mobility shift assays. © 2007 Elsevier Inc. All rights reserved. Keywords: Sulfolobus turreted icosahedral virus; STIV; Crenarchaea; Crenarchaeal virus; Hyperthermophilic virus; B116; DNA binding protein; Intracellular disulfide

Introduction Archaea, the third domain of life, encompass two major phyla, the Euryarchaeota, which includes methanogens and halophiles, and the Crenarchaeota, which includes many of the hyperthermophiles. Like the bacterial and eukaryotic branches in the tree of life, the Archaea are host to a multitude of viruses. However, compared to viruses infecting the domains Eukarya and Bacteria, studies of viruses infecting the Archaea are still in their infancy. Much remains to be discovered with respect to the viral life cycles, virus–host relationships, genetics and biochemistry of these viruses. The last few years, however, have seen a dramatic increase in the study of these viruses. This is particularly true of ⁎ Corresponding author. Department of Chemistry and Biochemistry, Gaines Hall 108, Montana State University, Bozeman, MT 59717, USA. Fax: +1 406 994 5407. E-mail address: [email protected] (C.M. Lawrence). 0042-6822/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2007.01.027

hyperthermophilic viruses infecting crenarchaeal hosts (Ortmann et al., 2006; Prangishvili and Garrett, 2005). We now know that these viruses exhibit spectacular diversity with respect to both morphology and genomic sequence. This diversity is reflected in the subsequent recognition of seven new viral families [Fuselloviridae (Martin et al., 1984; Palm et al., 1991; Schleper et al., 1992; Stedman et al., 2003; Wiedenheft et al., 2004), Lipothrixviridae (Arnold et al., 2000a, 2000b; Bettstetter et al., 2003; Haring et al., 2005b; Janekovic et al., 1983; Neumann et al., 1989), Rudiviridae (Prangishvili et al., 1999; Vestergaard et al., 2005), Globuloviridae (Ahn et al., 2006; Haring et al., 2004), Guttaviridae (Arnold et al., 2000a), Ampullaviridae (Haring et al., 2005a) and Bicaudaviridae (Haring et al., 2005c)], with two additional viruses awaiting classification (Rice et al., 2004; Xiang et al., 2005). Sulfolobus turreted icosahedral virus (STIV) was the first hyperthermophilic virus to be described with an icosahedral capsid. STIV infects Sulfolobus species resident in the acidic

388

E.T. Larson et al. / Virology 363 (2007) 387–396

hot springs (pH 2.9–3.9 and 72–92 °C) of Yellowstone National Park (Rice et al., 2004). It encapsidates a circular, dsDNA genome of 17,663 bp containing 37 open reading frames (ORFs). Similar to other families of crenarchaeal viruses, its genomic landscape is quite barren. Most of the 37 hypothetical proteins lack significant similarity to sequences in the NCBI database (National Center for Biotechnology Information), thus precluding functional assignments. The hypothetical protein encoded by open reading frame B116 is, however, somewhat unique in this regard. While it does not show sequence similarity to any genes of known function, it is common to the genomes of three additional hyperthermophilic Archaeal viral families, the Rudiviridae, the Lipothrixviridae and the Bicaudaviridae. B116 and its viral relatives thus constitute one of the most prominent clusters of orthologous proteins in the crenarachaeal viruses, one that spans four otherwise unrelated viral families (Prangishvili et al., 2006; Rice et al., 2004). Due to the central importance of this protein family to the biology of these viruses, we have undertaken biochemical and structural studies of STIV B116. Similar studies of crenarchaeal viral proteins from STIV (Khayat et al., 2005; Larson et al., 2006; Larson et al., submitted) and Sulfolobus spindle-shaped Virus 1 (Kraft et al., 2004a, 2004b) have made specific predictions regarding the functions and roles that these proteins play in the viral life cycle.

Table 2 Model Refinement a Parameter

Value

Rcryst b (%) Rfree b (%) Real space CC c (%) Mean B value (overall; Å2) Coordinate error (based on maximum likelihood, Å) RMSD from ideality: Bonds (Å) Angles (°) Ramachandran Plot d: Most favored (%) Additional allowed (%) PDB accession code

20.99 24.05 93 28.3 0.15 0.014 1.35 96.3 3.7 2J85

a

Refinement was carried out using Refmac5 (Murshudov, Vagin, and Dodson, 1997). b Rcryst = Σ||Fo| − Fc||/ΣFo| where Fo and Fc are the observed and calculated structure factor amplitudes used in refinement. Rfree is calculated as Rcryst, but using the “test” set of structure factor amplitudes that were withheld from refinement (5.1%). c Correlation coefficient (CC) is agreement between the model and 2mFo − DFc density map. d Calculated using PROCHECK (Laskowski et al., 1993).

single-wavelength anomalous diffraction (SAD) using selenomethionyl-incorporated protein. Details on data collection and model refinement are presented in Tables 1 and 2, respectively.

Results

Structure of B116

The B116 construct used in this study codes for the 116 amino acids of the native protein plus an additional C-terminal His-tag, for a total of 122 residues with a calculated mass of 14,153 Da. The purified protein elutes from a Superdex 75 size exclusion column as a single peak with an apparent molecular mass of 25–30 kDa, suggesting that it is present as a homodimer in solution. B116 crystallizes in space group P212121 with two copies of the protein, a potential homodimer, in the asymmetric unit. The structure was determined at a resolution of 2.4 Å by

