A Norway Spruce FLOWERING LOCUS T Homolog ... - Plant Physiology

A Norway Spruce FLOWERING LOCUS T Homolog Is Implicated in Control of Growth Rhythm in Conifers1[OA] Niclas Gyllenstrand, David Clapham, Thomas Ka¨llman, and Ulf Lagercrantz* Department of Evolutionary Functional Genomics, Evolutionary Biology Centre, Uppsala University, SE–752 36 Uppsala, Sweden (N.G., T.K., U.L.); and Department of Plant Biology and Forest Genetics, Swedish University of Agricultural Sciences, SE–750 07 Uppsala, Sweden (D.C.)

Growth in perennial plants possesses an annual cycle of active growth and dormancy that is controlled by environmental factors, mainly photoperiod and temperature. In conifers and other nonangiosperm species, the molecular mechanisms behind these responses are currently unknown. In Norway spruce (Picea abies L. Karst.) seedlings, growth cessation and bud set are induced by short days and plants from southern latitudes require at least 7 to 10 h of darkness, whereas plants from northern latitudes need only 2 to 3 h of darkness. Bud burst, on the other hand, is almost exclusively controlled by temperature. To test the possible role of Norway spruce FLOWERING LOCUS T (FT)-like genes in growth rhythm, we have studied expression patterns of four Norway spruce FT family genes in two populations with a divergent bud set response under various photoperiodic conditions. Our data show a significant and tight correlation between growth rhythm (both bud set and bud burst), and expression pattern of one of the four Norway spruce phosphatidylethanolamine-binding protein gene family members (PaFT4) over a variety of experimental conditions. This study strongly suggests that one Norway spruce homolog to the FT gene, which controls flowering in angiosperms, is also a key integrator of photoperiodic and thermal signals in the control of growth rhythms in gymnosperms. The data also indicate that the divergent adaptive bud set responses of northern and southern Norway spruce populations, both to photoperiod and light quality, are mediated through PaFT4. These results provide a major advance in our understanding of the molecular control of a major adaptive trait in conifers and a tool for further molecular studies of adaptive variation in plants.

Trees and other perennial plants must adapt their growth rhythm to seasonal changes in the environment. To a large extent, this adaptation is genetically controlled (Howe et al., 2003). A clear example is the strong clinal pattern of growth cessation and bud set in seedlings of the conifer Norway spruce (Picea abies L. Karst.; Ekberg et al., 1976). Like most conifers, Norway spruce has a long juvenile phase of about 20 years before the first cones are formed. In first-year seedlings, the annual cycle (Fig. 1) can be summarized as (1) shoot extension stops and terminal buds are set in late summer in response to a shortening photoperiod, after which the cambium ceases growth, needle primordia are initiated within the buds, and frost tolerance begins to increase; (2) rest dormancy (endodormancy) develops in the meristems during autumn after bud set and, with exposure to 1

This work was supported by the Swedish Research Council, the Swedish Research Council for Environment, Agricultural Sciences, and Spatial Planning, the Carl Tryggers Foundation, and the PhilipSo¨rensen Foundation. N.G. was supported by the European Union (grant no. QLRT–2001–01973 to Martin Lascoux). * Corresponding author; e-mail [email protected]; fax 46– 18–471–64 27. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Ulf Lagercrantz ([email protected]). [OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.095802 248

chilling temperatures (2!C–10!C), changes into quiescence dormancy (ectodormancy) by midwinter, when frost tolerance is maximal; and (3) opening of the bud scales (bud burst) occurs in spring after a temperature sum (TS) has been attained. The extension growth of first-year seedlings consists of the expansion of stem units formed in the current season. This free growth is in the following years (Fig. 1) successively replaced by predetermined growth (expansion of stem units initiated in the preceding growth period) and results in shortening of the period of extension growth. In older seedlings and trees, growth cessation and terminal bud set occur in early summer, presumably under endogenous rather than photoperiodic control (see Clapham et al., 2001a, and refs. therein). The buildup of frost tolerance in late summer is, however, initiated mainly under photoperiodic control. Seedlings from northern latitudes cease to grow early in the summer, whereas those from more southern locations continue to grow later in the season. This difference is to a large extent determined by a genetically controlled response to photoperiod (Eriksson et al., 1978). Seedlings from populations from the Arctic Circle cease to grow and set terminal buds when length of the night exceeds 2 to 3 h, whereas populations from lowlands in central Europe and Romania require 7 to 10 h of darkness to cease growth (Dormling, 1973). Shorter critical night lengths apply when seedlings are raised in continuous light; longer night lengths apply when the seedlings are raised in cycles of light and darkness (Dormling, 1973). Further

Plant Physiology, May 2007, Vol. 144, pp. 248–257, www.plantphysiol.org " 2007 American Society of Plant Biologists

FLOWERING LOCUS T Controls Growth Rhythm in Conifers

experiments adding populations from intermediate latitudes have shown that the variation displays a strong latitudinal cline (Clapham et al., 1998a). Previous experiments in Norway spruce have indicated that photoperiodic control of bud set can be achieved through two different processes, where one or the other dominates depending on the latitude of origin of the plants (for review, see Clapham et al., 1998b). One process (dark dominant) relies primarily on the measurement of a critical duration of darkness. This process is typical for trees from southern latitudes and night breaks in controlled experiments have a large effect on bud set. For the other process (light dominant), assessment of day length is more important and events occurring during the day are believed