The B116 polypeptide folds to form a five-stranded, predominantly parallel β-sheet lined on one side by three αhelices (Fig. 1). The polypeptide traces through β-strand 1 (β1), β-strand 2 (β2), α-helix 1 (α1), β-strand 3 (β3), α-helix 2 (α 2), β-strand 4 (β4), α-helix 3 (α 3) and β-strand 5 (β5). This results in a β-sheet topology of 3, 1, 4, 5, 2, with strand β5 running antiparallel to the remaining strands. Three of the connections between these secondary elements appear to be structurally important. Extended traverses are required to connect β1 to β2, α2 to β4 and β4 to α3. Interestingly, an intramolecular disulfide bond, contributed by Cys33 and Cys62, is also observed. This covalent link between the α1 and α2 helices is likely to enhance the thermostability of the B116 fold (Beeby et al., 2005; Larson et al., submitted). Two copies of the B116 polypeptide are found in the asymmetric unit, giving rise to the homodimer suggested by size exclusion chromatography. An important component of these subunit interactions are the β2 strands, which are found along the edge of each subunit (Fig. 1). These strands come together in an antiparallel fashion to unite the 5-stranded betasheet of each subunit into a larger 10-stranded β-sheet. Interestingly, the topology of the six central strands (β4, β5 and β2) of this 10-stranded mixed β-sheet resemble that of an unclosed antiparallel β-barrel (Fig. 1B). The remaining strands and helices flank the unclosed barrel, giving rise to a saddleshaped protein. A deep cleft, the “seat” of the saddle, spans the dimer interface, while the extended β4–α3 loop rises above to form the “horn” of the saddle. Formation of the dimer occludes 882 Å2 (greater than 12%) of the solvent-

Table 1 Data collection a Parameter

Result b for data set:

Wavelength (Å) Space group Cell constants (a,b,c; Å) α = β = γ = 90° Resolution range (Å) Unique reflections Average redundancy

0.97946 P212121 48.6, 83.3, 89.5 30 − 2.4 (2.49 − 2.4) 14,911 (1,466) 2.8 (2.8) c 5.1 (5.3) d 22 (5) 99.9 (100) 0.07 (0.26)

Se-Peak

I/σ Completeness (%) Rsym e

a Data were integrated, scaled, and reduced using the HKL-2000 software package (Otwinowski and Minor, 1997). b Numbers in parenthesis refer to the highest resolution shell. c Bijvoet pairs separate for scaling. d Bijvoet pairs merged for scaling. e Rsym = 100*ΣhΣi|Ii(h) − |/ΣhI(h) where Ii(h) is the ith measurement of reflection h and is the average value of the reflection intensity.


accessible surface area per monomer, with an interface rich in hydrophobic residues. The main chain atoms of the two monomers superimpose on each other relatively well with a RMSD of 0.49 Å. However, significant differences are seen at the apex of the β4–α3 loop (i.e., the horn of the saddle). In addition, smaller deviations are found in helix α3 and at the apex of the α2–β4 loop. Not surprisingly, these regions are associated with elevated Bfactors, as are the short β3–α2 loop and the N-terminal end of helix α2. This is particularly true for monomer A, where crystal contacts that might stabilize these regions are lacking. These loops appear to be well solvated in monomer B, where density is seen for a number of bound water molecules. In chain A, however, the increased B-factors of these solvent exposed regions leads to a decrease in the quality of the electron density and a corresponding loss of ordered waters. Structural comparisons performed using the DALI (Holm and Sander, 1993) and VAST (Gibrat et al., 1996) servers fail to find structures that superimpose meaningfully upon B116, the highest scoring results are barely above the level of insignificance. For the most part, the identified structures show some

389

similarity to the β-sheet in a single B116 subunit, but the similarities end there. Thus, it appears that the structure of B116 is unique. This lack of structural homology is unfortunate because it complicates the effort to formulate a functional hypothesis. However, structural analyses should also consider the surface properties of the molecule, including the location of significant clefts or pockets, an examination of the conserved residues and relationships between these features and the electrostatic surface potential. In conjunction with the structure, these properties can substantially aid development of a functional hypothesis. Conserved surface features in B116-like proteins Considering proteins encoded within the STIV genome, B116 is an exception in that it shares clear sequence similarity to proteins from other crenarchaeal viruses. A PSI-BLAST (Altschul et al., 1997) search identifies B116-like proteins in six other crenarchaeal viruses, spanning three additional viral families (Fig. 2). These include SIRV1, SIRV2 and ARV1 (Rudiviridae), SIFV and AFV1 (Lipothrixviridae) and ATV

Fig. 1. Structure of B116. (A) Stereo image of the B116 homodimer. One monomer is colored red and the second is in blue. The ribbon diagram depicts the secondary structural elements of B116, which are labeled in ascending order from N- to C-terminus. The polypeptide traces from the N-terminus through β1, β2, α1, β3, α2, β4, α3 and β5 of each subunit. The dimer displays a central 10-stranded β-sheet in which the central six strands adopt a topology resembling an unclosed antiparallel β-barrel. The missing staves result in formation of a deep cleft that spans the dimer interface, giving rise to a saddle-shaped homodimer. Note that Cys33 in helix α1 forms a disulfide bond (yellow) with Cys62 at the end of helix α2. (B) Relative to panel A, the homodimer has been rotated 90° about the depicted horizontal axis. The view is now looking into the deep cleft that spans the dimer interface, the “seat” of the saddle. Labels are as in panel A.

390


Fig. 2. Multiple sequence alignment of the B116 family. B116 from STIV was aligned with orthologs from other crenarchaeal viruses and the bacterial homologs using default settings in ClustalX (Thompson et al., 1997, 1994). A few manual adjustments were made around the gaps using the alignment of the viral proteins as a guide. Note the absence of gaps in the sequence of B116 itself. Strictly conserved residues are shaded in black with white lettering; strongly conserved residues are shaded in gray. The relative positions of the secondary structural elements in B116 are indicated above the alignment, where arrows represent β-strands and rounded rectangles represent α-helices. The numbering corresponds to that of B116. B116-like proteins show sequence conservation throughout their primary structure. Note the occurrence of the cysteine pair (bold type) among the viral orthologs from SIRV1, SIRV2 and AFV1, while the remaining sequences lack both cysteines. The Rudiviridae sequences include SIRV1 (NP_666617.1) (Peng et al., 2001), SIRV2 (CAC87312.1) (Peng et al., 2001) and ARV1 (CAI44168.1) (Vestergaard et al., 2005). Lipothrixviridae include AFV1 (YP_003762.1) (Bettstetter et al., 2003) and SIFV (NP_445691.1) (Arnold et al., 2000a, 2000b), while ATV is a member of the Bicaudaviridae (YP_319837.1) (Haring et al., 2005c). The creation of a new viral family for STIV is pending. Surprisingly, homologs are also found in three species of Bacteria; two from the family Clostridiaceae (A. metalliredigenes, ZP_00799325.1 and C. beijerincki, ZP_00907466.1, A. Copeland et al., unpublished), and one from the family Bacillaceae (yddF from B. subtilis, CAB12302.1) (Kunst et al., 1997). The presence of a B116-like protein in unrelated crenarchaeal viruses and select bacteria makes a strong case for horizontal gene transfer (Prangishvili et al., 2006).

(Bicaudaviridae). Interestingly, homologs are also found in three species of Bacteria; two from the family Clostridiaceae (Alkaliphilus metalliredigenes, accession number ZP_00799325.1 and Clostridium beijerincki, accession number ZP_00907466.1; A. Copeland et al., unpublished) and one from the family Bacillaceae (yddF from Bacillus subtilis, accession number CAB12302.1) (Kunst et al., 1997). To our knowledge, characterization of these viral or bacterial proteins has not been reported. A multiple sequence alignment of these viral and bacterial proteins is shown in Fig. 2. The alignment shows significant conservation along the entire linear sequence. However, only seven residues are strictly conserved. The regions of greatest conservation are in the β4–α3 loop and the β3–α2 loop. Strictly conserved residues are also found in the β1–β2 loop and the α2–β4 loop. Thus, all seven of the strictly conserved residues in the B116-like family are found in surface-exposed loops, and with the exception of the conserved glycine residue in the β3–α2 turn, they are unlikely to be of structural importance. Therefore, the strict conservation of Asn8, His51, Asn69, Arg70, Arg89 and Glu92 is most likely related to the function of B116. Importantly, when these strictly conserved

residues are mapped to the surface of B116, it becomes clear that they form a spatially contiguous surface along the top of the saddle. They run along the rim of the central cleft, extending down along the walls of the cleft and upwards to the horn of the saddle (Fig. 3). The calculated isoelectric point (pI) for native B116 is 4.7. With the exception of the B116-like proteins from ATV and ARV1, most of the other viral proteins show comparable pIs (Fig. 2). Similarly, two of three bacterial proteins show acidic pIs of approximately 5, while that from B. subtilis is quite basic. This suggests the presence of a significant amount of negative charge on most of these proteins. However, for B116, projection of the calculated electrostatic field onto the protein surface reveals a significant segregation of the positive and negative charge. For the surfaces surrounding the strictly conserved regions, a mixed pattern of positive and negative potential is observed, with the positive potential (blue) clustered around the rim and walls of the cleft (Fig. 3C). In contrast, a 180° rotation about the horizontal axis reveals a surface with strong negative potential (red, Fig. 3D). This surface is distant from the conserved residues pictured in Fig. 3A and B. The more neutral and basic


391

Fig. 3. Surface features in the family of B116-like proteins. (A) The surface of the B116 dimer is shown with strictly conserved residues colored according to residue type. Asn8 and Asn69 are in cyan; Gly50 is gray; His51, Arg70 and Arg89 are in blue; while Glu92 is in red. These strictly conserved residues form a patch of contiguous surface on each of the symmetry-related subunits. Arg89 and Glu92 are within the β4–α3 loop, which forms the horn of the saddle, His51 comes from the β3–α2 loop and Arg70 lies in the α2–β4 loop. The basic residues, colored in blue (His51, Arg70 and Arg89), lie along the lip and sides of the central cleft. (B) The strictly conserved surface features are shown from a different perspective. Relative to panel A, the dimer has been rotated by 90° about the depicted horizontal axis. (C) The electrostatic potential is mapped to the surface of B116 dimer, the perspective is identical to that in panel B. The color ramp on the surface is from −15 kT/e (red, acidic) to 15 kT/e (blue, basic). The surface exhibits a mix of positive and negative potential. The positive potential along the edge of the central cleft is due, in part, to the strictly conserved basic residues. Positive potential is also seen in the upper left and lower right corners of this panel (see Fig. 4). The electrostatic potentials at the surface were calculated with SPOCK (Christopher, 1998), using a probe radius of 1.4 Å, a temperature of 353 K, an ionic strength of 0.15 M, pH equal to 6.0, with protein and dielectric constants of 4 and 80, respectively. The image itself was prepared with PyMOL. (D) Relative to panel C, B116 has been rotated by 180° about the depicted horizontal axis to reveal a preponderance of negative charge on the nonconserved face. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

pIs of a few B116-like proteins suggest that the negative potential on this surface of B116 is not conserved across the B116-like family of proteins. DNA recognition While the B116 surface is quite convoluted, especially in the areas surrounding the conserved surface features, it is devoid of any obvious pockets that might play a role in recognition of small molecules. Thus, it seems likely that B116 will interact with a macromolecule. Given the inherent two-fold symmetry in the B116 homodimer, interacting macromolecules should also possess (pseudo)two-fold symmetry, at least when bound to the B116 homodimer. And while the overall pI of the protein is acidic, the strictly conserved basic residues (His51, Arg70 and Arg89) impart a significant positive potential along the lip and sides of the central cleft. This suggests that the lip and walls of the central cleft might interact with a macromolecule carrying

significant negative charge. The overall shape of the conserved surface and the intervening cleft is also a consideration. This surface is relatively convoluted. In contrast, protein–protein interactions are more likely to utilize relatively flat surfaces. The spacing between symmetry-related residues in the highly conserved β4–α3 loop is also relevant. In fact, using standard B-form DNA as a metric, one can see that the separation between the loops is roughly equivalent to the spacing of the major groove along the DNA axis (Fig. 4A). In addition, the side by side comparison also highlights the apparent complementarity between the conserved surface features of B116 and double-stranded DNA. Thus, an interaction between B116 and double-stranded DNA can be envisioned in which the β3–α3 loops insert into adjacent tracks of the DNA major groove, while the intervening ribose-phosphate backbone is accommodated by the central cleft of B116 with its conserved basic residues. Interestingly, the elevated B factors in regions of the protein that might interact with DNA suggest that they are

392


of a specific recognition sequence, most sequence specific DNA binding proteins also show non-specific interactions with DNA at elevated DNA or protein concentrations. Indeed, such non-specific interactions are clearly seen in EMSAs with B116 (Fig. 4B). Discussion