Figure 1. A, Summary of the annual growth cycle of Norway spruce (see text for details). B, Shoots of Norway spruce at different stages of bud burst. a, Resting bud (stage 0 on Krutzsch scale [Krutzsch, 1973]). b, Swollen bud (stage 2 on Krutzsch scale). c, Newly burst bud (stage 3 on Krutzsch scale). Plant Physiol. Vol. 144, 2007

to influence the induction of bud set, in addition to night length. Southern (e.g. Romanian) populations, in contrast to northern populations, do not require light rich in the far-red (FR) spectrum during 16-h day extensions to prevent bud set. In a regime with a main light period of 8 h with light rich in FR, followed by a 16-h extension with light deficient in FR, Romanian seedlings continue to grow and do not set a bud. In contrast, seedlings from northern populations set a bud under these conditions despite continuous illumination (Clapham et al., 1998a, 1998b). Northern populations are also less responsive to night breaks. A possible reason for the differential response could be that dark timekeeping is imprecise at high latitudes, with short nights and long twilights (Clapham et al., 1998a, 1998b), and may thus be selected against in those populations. Thus, previous studies suggest that the two different mechanisms for perception of day length that are proposed for short-day (SD) and longday (LD) plants, respectively, both exist in Norway spruce and that their relative importance is under natural selection (Clapham et al., 1998b; Carre, 2001). The dark-dominant response is thought to be mediated through PHYP (PhyB type), whereas the lightdominant response is probably mainly mediated through PHYO (PhyA type; Clapham et al., 1998a, 1998b). Besides the likely involvement of phytochromes in the induction of bud set, no genes controlling bud set in conifers have so far been reported. In an ongoing global gene expression study aiming at identifying genes affecting natural variation in bud set, we identified a Norway spruce phosphatidylethanolaminebinding protein (PEBP) family homolog, which showed a strong response to photoperiod treatment (T. Ka¨llman, S. Ralph, N. Gyllenstrand, I. Ekberg, D. Clapham, J. Bohlman, and U. Lagercrantz, unpublished data). The gene also displayed higher expression in a population from the Arctic Circle as compared to a population from central Europe. The PEBP/RKIP gene family is distinguished by a PEBP domain (Chardon and Damerval, 2005; Hanzawa et al., 2005). These highly conserved genes are present in all major phylogenetic divisions and have been shown to play several key roles in both animal and plant organisms (Banfield and Brady, 2000). In angiosperms, members of the PEBP gene family have been found to play crucial roles in the control of flower induction (Kardailsky et al., 1999; Kobayashi et al., 1999; Chardon and Damerval, 2005; Hecht et al., 2005). In Arabidopsis (Arabidopsis thaliana), the PEBP gene family is made up of six closely related genes: FLOWERING LOCUS T (FT), TERMINAL FLOWER1 (TFL1), ARABIDOPSIS CENTRORADIALIS HOMOLOG, TWIN SISTER OF FT, BROTHER OF FT AND TFL1, and MOTHER OF FT AND TFL1 (MFT; Bradley et al., 1996; Kobayashi et al., 1999; Mimida et al., 2001). Investigation of these proteins has revealed that PEBP genes in all angiosperms fall into three related clades, FT like, MFT like, and TFL like (Chardon and Damerval, 2005; Hecht et al., 2005). 249

Gyllenstrand et al.

Besides a role in induction of flowering (both as inducers [FT, MFT] and repressor [TFL1]), recent data also suggest that an FT gene is involved in the photoperiodic control of bud set in an angiosperm tree, Populus (Bohlenius et al., 2006). An important challenge is to elucidate which parts of the pathways in photoperiodic response are conserved among various plant species. Conifers diverged from angiosperms some 300 million years ago, but show characteristics in the response to photoperiod that are similar to those found in angiosperms. Conifer homologs to several genes in the photoperiod pathway of angiosperms have also been identified (Heuertz et al., 2006). Among others, we isolated four Norway spruce genes with similarity to the PEBP family. Two of these, PaFT1 and PaFT3, cluster with the MFT group, whereas PaFT2 and PaFT4 showed strongest affinity to the FT group (H. Hedman, T. Ka¨llman, D. Moore, M. Lascoux, U. Lagercrantz, and N. Gyllenstrand, unpublished data). Amino acid residues critical for FT function were also conserved in PaFT2 and PaFT4 (Hanzawa et al., 2005). To test the possible role of Norway spruce PEBP-like genes in growth rhythm, we have now studied expression patterns of four PEBP family genes in seedlings from two populations with divergent bud set response under various photoperiodic conditions. Our data show significant and tight correlation between growth rhythm (both bud set and bud burst) and expression pattern of one of the four Norway spruce PEBP gene family members over a range of photoperiodic conditions.

RESULTS Expression of PaFT4 Is Tightly Correlated with Bud Set in the Romanian Population

Several PEBP family genes have been shown to exhibit diurnal rhythm in angiosperms. To test for

diurnal expression of Norway spruce PEBP genes, seedlings from a Romanian population (from latitude 47) were raised in continuous light for 3 months. Seedlings were then transferred to an 8-h light/16-h dark photoperiod (hereafter denoted SD). Needles for RNA extraction were sampled every 4 h for 96 h and mRNA levels for the four Norway spruce PEBP genes (PaFT1–4) were estimated using real-time PCR. Under continuous light, expression levels for all four genes were consistently low, but transfer to SD resulted in a striking induction up to over 250-fold at some time points for one of the genes: PaFT4 (Fig. 2). The expression also displayed a diurnal rhythm with the highest expression levels occurring during the light period. PaFT3 also displayed diurnal rhythm, but expression levels were markedly lower and, in contrast to PaFT4, levels did not increase over time (Fig. 3). PaFT1 and PaFT2, on the other hand, showed steady expression over time at low levels similar to the average level of PaFT3 (data not shown). Bud set in Norway spruce seedlings is induced by SDs in the sense that the seedlings set bud in response to one or a few cycles of long nights and SDs, even if they are returned to continuous light after the treatment. When grown up under continuous light, the Romanian population used in this experiment requires four cycles of SD to set terminal buds (Qamaruddin et al., 1995). To test whether PaFT4 expression was correlated with bud set, a series of experiments with different photoperiod treatments was conducted and bud set and PaFT4 expression were assayed. One group of seedlings from the Romanian population were again subjected to four cycles of SD and another group to four cycles of 19-h light/5-h dark (denoted LD treatment); both groups were then transferred back to continuous light. The former condition should result in a high frequency of bud set, whereas the latter should result in a low degree of bud set. Two additional groups of plants were transferred to a SD photoperiod with the addition of 1-h night breaks,

Figure 2. PaFT4 expression increase significantly after transfer from continuous light to an 8-h light/ 16-h dark (SD) photoperiod in Norway spruce plants from a Romanian population. Average DCT values (CTCTRL 2 CTPaFT4) 6 SE are given from two real-time PCR amplifications using different control genes (a-tubulin and polyubiquitin). White and black bars at the top represent light and dark periods.

250

Plant Physiol. Vol. 144, 2007


Figure 3. PaFT3 expression display a diurnal rhythm after transfer from continuous light to an 8-h light/ 16-h night (SD) photoperiod in Norway spruce plants from a Romanian population. Expression values are given as DCT (CTUBQ 2 CTPaFT3). White and black bars at the top represent light and dark periods.

either 5 h into the night (early night break [ENB]), or 12 h after lights off (late night break [LNB]). Night breaks are known to be efficient in preventing bud set in Romanian populations of Norway spruce when applied close to the critical night length of 7 h, even in an extended 40-h night, whereas a night break later in the night is less efficient (Clapham et al., 2001b). Repeated SD treatment gave a very similar expression profile to the initial SD experiment (Fig. 4; correlation coefficient 0.97). The treatment resulted in 82% of the plants setting bud (Fig. 5). The PaFT4 expression pattern after LD treatment was strikingly different, with expression constantly low at levels similar to those in constant light (Fig. 4). The low expression levels were paralleled by an almost complete suppression of bud set (2%; Fig. 5). The two night-break treatments resulted in intermediate levels of PaFT4 expression (Fig. 4) as well as bud set (24% and 55% for ENB and LNB, respectively; Fig. 5). Average PaFT4 expression levels (over time) for the different treat-

ments are given in Table I. Expression levels are all significantly different (Wilcoxon paired-sample test, all multiple test corrected, P , 0.0013). There was also a striking correlation between expression level of PaFT4 and bud set in the different experiments (Fig. 5; R2 5 0.92; degrees of freedom 5 2; P 5 0.046). Additional sampling of needles after transfer back to constant light revealed that PaFT4 expression in needles returned to the same low levels as before transfer to SD conditions (data not shown). Similar, low PaFT4 levels were observed 5, 12, 18, and 25 d after transfer. During this time, bud set was initiated and completed in induced plants. PaFT4 Expression Is Markedly Different in the Northern Population

Bud set response to photoperiod is very different in Norway spruce populations from northern latitudes. Seedlings from populations north of the Arctic Circle Figure 4. Expression of PaFT4 differs significantly between four different photoperiod treatments in Norway spruce plants from a Romanian population. Plants were grown in continuous light and transferred to one of four treatments for 4 d. Treatments were: LD (19-h light/5-h dark; n); SD (8-h light/16-h dark; h); SD 1 ENB (s); and SD 1 LNB ()). White and black bars at the top represent light and dark periods in SD (top) and LD (bottom) conditions. Start points of early and late 1-h night breaks are indicated with double and single arrows, respectively. PaFT4 expression levels were normalized to the average expression level of the LD treatment.


251

Gyllenstrand et al.

from both populations were subjected to day extensions with 16 h of FR-deficient cool-white illumination. Under these conditions, PaFT4 expression was strongly induced in northern seedlings, but remained at background level in Romanian seedlings (Fig. 7). Expression Patterns of PaFT1, PaFT2, and PaFT3 Are Not Correlated with Bud Set

Figure 5. Bud set plotted against average DCT values of PaFT4 expression for the four different photoperiodic treatments on the Romanian population (compare with Fig. 4). Linear regression (solid line) is significant (P 5 0.046) with R2 5 0.92.

raised in continuous light are induced to set terminal buds after one 16-h night. To study PaFT4 expression and bud set in seedlings from a population from latitude 67, the same four treatments were tested, except that the plants were transferred back to continuous light after two nights. Similar to the Romanian population, PaFT4 expression increased dramatically after transfer to SD conditions, but peak levels were even higher (Fig. 6). In contrast to southern populations, night breaks had no or limited effect on expression. Furthermore, expression patterns differed significantly in the LD treatments. Whereas expression remained virtually unchanged in the Romanian population, PaFT4 expression increased significantly in the Arctic population to levels even higher than those seen after night-break treatment in the Romanian one (compare with Figs. 4 and 6; Table I). Average PaFT4 expression for LD in the Arctic population was significantly higher than that for ENB in the Romanian one (Wilcoxon paired-sample test, P 5 0.016). These differences were also reflected in the bud set response, with 100% bud set in all treatments, except LD. Bud set after LD treatment was 98% and occurred 1 week later than in the other treatments. As Romanian and Artic populations differ in their requirement for FR light to prevent bud set, seedlings

Expression patterns of PaFT1 and PaFT2 that displayed low and steady expression throughout the experiment in SDs showed similar low and constant expression levels in the other photoperiodic treatments (data not shown). PaFT3, which showed a diurnal expression pattern in SDs, displayed a shift in phase in the short night treatment that was similar in both populations (data not shown). Thus, the shift in phase of PaFT3 was not associated with bud set in the Romanian population. These data suggest that neither PaFT1, PaFT2, nor PaFT3 participate in the control of vegetative bud set. PaFT4 Expression Also Correlates with Bud Burst