Fig. 4. B116–DNA interactions. (A) Spacing between the β4–α3 loops. The B116 homodimer is depicted in the same orientation as in Fig. 1A; however, the protein is colored to reflect the relative main chain B-factors using a rainbow colored gradient with blue indicating low B-factors and red indicating high Bfactors. The side chains of the strictly conserved residues are also depicted. In addition, a 21-bp fragment of B-form DNA is positioned above B116 as a metric. The spacing between the two symmetry-related β4–α3 loops is roughly equivalent to the major groove spacing of the DNA. Complementarity between the saddle-shaped surface of B116 and the DNA is apparent. This also extends to complementarity with respect to charge (Fig. 3C). The conserved positive charge flanking the central cleft of B116 may accommodate the ribosephosphate backbone flanking the minor groove in the center of the DNA fragment. Note that the upper right and lower left corners of Fig. 3C also show areas of positive potential that might serve to recognize the ribose-phosphate backbone present at the outer edges of the DNA. (B) Non-specific binding to double-stranded DNA. Increasing concentrations of purified B116 were added to a 45-bp double-stranded DNA fragment. Lane 1 contains a 100-bp DNA ladder. Lane 2 contains the 45-bp DNA fragment in the absence of B116. Lane 3 contains equimolar ratios of B116 and DNA. Lane 4 demonstrates non-specific binding to DNA when B116 is present in 5-fold excess. Visualization of the protein with Coomassie stain (not shown) shows comigration of the protein and the DNA in lane 4. In contrast, protein alone migrates quite slowly and is found near the top of the gel, just under the well. Similar band shifts are seen for oligos of poly-dA annealed to poly-dT. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

relatively mobile (Fig. 4A), a feature that is common in DNA binding proteins. The overall surface features of the B116 homodimer are thus quite suggestive of a protein–DNA interaction. In order to test this prediction, we looked for interactions between B116 and double-stranded DNA using an electrophoretic mobility shift assay (EMSA). While demonstration of a high affinity protein–DNA interaction requires isolation and/or knowledge

Efforts are currently underway to identify a sequence specific interaction for B116. Until then, it is difficult to say whether the B116–DNA interaction might serve to regulate gene expression, or is indicative of a role in the modification, synthesis or packaging of nucleic acid, either alone, or in a larger protein– nucleic acid complex. If B116 does show a higher affinity sitespecific interaction, the fold represents a unique motif for an operator-specific protein. Alternatively, while the overall folds differ, there are some similarities between B116 and the gene V protein from Ff filamentous phage (PDB IDs 1VQB, 2GVA, 1VHA, etc.), specifically with regard to the overall shape, the patches of basic surface charge and the relative location of the dimer interface (Folkers et al., 1994; Guan et al., 1994; Skinner et al., 1994). While the gene V protein preferentially recognizes single-stranded DNA, it will also bind non-specifically to double-stranded nucleic acids, though with lower affinity than to single-stranded DNA (Mou et al., 2003). These properties confer multiples activities on the gene V protein (Mou et al., 2003). It functions to control viral DNA replication by switching from the synthesis of a double-stranded DNA replicative form to the synthesis of progeny single-stranded DNA. It also serves to prepackage the progeny single-stranded DNA into a complex that is an intracellular precursor to the virus. However, in contrast to the Ff phage, STIV packages double-stranded DNA. Thus, B116 and the gene V protein are unlikely to serve identical functions. Nevertheless, these similarities may indicate a nonspecific DNA interaction for B116. As noted earlier, B116 appears orthologous to proteins encoded by six other crenarchaeal viruses, all with doublestranded DNA genomes, representing three additional viral families. Because the similarities between these families are quite limited with respect to particle morphology and genome sequence, the extent of the conservation of this gene product is remarkable, especially when considering the greater mutation rates typically observed in viruses. However, there are some similarities with respect to all of these viruses. They all inhabit acidic hyperthermophilic environments and infect hosts that belong to the family Sulfolobaceae. The maintenance of the observed sequence conservation in these diverse viruses suggests an evolutionary pressure exerted by a feature common to their respective hosts. To our knowledge, the intracellular pH of Sulfolobus has not been accurately determined. However, because Sulfolobus is an acidophilic organism, it is possible that the intracellular pH is also significantly more acidic than in most organisms. This might accentuate the positive potentials and diminish the negative potentials depicted in Fig. 3. The intramolecular disulfide bond in B116 is also worthy of comment. B116 is not among the nine proteins identified in the


purified viral particle (Maaty et al., 2006); however, it is detected by Western blot in STIV infected Sulfolobus solfataricus (data not shown). This suggests that B116 is a nonstructural protein expressed in the cytoplasm of the host upon infection with STIV. Though disulfide bonds are generally rare in the intracellular proteins of most prokaryotes (Kadokura et al., 2003), there is strong genomic evidence that suggests disulfide bonds are commonly employed to stabilize the intracellular proteins of S. solfataricus (Beeby et al., 2005) and its associated viruses (Larson et al., submitted). Thus, the disulfide bond is likely to enhance the thermostability of the B116 fold. Despite the absence of a structural homolog with known function, a preliminary understanding of the function of B116like proteins has emerged. These results will guide future biochemical and genetic studies of the B116-like family of proteins and help to decipher their role in a process of central importance to the crenarchaeal viruses. As this occurs, the structure of B116 will continue to contribute to a more detailed understanding of the structure–function relationships inherent in this newly discovered protein fold. Materials and methods Cloning The B116 open reading frame (ORF) was amplified by nested PCR directly from viral particles purified as previously described (Rice et al., 2004). The PCR primers added attB sites to facilitate ligase-free cloning using the Gateway system (Invitrogen), a Shine-Dalgarno sequence to facilitate efficient translation and a C-terminal His-tag to facilitate protein purification via nickel-affinity chromatography. The internal forward and reverse primers were 5′-TTCGAAGGAGATAGAACCATGGGTAAGGTATTCCTCA-3′ and 5′-GTGATGGTGAT GG TGATG CCACACCTCATAAAATGAG-3′, respectively, while the external forward and reverse primers were 5′-GGGGACAAGTTTGTACAAA AAAGCAGGCTTCGAAGGAGATA GAACC-3′ and 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGTGATGGTGATG GTGATG3′, respectively. The sequence of the resulting entry clone was verified using ABI BigDye terminator cycle sequencing. The His-tagged B116 construct was then inserted into destination vector pDEST14 (Invitrogen), yielding the expression vector pEXP14-B116, for protein expression in Escherichia coli. Expression, purification and characterization of B116 Typically, pEXP14-B116 was transformed into E. coli strain BL21-CodonPlus(DE3)-RIL (Stratagene), and a single colony was used to inoculate 5 ml of LB medium and grown overnight, with subsequent serial expansion to a 10-L fermentor (New Brunswick; BIOFLO 2000) batch culture, all at 37 °C. Medium for batch fermentation was as recommended by the manufacturer (R&D Laboratory-New Brunswick Scientific, 1996). All media contained 100 μg/ml ampicillin. Fermentor batch cultures were supplemented with filtered air at a flow rate of 10 L/min and stirred at 300 to 500 rpm. Cells were grown to an