Air temperature is the major environmental factor regulating timing of bud burst in Norway spruce and many other tree species. A latitudinal trend in temperature response in Norway spruce has also been found in common garden experiments (Hannerz, 1994) and bud burst can be accurately predicted by the TS (based on a linear response to temperature above a defined threshold [Hannerz, 1999]). Because PaFT4 expression was closely associated with induction of bud set, we wanted to test whether a correlation existed also when buds commence growth in the spring. Dormant ramets of two Norway spruce clones with divergent bud burst response were transferred to a growth chamber with controlled temperature and light conditions. Samples of buds were taken at 12 time points from the start of the experiment until buds had flushed (representative buds at different stages are shown in Fig. 1B). In resting buds at the start of the experiment, PaFT4 expression was relatively high, with values comparable to those in needles under SD conditions in the bud set experiments (Fig. 8). Expression levels remained high until the TS had reached above 100 (after 35 d) and thereafter declined steadily

Table I. Average expression levels for PaFT4 in four photoperiodic treatments in Norway spruce plants from a Romanian and an Arctic population Expression levels, averaged over time points, are given on a log scale as DCT values (CTUBQ 2 CTPaFT4) and on an arithmetic scale relative to the SN treatment in the Romanian population. Romanian Treatment

SD SD SD LD 252

(8L/16D) 1 LNB 1 ENB (19L/5D)

Arctic

Log

Arithmetic

Log

Arithmetic

23.55 25.68 26.62 210.12

95.01 21.71 11.31 1

23.04 23.67 24.10 24.87

135.30 87.43 64.89 38.05 Plant Physiol. Vol. 144, 2007


dia and that expression declines when the plants go from an endodormant to an ectodormant stage as an effect of exposure to chilling temperatures during early winter. Further decline in expression was associated with bud burst.

DISCUSSION

Figure 6. Expression of PaFT4 during four different photoperiod treatments in Norway spruce plants from an Arctic population. Plants were grown in continuous light and transferred to one of four treatments for 2 d. Treatments were: LD (19-h light/5-h dark; n); SD (8-h light/16-h dark; h); SD 1 ENB (s); and SD 1 LNB ()). White and black bars at the top represent light and dark periods in SD (top) and LD (bottom) conditions. Start points of early and late 1-h night breaks are indicated with double and single arrows, respectively. PaFT4 expression levels were normalized to the average expression level of the LD treatment in with the Romanian population (compare with Fig. 4).

until day 56 (TS 400). The decline in the early flushing clone (K1709) occurred 1 week earlier than in the late flushing clone. The first clear signs of bud swelling occurred around TS 170 and all buds were swollen after around TS 240 (after 44 d). At TS 490 (after 62 d), all buds had flushed. At this time point, data indicated an increase in PaFT4 expression. Further experiments with extended temporal sampling are needed to clarify the expression of PaFT4 at later stages of bud burst and extension growth. Additional sampling of buds from adult trees in natural stands (from the Uppsala area, latitude 60) confirmed high PaFT4 expression levels in vegetative buds sampled in the autumn and low levels at early stages of bud burst in the spring. In samples from August 20, development of the leaf primordia had started with two to three rounds of primordia. On September 4, the shoots had initiated about two-thirds of the final number of needles, whereas on October 29, primordia initiation was complete. PaFT4 expression displayed peak expression around the time of active primordia development and declined thereafter (Fig. 9). In April, when bud burst was initiated (swollen buds; compare with. Fig. 1B), expression was very low. These data corroborate that PaFT4 expression is high in buds during active development of needle primorPlant Physiol. Vol. 144, 2007

Control of growth cessation in adult trees is poorly known, but numerous experiments have shown that photoperiod is the main cue for induction of bud set in Norway spruce seedlings (Dormling, 1973; Ekberg et al., 1976; Clapham et al., 1998a, 1998b). It is also clear that there is a strong genetically controlled latitudinal cline in this response, indicating strong selection on seedling growth rhythm (Clapham et al., 1998a). In Norway spruce seedlings, we found a striking correlation between the expression patterns in needles of one Norway spruce FT-like gene (PaFT4) and photoperiodic induction of bud set. The correlation between bud set and PaFT4 expression was particularly strong in a population from the south of the natural range, one reason being that treatments were chosen to maximize differences in bud set in that population. For comparative reasons, the same treatments were used for the northern population and these treatments caused almost complete bud set in all conditions. Still, the lower PaFT4 expression observed in the LD treatment correlated with a delay of bud set in the northern population. The strong association between the expression levels of PaFT4 and bud set, both between treatments in the Romanian population and between the two populations, clearly suggests that this gene plays a key role in the induction of growth cessation and bud set.

Figure 7. Expression of PaFT4 in Norway spruce is repressed in plants from a Romanian (h) population but not in plants from an Arctic (d) population during day extensions with R light. Plants were grown in continuous light and transferred to cycles of 16-h cool-white fluorescent light with a R:FR ratio of 10.1 (RL) and 8-h white light with a R:FR ratio of 3.0 (WL). Gray and white bars at the top represent RL and WL periods. PaFT4 expression levels were normalized to the average expression level of the Romanian population. 253

Gyllenstrand et al.

Figure 8. Decline in PaFT4 expression in buds during bud burst in two Norway spruce clones, one early flushing (s) and one late flushing (h). Arrows indicate stages of bud burst. a, A few plants had swollen buds (stage 2; compare with Fig. 1B). b, All plants had reached stage 2. c, All buds had burst (stage 3; compare with Fig. 1B). Expression values are given as DCT (CTUBQ 2 CTPaFT4).

PaFT4 is a member of the plant PEBP gene family for which no functional information is currently available outside the angiosperms. Judging from sequence homology, PaFT4 is most similar to the FT subfamily that has been shown to control induction of reproduction in angiosperms (H. Hedman, T. Ka¨llman, D. Moore, M. Lascoux, U. Lagercrantz, and N. Gyllenstrand, unpublished data). Lifschitz and Eshed (2006), however, suggested that the primary targets for both FT- and TFL-like genes in angiosperms may actually be induction and termination of growth and that induction of flowering could be seen as a pleiotropic effect. Introduction in tomato (Solanum lycopersicum) of Arabidopsis FT under the filamentous flower promoter results in FT expression mainly in leaf primordia. Such FT expression in leaf primordia results in reduced stem and leaf growth and in frequent meristem arrest in addition to early flowering (Lifschitz et al., 2006). These results indicate that FT genes can affect growth independently of flower formation. Thus, the effect of PaFT4 on extension growth and bud set could result from repression of vegetative growth, indicating that the molecular function of FTlike genes might be conserved between angiosperms and gymnosperms. However, Bohlenius et al. (2006) reported that expression of one poplar (Populus tremuloides) FT gene (PtFT1) was negatively correlated with bud set. In Arabidopsis, Hanzawa et al. (2005) showed that a single amino acid could convert the activator of flowering FT to a repressor. In light of these data, the apparently contrasting results in poplar and Norway spruce are not inconceivable, but more studies are clearly needed to clarify the function of PEBP genes in growth rhythm of both angiosperms and gymnosperms. In Norway spruce, PaFT4 is strongly expressed in leaves under SD induction, but, when plants were transferred back to continuous light, expression levels 254

returned to a low level in the leaves even though bud set was initiated. This suggests that expression of PaFT4 induced a transmissible signal directed to the apex. In angiosperms, FT genes are mainly expressed in leaves, particularly in vascular tissues. Current models in Arabidopsis state that FT expression is induced in leaves by the CONSTANS gene (Corbesier and Coupland, 2006) under inductive photoperiods. Recent data also suggest that FT mRNA, FT protein, or perhaps a downstream floral-promoting substance is transported from the leaves to the shoot apical meristem (Huang et al., 2005; Lifschitz et al., 2006). This movement results in induction of FT mRNA in the apex and the FT protein interacts with the transcription factor FD to activate flower meristem identity genes (Abe et al., 2005; Wigge et al., 2005). We also detected high expression levels of PaFT4 in buds following expression of PaFT4 in leaves and bud set induction, which is compatible with the Arabidopsis model for FT function. In plants where flowering is induced by LD photoperiods (e.g. Arabidopsis and Lolium), FT is induced in LDs (Kardailsky et al., 1999; King et al., 2006), whereas in SD plants (rice [Oryza sativa]) the FT ortholog (Hd3a) is repressed in LDs (Kojima et al., 2002). Activation of FT is mediated by CONSTANS in Arabidopsis, whereas in rice the CONSTANS ortholog Hd1 is proposed to have two opposite functions in the control or Hd3a. Under LDs, Hd1 is activated by light and represses Hd3a, whereas in SDs Hd1 is expressed during the night, which allows Hd1 to induce Hd3a (Samach et al., 2000; Hayama et al., 2003; Hayama and Coupland, 2004). Bud set in Norway spruce is induced by SDs, and PaFT4, particularly in the Romanian population, shows a response to photoperiod that is very similar to that of the rice FT gene Hd3a (Izawa et al., 2002; Ishikawa et al., 2005). In the Romanian population that is characterized by a dark-dominant bud set response (typical for SD plants), PaFT4 expression is very low under LD conditions, as is the expression of Hd3a in rice (Izawa et al., 2002). Under

Figure 9. PaFT4 expression in buds of adult Norway spruce trees at different stages of the annual growth cycle. Expression values are given as DCT (CTUBQ 2 CTPaFT4). Plant Physiol. Vol. 144, 2007


Table II. List of primers used in this study Name

Forward 5# / 3#

Reverse 5# / 3#

Polyubiquitin a-Tubulin PaFT1 PaFT2 PaFT3 PaFT4

TGGTCGTACTCTGGCCGATTATA GGCATACCGGCAGCTCTTC GTCTCTATACTCTGGTAATGA CTCCAGGCAGGTCAACAAT CGAGAATGGCTTCACTGGAT CGATGTTGGAGGAGACGAC

ACACCTAGCGGCACACAGTTAA AAGTTGTTCCGGCGTCTT GTGAACCCATTCCCGCATGTT CGCAGTGTTGGATCGCT CATCATCATCACCATCGGA GCATAAGCTCCCGTCCAAA

SDs, there is marked increase in expression of both PaFT4 and Hd3a and both also show diurnal rhythm. Furthermore, night breaks are efficient in reducing the expression of both genes in the Romanian population of Norway spruce (our data) and rice (Ishikawa et al., 2005), respectively. In rice, night-break repression of Hd3a and subsequently of flowering requires phyB (Ishikawa et al., 2005). The night-break effect is at least partly mediated through an Hd1-independent pathway possibly involving the Ehd1 gene (Doi et al., 2004; Ishikawa et al., 2005). Red (R) light is most efficient in night-break experiments also in Norway spruce (Vince-Prue, 1984), indicating a response through a B-type phytochrome also in spruce (possibly PHYP; Clapham et al., 1999). Analysis of the expression of two CO-like genes from Norway spruce (PaCOL1 and PaCOL2) did not detect any effect of night break on their expression (data not shown), indicating a similar CO-independent pathway in Norway spruce. However, additional COlike genes might exist in Norway spruce or the effect of PaCOL genes could be posttranscriptional. Interestingly, the PaFT4 response is rather different in the northern population, which fits with the hypothesis of light-dominant response (typical of LD plants) in high latitude populations of Norway spruce (Clapham et al., 1998b, 2001b). In light-dominant plants, events during the day are most important and are thought to override the effects of the duration of the night, which is most important in dark-dominant plants (typically SD plants). Requirement for FR light, a characteristic of light-dominant plants, is seen in northern populations of Norway spruce, but not in southern ones such as the Romanian (Clapham et al., 1998a). Northern populations are also less sensitive to night breaks. In this study, 1-h night breaks, whether early or late in the dark period, did not affect bud set in the northern populations. This lack of bud set response to night breaks was paralleled by a lack of PaFT4 repression seen in the Romanian population. Furthermore, a day extension experiment where an 8-h photoperiod was followed by 16-h cool-white fluorescent light that is deficient in the FR spectrum resulted in induction of PaFT4 in the northern population. In contrast, PaFT4 expression in the Romanian population remained low under the same conditions. We have previously shown that the southern and northern populations differ in their bud set response to day extensions with FR-deficient light (Clapham et al., 1998a, 1998b). All seedlings from the northern population, but none from the Romanian Plant Physiol. Vol. 144, 2007