393

optical density at 600 nm (OD600) of 0.8 to 1.5, and protein expression was then induced by addition of 1 mM isopropyl-βD-thiogalactopyranoside (IPTG). After an additional 4 to 6 h of growth, cells were harvested by centrifugation (IEC PR7000 M) at 6,000 × g for 20 min and pellets were stored at − 80 °C until needed. For purification, cell pellets were thawed and resuspended in lysis buffer (10 mM Tris–HCl, pH 8.0, 400 mM NaCl) at 10 ml/g of wet cell pellet mass. Phenylmethylsulfonyl fluoride (PMSF; 0.1 mM) was added to the cell suspension, and cells were lysed by passage through a microfluidizer (Microfluidics Corporation, Newton, MA) or a Power laboratory press (American Instrument Co., Inc., Silver Spring, MD), depending on the volume of the cell suspension. The cell lysate was incubated at 65 °C for 20 min to denature many of the contaminating E. coli proteins and clarified by centrifugation (Beckman; Avanti J-30I) at 22,000 × g for 20 min. The resulting cleared lysate was applied to a column containing a 3- to 5-ml bed volume of His-Select nickel affinity gel (Sigma-Aldrich), washed with at least 10 column volumes of wash buffer (lysis buffer plus 5 mM imidazole) and eluted with elution buffer (10 mM Tris–HCl, pH 8.0, 50 mM NaCl, 200 mM imidazole). Fractions containing B116 were pooled and loaded onto a Superdex 75 gel filtration column (Amersham Biosciences) for further purification and buffer exchange into a minimal buffer (10 mM Tris–HCl, pH 8.0, 50 mM NaCl) for crystallization. Peak fractions were pooled and concentrated using a 10-kDa molecular mass cutoff (Amicon ultracentrifugal filter devices; Millipore) to 6.5 mg/ml. Protein concentrations were determined by Bradford assay (Bradford, 1976) using “protein assay reagent” (Bio-Rad) and bovine serum albumin (BSA) as a standard. Protein yield was typically 8 to 12 mg/g of cell pellet. Molecular weight and purity were assessed by 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). For expression and purification of selenomethionine-incorporated B116, pEXP14-B116 was transformed into E. coli strain B834(DE3)pLysS (Novagen), a methionine auxotroph. Methionine auxotrophy was confirmed for a single colony, which was then used to inoculate 5 ml of medium, prepared essentially as described previously (Thoma et al., 1999), but supplemented with 1 ng/ml biotin, 50 ng/ml L-(+)-selenomethionine and 100 μg/ml ampicillin, followed by serial expansion to a 10-L batch culture (New Brunswick; BIOFLO 2000) in the same medium. After growth to an OD600 of 0.6 to 0.8, protein expression was induced and the protein purified as described above for native protein. Selenium incorporation was monitored by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (MS) with a Bruker Biflex III in the matrix-cyano-4-hydroxycinnamic acid and found to be essentially 100%. Crystallization of B116 and collection of x-ray diffraction data Purified B116 was crystallized by hanging drop vapor diffusion at 17 °C. Drops were assembled with 2 μl of B116 (6.5 mg/ml in 10 mM Tris–HCl, pH 8.0, 50 mM NaCl) mixed with 2 μl of well solution (0.1 M Tris–HCl [pH 8.0], 1.95 M

394


NH4H2PO4). Selenomethionine-incorporated B116 crystals were grown under identical conditions. Single rod-shaped or wedge-shaped crystals were isolated, and cryoprotectant was introduced with a quick soak (30 to 300 s) in well solution supplemented with 10% glycerol. Crystals were then flash frozen in liquid nitrogen. Single-wavelength anomalous diffraction (SAD) was used to solve the structure. Data were collected to 2.4 Å resolution at the Se K-edge on beamline X9-B at the National Synchrotron Light Source (NSLS) during the RapiData 2004 course at Brookhaven National Labs (Table 1). Data were integrated, scaled and reduced in space group P212121 (Table 1) using the HKL-2000 software package (Otwinowski and Minor, 1997).

CACTATAGACC CTGCTTCAACA GTGC-3′) were annealed together by heating at 65 °C for 10 min in 10 mM Tris, pH 8.0, 1 mM EDTA, 10 mM MgCl2 and allowed to cool to room temperature. Annealed DNA (5 μg) was mixed with B116 in molar ratios (DNA to protein) of 1:0, 1:1 and 1:5, and incubated at 25 °C for 30 min in 14 mM histidine, 30 mM MES pH 5.5. Final DNA concentration was 8.55 μM. Higher concentrations of B116 (20-fold excess) result in aggregation and or precipitation of the B116–DNA complex. Samples were electrophoresed in 1.6% agarose gel containing ethidium bromide for 50 min at 115 volts. Running buffer was 14 mM histidine and 30 mM MES at pH 5.5. DNA was visualized by UV illumination.

Structure determination and model refinement

Acknowledgments

SOLVE (Terwilliger and Berendzen, 1999) was used to determine the positions of the selenium substructure and to calculate initial phases. Eight out of 10 possible Se sites were identified, corresponding to two B116 molecules per asymmetric unit. The SOLVE output was then used in RESOLVE (Terwilliger, 2000, 2002) for density modification and initial model building. The resulting electron density map was of good quality, allowing the best parts of various models output by RESOLVE to be manually assembled into a composite model using O (Jones et al., 1991), followed by refinement with REFMAC5 (Bailey, 1994; Murshudov et al., 1997). The refinement included the use of TLS (translation/libration/ screw) parameters in which each chain of the model was broken into five TLS groups (1: A2–A40, 2: A41–A75, 3: A76–A86, 4: A87–A108, 5: A109–A119, 6: B2–B24, 7: B25–B46, 8: B47–B84, 9: B85–B89, 10: B90–B118) with the assistance of the TLS Motion Determination Home (http://skuld.bmsc. washington.edu/~tlsmd/) (Painter and Merritt, 2006a, 2006b). Iterative rounds of model building and refinement with O and REFMAC5 resulted in a final model with an Rcryst of 21.0% and an Rfree of 24.0% (Table 2). The final model has good stereochemistry, with all residues in allowed regions of the Ramachandran plot (Laskowski et al., 1993) (Table 2). The protein quaternary structure server (http://pqs.ebi.ac.uk/) was used to calculate the surface area at the putative dimer interface. Structural comparisons were performed using the DALI (http:// www.ebi.ac.uk/dali) (Holm and Sander, 1993) and VAST (http:// www.ncbi.nlm.nih.gov/Structure/VAST/) (Gibrat et al., 1996) servers. Structural figures were generated with PYMOL (http:// www.pymol.org) (DeLano, 2002).

We thank a reviewer for noting the similarity between B116 and the gene V protein. This work was supported by grants from the National Science Foundation (MCB-0236344; MCB0132156) and the National Aeronautics and Space Administration (NAG5-8807). We are indebted to the staff at the National Synchrotron Light Source beamline X9B, in particular Zbyszek Dauter and Peter Zwart, for support during data collection at the RapiData 2004 course. Portions of this research were carried out at the Stanford Synchrotron Radiation Laboratory, a national user facility operated by Stanford University on behalf of the U. S. Department of Energy, Office of Basic Energy Sciences. The SSRL Structural Molecular Biology Program is supported by the Department of Energy, Office of Biological and Environmental Research and by the National Institutes of Health, National Center for Research Resources, Biomedical Technology Program, and the National Institute of General Medical Sciences. The Macromolecular Diffraction Laboratory at Montana State University was supported, in part, by a grant from the Murdock Foundation.

Atomic coordinates Atomic coordinates and structure factors for B116 are on deposit in the Protein Data Bank (www.pdb.org) under accession code 2J85. Electrophoretic mobility shift assays For electrophoretic mobility shift assays, complementary 45 base oligonucleotides (5′-GAGCGCGCGTAATACGACT-

References Ahn, D.G., Kim, S.I., Rhee, J.K., Kim, K.P., Pan, J.G., Oh, J.W., 2006. TTSV1, a new virus-like particle isolated from the hyperthermophilic crenarchaeote Thermoproteus tenax. Virology 351 (2), 280–290. Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Arnold, H.P., Ziese, U., Zillig, W., 2000a. SNDV, a novel virus of the extremely thermophilic and acidophilic archaeon Sulfolobus. Virology 272 (2), 409–416. Arnold, H.P., Zillig, W., Ziese, U., Holz, I., Crosby, M., Utterback, T., Weidmann, J.F., Kristjanson, J.K., Klenk, H.P., Nelson, K.E., Fraser, C.M., 2000b. A novel Lipothrixvirus, SIFV, of the extremely thermophilic crenarchaeon Sulfolobus. Virology 267 (2), 252–266. Bailey, S., 1994. The CCP4 suite—Programs for protein crystallography. Acta Cryst. D50, 760–763. Beeby, M., Connor, B.D., Ryttersgaard, C., Boutz, D.R., Perry, L.J., Yeates, T.O., 2005. The genomics of disulfide bonding and protein stabilization in thermophiles. PLoS Biology 3 (9), 1549–1558. Bettstetter, M., Peng, X., Garrett, R.A., Prangishvili, D., 2003. AFV1, a novel virus infecting hyperthermophilic Archaea of the genus Acidianus. Virology 315 (1), 68–79. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of