population, set terminal buds under these conditions (cycles of 8-h main light and 16-h FR-deficient light). In controls where the day extensions were with lowirradiance illumination from metal halogen lamps, seedlings from neither population set terminal buds, confirming that the low R-to-FR ratio rather than the reduced level of illumination was inducing bud set in the northern population (Clapham et al., 1998a, 1998b). Thus, both the dark- and light-dominant responses seem to be mediated through PaFT4. Our data also showed that PaFT4 expression was high in buds after bud set. In adult trees, the highest expression was seen in late August when growth is characterized by active development of new needle primordia for the coming season. Thus, high PaFT4 expression is associated with cessation of primordial extension and bud set, but not with complete arrest of meristem growth, as development of new leaf primordia is highly active in the presence of high PaFT4 expression. After completion of leaf primordia development, plants are in an endodormant stage so they remain dormant even if exposed to high temperature. Several weeks of low temperature during early winter then transfer the plants to an ectodormant stage, meaning that exposure to high temperature results in bud break (analogous to the effect of vernalization in flowering plants). The transfer to the ectodormant stage was paralleled by a decrease in PaFT4 expression. A further decrease to very low PaFT4 levels was evident during bud burst. A more detailed phytotron study of bud burst induced by high temperature revealed a gradual decrease in PaFT4 expression. Temperature has also been shown to affect FT expression independently of light in Arabidopsis (Blazquez et al., 2003; Halliday et al., 2003; Balasubramanian et al., 2006). An increase in growth temperature from 23!C to 27!C induces flowering in SD-grown Arabidopsis plants and this effect is mediated through FT. Our present data hence show that PaFT4 expression is also affected by temperature, indicating that two major pathways for developmental response to environmental factors (photoperiod and temperature) are at least partly conserved between angiosperms and gymnosperms.

CONCLUSION

Our data strongly suggest that PaFT4 is a key integrator of growth rhythm control in Norway spruce. 255

Gyllenstrand et al.

Our data also support the hypothesis suggested by Lifschitz and Eshed (2006) that the primary and ancestral function of FT-like genes may be the induction and termination of growth. Previous studies have shown that pathways sensitive to R and FR light are important for bud set in southern and northern populations, respectively. Our results indicate that these two pathways controlling bud set and probably a temperature-sensitive pathway controlling bud burst all converge on PaFT4. A key question now is to identify these different pathways and to determine how the divergent responses of northern and southern populations are controlled. PaFT4 provides an essential tool in this quest.

MATERIALS AND METHODS Plant Materials Seedlings from two populations were used in the bud set experiment, a northern from 66.68!N, 150 m above sea level (Jock Valsja¨rv, Sweden), and a southern from 47.30!N, 750 m above sea level (Frasin, Romania).

General Plant Growth Conditions Seedlings were raised in a growth room under continuous light from metal halogen lamps at 250 mmol m22 s21 (400–700 nm) with a ratio of irradiances at 660 and 730 nm (R:FR) of 2.0, at 20!C for 3 to 4 months. Plants were grown in pots 8.5 3 8.5 3 6 cm, four to a pot, in a mixture of peat and coarse sand, with watering every 1 to 2 d from a weak complete nutrient solution after Ingestad (1979), giving 100 mg N L21. For the night-break and cycling experiments, seedlings were transferred to growth cabinets (Fison) with fluorescent tubes giving irradiance at plant level during the light periods of 200 mmol m22 s21; R:FR 5 3.0 at 20!C.

Photoperiodic Treatments—Bud Set Experiment The Romanian seedlings were exposed to four cycles of 8-h light/16-h dark (SD) before returning the seedlings to continuous light at 20!C as specified for raising the seedlings. Some of the plants were exposed to 1-h night breaks at 150 mmol m22 s21 (R:FR 5 3.0), either from 5 to 6 h after lights off (ENB) or from 12 to 13 h after lights off (LNB). Seedlings of the northern population were given two cycles of 8-h light/16-h dark. Some of the plants were exposed to night breaks as described for the Romanian seedlings, but from 2 to 3 h after lights off (ENB) or from 12 to 13 h after lights off (LNB). The ENB was chosen to coincide with the critical night length of the respective populations, where it has been shown to be most effective (Clapham et al., 2001b). Seedlings from both populations were also subjected to four or two cycles of 19-h light/5-h dark (LD) for the Romanian and northern populations, respectively. After treatment, seedlings were returned to the growth room and continuous light, during which bud set and extension growth were recorded. During the experiment, four needles close to the shoot tip from each of four plants from each population were collected at each sampling point.

Response of Seedlings to Day Extensions with FR-Deficient Light To test the response to day extensions with FR-deficient light, seedlings of the two populations were raised for 12 weeks in the growth room in continuous light as previously described and then exposed to the following conditions: (1) 16 h of FR-deficient illumination from Philips TL 40W/29RS fluorescent tubes of the cool-white type, with irradiance at a plant level of 40 mmol m22 s21 over the range 400 to 700 nm; the irradiance at 670 nm was 2.23 mmol m22 s21 and that at 730 nm was 0.21 mmol m22 s21, giving an R:FR ratio of 10.1; (2) 8 h of illumination from fluorescent tubes giving irradiance at a

256

plant level of 200 mmol m22 s21, R:FR 5 3.0; (3) a second 16-h period of FRdeficient illumination, all at 20!C. Needles were sampled at intervals of 4 h as previously described.