E.T. Larson et al. / Virology 363 (2007) 387–396 microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254 (SPOCK: The Structural Properties Observation and Calculation Kit. http://quorum.tamu.edu/. The PyMOL Molecular Graphics System. http://www.pymol.org.). Christopher, J.A., 1998. SPOCK: The Structural Properties Observation and Calculation Kit. http://quorum.tamu.edu/. DeLano, W.L., 2002. The PyMOL Molecular Graphics System on World Wide Web. http://www.pymol.org. Folkers, P.J., Nilges, M., Folmer, R.H., Konings, R.N., Hilbers, C.W., 1994. The solution structure of the Tyr41 → His mutant of the single-stranded DNA binding protein encoded by gene V of the filamentous bacteriophage M13. J. Mol. Biol. 236 (1), 229–246. Gibrat, J.-F., Madej, T., Bryant, S.H., 1996. Surprising similarities in structure comparison. Curr. Opin. Struct. Biol. 6 (3), 377–385. Guan, Y., Zhang, H., Konings, R.N., Hilbers, C.W., Terwilliger, T.C., Wang, A.H., 1994. Crystal structures of Y41H and Y41F mutants of gene V protein from Ff phage suggest possible protein–protein interactions in the GVP–ssDNA complex. Biochemistry 33 (25), 7768–7778. Haring, M., Peng, X., Brugger, K., Rachel, R., Stetter, K.O., Garrett, R.A., Prangishvili, D., 2004. Morphology and genome organization of the virus PSV of the hyperthermophilic Archaeal genera Pyrobaculum and Thermoproteus: a novel virus family, the Globuloviridae. Virology 323 (2), 233–242. Haring, M., Rachel, R., Peng, X., Garrett, R.A., Prangishvili, D., 2005a. Viral diversity in hot springs of Pozzuoli, Italy, and characterization of a unique Archaeal virus, Acidianus bottle-shaped virus, from a new family, the Ampullaviridae. J. Virol. 79 (15), 9904–9911. Haring, M., Vestergaard, G., Brugger, K., Rachel, R., Garrett, R.A., Prangishvili, D., 2005b. Structure and genome organization of AFV2, a novel Archaeal Lipothrixvirus with unusual terminal and core structures. J. Bacteriol. 187 (11), 3855–3858. Haring, M., Vestergaard, G., Rachel, R., Chen, L., Garrett, R.A., Prangishvili, D., 2005c. Virology: independent virus development outside a host. Nature 436 (7054), 1101–1102. Holm, L., Sander, C., 1993. Protein structure comparison by alignment of distance matrices. J. Mol. Biol. 233 (1), 123–138. Janekovic, D., Wunderl, S., Holz, I., Zillig, W., Gierl, A., Neumann, H., 1983. TTV1, TTV2 and TTV3, a family of viruses of the extremely thermophilic, anaerobic sulfur reducing archaebacterium Thermoproteus tenax. Mol. Gen. Genet. 192, 39–45. Jones, T.A., Zou, J.Y., Cowan, S.W., Kjeldgaard, M., 1991. Improved methods for building protein models in electron density maps and the location of errors in these models. Acta Crystallogr. A 47, 110–119. Kadokura, H., Katzen, F., Beckwith, J., 2003. Protein disulfide bond formation in prokaryotes. Annu. Rev. Biochem. 72, 111–135. Khayat, R., Tang, L., Larson, E.T., Lawrence, C.M., Young, M., Johnson, J.E., 2005. Structure of an Archaeal virus capsid protein reveals a common ancestry to eukaryotic and bacterial viruses. PNAS 102 (52), 18944–18949. Kraft, P., Kummel, D., Oeckinghaus, A., Gauss, G.H., Wiedenheft, B., Young, M., Lawrence, C.M., 2004a. Structure of D-63 from Sulfolobus spindleShaped Virus 1: surface properties of the dimeric four-helix bundle suggest an adaptor protein function. J. Virol. 78 (14), 7438–7442. Kraft, P., Oeckinghaus, A., Kummel, D., Gauss, G.H., Gilmore, J., Wiedenheft, B., Young, M., Lawrence, C.M., 2004b. Crystal structure of F-93 from Sulfolobus spindle-shaped virus 1, a winged-helix DNA binding protein. J. Virol. 78 (21), 11544–11550. Kunst, F., Ogasawara, N., Moszer, I., Albertini, A.M., Alloni, G., Azevedo, V., Bertero, M.G., Bessieres, P., Bolotin, A., Borchert, S., Borriss, R., Boursier, L., Brans, A., Braun, M., Brignell, S.C., Bron, S., Brouillet, S., Bruschi, C.V., Caldwell, B., Capuano, V., Carter, N.M., Choi, S.K., Codani, J.J., Connerton, I.F., Cummings, N.J., Daniel, R.A., Denizot, F., Devine, K.M., Dusterhoft, A., Ehrlich, S.D., Emmerson, P.T., Entian, K.D., Errington, J., Fabret, C., Ferrari, E., Foulger, D., Fritz, C., Fujita, M., Fujita, Y., Fuma, S., Galizzi, A., Galleron, N., Ghim, S.Y., Glaser, P., Goffeau, A., Golightly, E.J., Grandi, G., Guiseppi, G., Guy, B.J., Haga, K., Haiech, J., Harwood, C.R., Henaut, A., Hilbert, H., Holsappel, S., Hosono, S., Hullo, M.F., Itaya, M., Jones, L., Joris, B., Karamata, D., Kasahara, Y., Klaerr-Blanchard, M., Klein, C., Kobayashi, Y., Koetter, P., Koningstein,