Bud Burst Experiment For the bud burst experiment, two clones were chosen that flush with about 2 weeks difference based on phenological observations in the field, one early flushing (1,709) originating from middle Sweden (60!N) and one late flushing (2,644) originating from Belarus (53!N). Clones of both genotypes were grown in a phytotron under controlled temperature and light (250 W, 300 mmol m22 s21, 400- to 700-nm spectrum). Plants were released from dormancy by increasing the temperature in steps from 5!C to 20!C. At each sampling, buds from four plants from each clone were collected for RNA extraction.

Molecular Methods Total RNA was isolated from needles or buds according to the protocol described in Azevedo et al. (2003) with slight modifications. In all cases, needles or buds were extracted from a pool of four plants. cDNA was prepared from 0.5 mg total RNA using SuperScript III (Invitrogen; http:// www.invitrogen.com) and random hexamer primers. cDNAs were diluted 1:100 and 5 mL were used in duplicate quantitative assays using SYBR Green master mix (Molecular Probes) with a ABI 7000 system according to manufacturer protocol. Primers for real-time reverse transcription-PCR were designed to span introns (Table II). In the initial experiments, a-tubulin and polyubiquitin were evaluated as reference genes and polyubiquitin was chosen to normalize data in subsequent experiments.

Data Analysis Relative quantification using DCT values (CTCONTROL 2 CTTARGET), where CT is the threshold cycle, was used to compare between real-time PCR assays. For some comparisons (Figs. 4 and 6), CT values were converted to relative expression levels as Rðxi Þ 5 2DCTxi 2 DCTSN where DCTSN is the average DCT value for the LD treatment of the Romanian population. For the calculations of average DCT values over time for different treatments, the first three time points in constant light (0 h to 8 h; compare with Fig. 4) were excluded. The Wilcoxon signed-rank test for paired samples was used to test for the difference in average DCT values of PaFT4 between treatments. P values of the pairwise tests were adjusted for multiple testing using the Bonferroni correction.

ACKNOWLEDGMENT We thank Kerstin Santesson for lab assistance. Received January 12, 2007; accepted March 10, 2007; published March 16, 2007.

LITERATURE CITED Abe M, Kobayashi Y, Yamamoto S, Daimon Y, Yamaguchi A, Ikeda Y, Ichinoki H, Notaguchi M, Goto K, Araki T (2005) FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science 309: 1052–1056 Azevedo H, Lino-Neto T, Tavares R (2003) An improved method for highquality RNA isolation from needles of adult maritime pine trees. Plant Mol Biol Rep 21: 333–338 Balasubramanian S, Sureshkumar S, Lempe J, Weigel D (2006) Potent induction of Arabidopsis thaliana flowering by elevated growth temperature. PLoS Genet 2: e106 Banfield MJ, Brady RL (2000) The structure of Antirrhinum centroradialis protein (CEN) suggests a role as a kinase regulator. J Mol Biol 297: 1159–1170 Blazquez MA, Ahn JH, Weigel D (2003) A thermosensory pathway controlling flowering time in Arabidopsis thaliana. Nat Genet 33: 168–171 Bohlenius H, Huang T, Charbonnel-Campaa L, Brunner AM, Jansson S, Strauss SH, Nilsson O (2006) CO/FT regulatory module controls timing of flowering and seasonal growth cessation in trees. Science 312: 1040–1043



Bradley D, Carpenter R, Copsey L, Vincent C, Rothstein S, Coen E (1996) Control of inflorescence architecture in Antirrhinum. Nature 379: 791–797 Carre IA (2001) Day-length perception and the photoperiodic regulation of flowering in Arabidopsis. J Biol Rhythms 16: 415–423 Chardon F, Damerval C (2005) Phylogenomic analysis of the PEBP gene family in cereals. J Mol Evol 61: 579–590 Clapham D, Dormling I, Ekberg I, Eriksson G, Qamaruddin M, VincePrue D (1998a) Latitudinal cline for requirement for far-red light for the photoperiodic control of bud set and extention growth in Picea abies. Physiol Plant 102: 71–78 Clapham D, Ekberg I, Dormling I, Eriksson G, Qamaruddin M, VincePrue D (1998b) Dormancy: night timekeeping and day timekeeping for the photoperiodic control of bud set in Norway spruce. In P Lumsden, A Millar, eds, Biological Rhythm Photoperiodism in Plants. BIOS Scientific Publishers Ltd, Oxford Clapham D, Ekberg I, Little C, Savolainen O (2001a) Molecular biology of conifer frost tolerance and potential applications to tree breeding. In F Bigras, S Colombo, eds, Conifer Cold Hardiness. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 187–219 Clapham D, Ekberg I, Norell L, Vince-Prue D (2001b) Circadian timekeeping for the photoperiodic control of budset in Picea abies (Norway spruce) seedlings. Biol Rhythm Res 32: 479–487 Clapham DH, Kolukisaoglu HU, Larsson CT, Qamaruddin M, Ekberg I, Wiegmann-Eirund C, Schneider-Poetsch HA, von Arnold S (1999) Phytochrome types in Picea and Pinus: expression patterns of PHYArelated types. Plant Mol Biol 40: 669–678 Corbesier L, Coupland G (2006) The quest for florigen: a review of recent progress. J Exp Bot 57: 3395–3403 Doi K, Izawa T, Fuse T, Yamanouchi U, Kubo T, Shimatani Z, Yano M, Yoshimura A (2004) Ehd1, a B-type response regulator in rice, confers short-day promotion of flowering and controls FT-like gene expression independently of Hd1. Genes Dev 18: 926–936 Dormling I (1973) Photoperiodic control of growth and growth cessation in Norway spruce seedlings. International Symposium on Dormancy in Trees. IUFRO division 2, working party 2.01.4, Kornik, Poland Ekberg I, Dormling I, Eriksson G, von Wettstein D (1976) Inheritance of the photoperiodic response in trees. In MGR Cannel, FT Last, eds, Tree Physiology and Yield Improvement. Academic Press, London, pp 207–221 Eriksson G, Ekberg I, Dormling I, Mate´rn B, von Wettstein D (1978) Inheritance of bud-set and bud-flushing in Picea abies (L.) Karst. Theor Appl Genet 52: 2–19 Halliday KJ, Salter MG, Thingnaes E, Whitelam GC (2003) Phytochrome control of flowering is temperature sensitive and correlates with expression of the floral integrator FT. Plant J 33: 875–885 Hannerz M (1994) Predicting the risk of frost occurrence after budburst of Norway spruce in Sweden. Silva Fennica 28: 243–249 Hannerz M (1999) Evaluation of temperature models for predicting bud burst in Norway spruce. Can J For Res 29: 1–11 Hanzawa Y, Money T, Bradley D (2005) A single amino acid converts a repressor to an activator of flowering. Proc Natl Acad Sci USA 102: 7748–7753 Hayama R, Coupland G (2004) The molecular basis of diversity in the photoperiodic flowering responses of Arabidopsis and rice. Plant Physiol 135: 677–684 Hayama R, Yokoi S, Tamaki S, Yano M, Shimamoto K (2003) Adaptation of photoperiodic control pathways produces short-day flowering in rice. Nature 422: 719–722 Hecht V, Foucher F, Ferrandiz C, Macknight R, Navarro C, Morin J, Vardy


ME, Ellis N, Beltran JP, Rameau C, et al (2005) Conservation of Arabidopsis flowering genes in model legumes. Plant Physiol 137: 1420–1434 Heuertz M, De Paoli E, Kallman T, Larsson H, Jurman I, Morgante M, Lascoux M, Gyllenstrand N (2006) Multilocus patterns of nucleotide diversity, linkage disequilibrium and demographic history of Norway spruce (Picea abies L. Karst). Genetics 174: 2095–2105 Howe GT, Aitken SN, Neale DB, Jermstad KD, Wheeler NC, Chen TH (2003) From genotype to phenotype: unraveling the complexities of cold adaptation in forest trees. Can J Bot 81: 1247–1266 Huang T, Bohlenius H, Eriksson S, Parcy F, Nilsson O (2005) The mRNA of the Arabidopsis gene FT moves from leaf to shoot apex and induces flowering. Science 309: 1694–1696 Ingestad T (1979) Mineral nutrient requirements of Pinus sylverstris and Picea abies seedlings. Plant Physiol 45: 373–380 Ishikawa R, Tamaki S, Yokoi S, Inagaki N, Shinomura T, Takano M, Shimamoto K (2005) Suppression of the floral activator Hd3a is the principal cause of the night break effect in rice. Plant Cell 17: 3326–3336 Izawa T, Oikawa T, Sugiyama N, Tanisaka T, Yano M, Shimamoto K (2002) Phytochrome mediates the external light signal to repress FT orthologs in photoperiodic flowering of rice. Genes Dev 16: 2006–2020 Kardailsky I, Shukla VK, Ahn JH, Dagenais N, Christensen SK, Nguyen JT, Chory J, Harrison MJ, Weigel D (1999) Activation tagging of the floral inducer FT. Science 286: 1962–1965 King RW, Moritz T, Evans LT, Martin J, Andersen CH, Blundell C, Kardailsky I, Chandler PM (2006) Regulation of flowering in the longday grass Lolium temulentum by gibberellins and the FLOWERING LOCUS T gene. Plant Physiol 141: 498–507 Kobayashi Y, Kaya H, Goto K, Iwabuchi M, Araki T (1999) A pair of related genes with antagonistic roles in mediating flowering signals. Science 286: 1960–1962 Kojima S, Takahashi Y, Kobayashi Y, Monna L, Sasaki T, Araki T, Yano M (2002) Hd3a, a rice ortholog of the Arabidopsis FT gene, promotes transition to flowering downstream of Hd1 under short-day conditions. Plant Cell Physiol 43: 1096–1105 Krutzsch P (1973) Norway spruce development of buds. IUFRO S2.02.11. International Union of Forest Research Organization, Vienna Lifschitz E, Eshed Y (2006) Universal florigenic signals triggered by FT homologues regulate growth and flowering cycles in perennial dayneutral tomato. J Exp Bot 57: 3405–3414 Lifschitz E, Eviatar T, Rozman A, Shalit A, Goldshmidt A, Amsellem Z, Alvarez JP, Eshed Y (2006) The tomato FT ortholog triggers systemic signals that regulate growth and flowering and substitute for diverse environmental stimuli. Proc Natl Acad Sci USA 103: 6398–6403 Mimida N, Goto K, Kobayashi Y, Araki T, Ahn JH, Weigel D, Murata M, Motoyoshi F, Sakamoto W (2001) Functional divergence of the TFL1like gene family in Arabidopsis revealed by characterization of a novel homologue. Genes Cells 6: 327–336 Qamaruddin M, Ekberg I, Dormling I, Norell L, Eriksson G (1995) Early effects of long nights on budset, dormancy, and abscisic acid content in two populations of Picea abies. For Genet 2: 207–216 Samach A, Onouchi H, Gold SE, Ditta GS, Schwarz-Sommer Z, Yanofsky MF, Coupland G (2000) Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis. Science 288: 1613–1616 Vince-Prue D (1984) Contrasting types of photoperiodic responses in the control of dormancy. Plant Cell Environ 7: 507–513 Wigge PA, Kim MC, Jaeger KE, Busch W, Schmid M, Lohmann JU, Weigel D (2005) Integration of spatial and temporal information during floral induction in Arabidopsis. Science 309: 1056–1059

257