395

G., Krogh, S., Kumano, M., Kurita, K., Lapidus, A., Lardinois, S., Lauber, J., Lazarevic, V., Lee, S.M., Levine, A., Liu, H., Masuda, S., Mauel, C., Medigue, C., Medina, N., Mellado, R.P., Mizuno, M., Moestl, D., Nakai, S., Noback, M., Noone, D., O'Reilly, M., Ogawa, K., Ogiwara, A., Oudega, B., Park, S.H., Parro, V., Pohl, T.M., Portetelle, D., Porwollik, S., Prescott, A.M., Presecan, E., Pujic, P., Purnelle, B., Rapoport, G., Rey, M., Reynolds, S., Rieger, M., Rivolta, C., Rocha, E., Roche, B., Rose, M., Sadaie, Y., Sato, T., Scanlan, E., Schleich, S., Schroeter, R., Scoffone, F., Sekiguchi, J., Sekowska, A., Seror, S.J., Serror, P., Shin, B.S., Soldo, B., Sorokin, A., Tacconi, E., Takagi, T., Takahashi, H., Takemaru, K., Takeuchi, M., Tamakoshi, A., Tanaka, T., Terpstra, P., Tognoni, A., Tosato, V., Uchiyama, S., Vandenbol, M., Vannier, F., Vassarotti, A., Viari, A., Wambutt, R., Wedler, E., Wedler, H., Weitzenegger, T., Winters, P., Wipat, A., Yamamoto, H., Yamane, K., Yasumoto, K., Yata, K., Yoshida, K., Yoshikawa, H.F., Zumstein, E., Yoshikawa, H., Danchin, A., 1997. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390 (6657), 249–256. Larson, E.T., Reiter, D., Young, M., Lawrence, C.M., 2006. Structure of A197 from Sulfolobus turreted icosahedral virus: a crenarchaeal viral glycosyltransferase exhibiting the GT-A fold. J. Virol. 80 (15), 7636–7644. Larson, E.T., Reiter, D., Young, M.J., and Lawrence, C.M., submitted for publication. A winged-helix protein from Sulfolobus turreted icosahedral virus points toward stabilizing disulfide bonds in the intracellular proteins of a hyperthermophilic virus. Laskowski, R.A., MacArthur, M.W., Moss, D.S., Thornton, J.M., 1993. PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Cryst. 26, 283–291. Maaty, W.S.A., Ortmann, A.C., Dlakic, M., Schulstad, K., Hilmer, J.K., Liepold, L., Weidenheft, B., Khayat, R., Douglas, T., Young, M.J., Bothner, B., 2006. Characterization of the Archaeal thermophile Sulfolobus turreted icosahedral virus validates an evolutionary link among double-stranded DNA viruses from all domains of life. J. Virol. 80 (15), 7625–7635. Martin, A., Yeats, S., Janekovic, D., Reiter, W.D., Aicher, W., Zillig, W., 1984. SAV 1, a temperate u.v.-inducible DNA virus-like particle from the archaebacterium Sulfolobus acidocaldarius isolate B12. EMBO J. 3 (9), 2165–2168. Mou, T.C., Shen, M.C., Terwilliger, T.C., Gray, D.M., 2003. Binding and reversible denaturation of double-stranded DNA by Ff gene 5 protein. Biopolymers 70 (4), 637–648. Murshudov, G.N., Vagin, A.A., Dodson, E.J., 1997. Refinement of macromolecular structures by the maximum-likelihood method. Acta Cryst. D53, 240–255. Neumann, H., Schwass, V., Eckerskorn, C., Zillig, W., 1989. Identification and characterization of the genes encoding three structural proteins of the Thermoproteus tenax virus TTV1. Mol. Gen. Genet. 217 (1), 105–110. Ortmann, A.C., Wiedenheft, B., Douglas, T., Young, M., 2006. Hot crenarchaeal viruses reveal deep evolutionary connections. Nat. Rev. Microbiol. 4 (7), 520–528. Otwinowski, Z., Minor, W., 1997. Processing of X-ray diffraction data collected in oscillation mode. In: Carter, C., Sweet, R. (Eds.), Macromolecular Crystallography, Part A, vol. 276. Academic Press, pp. 307–326. Painter, J., Merritt, E.A., 2006a. Optimal description of a protein structure in terms of multiple groups undergoing TLS motion. Acta Crystallogr. Sect. D 62 (4), 439–450. Painter, J., Merritt, E.A., 2006b. TLSMD Web server for the generation of multigroup TLS models. J. Appl. Crystallogr. 39 (1), 109–111. Palm, P., Schleper, C., Grampp, B., Yeats, S., McWilliam, P., Reiter, W.D., Zillig, W., 1991. Complete nucleotide sequence of the virus SSV1 of the archaebacterium Sulfolobus shibatae. Virology 185 (1), 242–250. Peng, X., Blum, H., She, Q., Mallok, S., Brugger, K., Garrett, R.A., Zillig, W., Prangishvili, D., 2001. Sequences and replication of genomes of the Archaeal Rudiviruses SIRV1 and SIRV2: relationships to the Archaeal Lipothrixvirus SIFV and some eukaryal viruses. Virology 291 (2), 226–234. Prangishvili, D., Garrett, R.A., 2005. Viruses of hyperthermophilic crenarchaea. Trends Microbiol. 13 (11), 535–542. Prangishvili, D., Arnold, H.P., Gotz, D., Ziese, U., Holz, I., Kristjansson, J.K., Zillig, W., 1999. A novel virus family, the Rudiviridae: structure, virus–host

396


interactions and genome variability of the Sulfolobus viruses SIRV1 and SIRV2. Genetics 152 (4), 1387–1396. Prangishvili, D., Garrett, R.A., Koonin, E.V., 2006. Evolutionary genomics of Archaeal viruses: unique viral genomes in the third domain of life. Virus Res. 117 (1), 52–67. R&D Laboratory—New Brunswick Scientific (1996). Fundamentals of Fermentation: Techniques For Benchtop Fermentors Part I—E. coli, Edison, NJ. Rice, G., Tang, L., Stedman, K., Roberto, F., Spuhler, J., Gillitzer, E., Johnson, J.E., Douglas, T., Young, M., 2004. The structure of a thermophilic Archaeal virus shows a double-stranded DNA viral capsid type that spans all domains of life. PNAS 101 (20), 7716–7720. Schleper, C., Kubo, K., Zillig, W., 1992. The particle SSV1 from the extremely thermophilic archaeon Sulfolobus is a virus: demonstration of infectivity and of transfection with viral DNA. Proc. Natl. Acad. Sci. U.S.A. 89 (16), 7645–7649. Skinner, M.M., Zhang, H., Leschnitzer, D.H., Guan, Y., Bellamy, H., Sweet, R.M., Gray, C.W., Konings, R.N., Wang, A.H., Terwilliger, T.C., 1994. Structure of the gene V protein of bacteriophage f1 determined by multiwavelength X-ray diffraction on the selenomethionyl protein. Proc. Natl. Acad. Sci. U.S.A. 91 (6), 2071–2075. Stedman, K.M., She, Q., Phan, H., Arnold, H.P., Holz, I., Garrett, R.A., Zillig, W., 2003. Relationships between fuselloviruses infecting the extremely thermophilic archaeon Sulfolobus: SSV1 and SSV2. Res. Microbiol. 154 (4), 295–302. Terwilliger, T.C., 2000. Maximum likelihood density modification. Acta Cryst. D 56, 965–972.

Terwilliger, T.C., 2002. Automated main-chain model-building by template-matching and iterative fragment extension. Acta Cryst. D 59, 34–44. Terwilliger, T.C., Berendzen, J., 1999. Automated MAD and MIR structure solution. Acta Crystallogr. D 55, 849–861. Thoma, R., Obmolova, G., Lang, D.A., Schwander, M., Jenö, P., Sterner, R., Wilmanns, M., 1999. Efficient expression, purification and crystallisation of two hyperthermostable enzymes of histidine biosynthesis. FEBS Lett. 454 (1–2), 1–6. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucl. Acids Res. 22, 4673–4680. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Vestergaard, G., Haring, M., Peng, X., Rachel, R., Garrett, R.A., Prangishvili, D., 2005. A novel rudivirus, ARV1, of the hyperthermophilic Archaeal genus Acidianus. Virology 336 (1), 83–92. Wiedenheft, B., Stedman, K., Roberto, F., Willits, D., Gleske, A.K., Zoeller, L., Snyder, J., Douglas, T., Young, M., 2004. Comparative genomic analysis of hyperthermophilic Archaeal Fuselloviridae viruses. J. Virol. 78 (4), 1954–1961. Xiang, X., Chen, L., Huang, X., Luo, Y., She, Q., Huang, L., 2005. Sulfolobus tengchongensis spindle-Shaped Virus STSV1: virus–host interactions and genomic features. J. Virol. 79 (14), 8677–8686.