A novel corticotropin-releasing factor receptor ... - The FASEB Journal

The FASEB Journal • Research Communication

A novel corticotropin-releasing factor receptor splice variant exhibits dominant negative activity: a putative link to stress-induced heart disease Yehezkel Sztainberg,*,† Yael Kuperman,* Orna Issler,* Shosh Gil,* Joan Vaughan,‡ Jean Rivier,‡ Wylie Vale,‡ and Alon Chen*,1 *Department of Neurobiology, Weizmann Institute of Science, Rehovot, Israel; †The Leslie and Susan Gonda (Goldschmied) Multidisciplinary Brain Research Center, Bar-Ilan University, RamatGan, Israel; and ‡Clayton Foundation Laboratories for Peptide Biology, The Salk Institute for Biological Studies, La Jolla, California, USA A growing body of experimental and clinical studies supports a strong association between psychological stress and cardiovascular disease. An important endogenous cardioprotective role in heart physiology has been attributed to corticotropin-releasing factor receptor type 2␤ (CRFR2␤). Here, we report the isolation of cDNA from mouse (m) heart encoding a novel CRFR2␤ splice variant. Translation of this insertion variant (iv)-mCRFR2␤ isoform produces a 421-aa protein that includes a unique C-terminal cytoplasmic tail. Our functional analysis and cellular localization studies demonstrated that when coexpressed with wild-type mCRFR2␤, iv-mCRFR2␤ significantly inhibited the wild-type mCRFR2␤ membrane expression and its functional signaling by ER-Golgi complex retention, suggesting a dose-dependent dominant negative effect. Interestingly, mice exposed to a 4-wk paradigm of chronic variable stress, a model of chronic psychological stress in humans, presented significantly lower levels of mCRFR2␤ and higher levels of ivmCRFR2␤ mRNA expression in their hearts, compared to nonstressed control mice. The dominant-negative effect of iv-mCRFR2␤ and its up-regulation by psychological stress suggest a new form of regulation of the mCRFR2␤ cardioprotective effect and a potential role for this novel isoform in stress-induced heart disease.—Sztainberg, Y., Kuperman, Y., Issler, O., Gil, S., Vaughan, J., Rivier, J., Vale, W., Chen, A. A novel corticotropin-releasing factor receptor splice variant exhibits dominant negative activity: a putative link to stress-induced heart disease. FASEB J. 23, 2186 –2196 (2009) ABSTRACT

Key Words: cardiovascular disease 䡠 urocortins 䡠 isoform 䡠 alternative splicing 䡠 ER retention Chronic cardiovascular diseases (CVDs) are the leading cause of death in developed countries. Exposure to chronic and acute psychological stress is an accepted risk factor for cardiovascular disease and may play a role in the development of cardiovascular pathology (1). 2186

The hypothalamic peptide corticotropin-releasing factor (CRF) (2) plays a crucial role in the regulation of the hypothalamic-pituitary-adrenal axis and, collectively with its related peptides urocortin (Ucn) 1 (3), Ucn 2 (4, 5), and Ucn 3 (5, 6), acts to integrate the endocrine, autonomic, and behavioral response to stressors. The CRF-related peptides signal through the activation of two G protein-coupled receptors, CRF receptor type 1 (CRFR1) (7–9), and CRFR2 (10 –14). Both CRFR1 and CRFR2 belong to the class B1 subfamily of seventransmembrane domain receptors that signal by coupling to G proteins. CRFR1 has only one known functional splice variant (␣) expressed in the central nervous system and the periphery (15, 16); however, recently it has been demonstrated that in human skin, nonfunctional splice variants of CRFR1, can interact and modify the CRFR1␣ subcellular localization and thus may modify its activity (17, 18). CRFR2 has three functional membrane splice variants in human (␣, ␤, and ␥) and two in rodent (␣ and ␤) (10 –14, 16, 19). CRFR type 2␣ (CRFR2␣) is the major splice variant expressed in the rodent brain (20), whereas CRFR type 2␤ (CRFR2␤) is expressed primarily in peripheral tissues, with the highest levels of expression in the skeletal muscle, heart, and skin (10). CRFR1 and CRFR2 differ pharmacologically: CRF has relatively lower affinity for CRFR2 compared to its affinity for CRFR1, Ucn 1 has equal affinities for both receptors, and Ucn 2 and Ucn 3 appear to be selective for CRFR2 (3, 4, 6). The urocortins are well recognized for their beneficial effects on cardiovascular functions, which are mediated via activation of heart CRFR2␤ (for a review, see refs. 21–23). Exogenously administered Ucn 1 causes vasodilatation; increases heart rate, cardiac output, cardiac contractility and coronary blood flow; and has a positive ionotropic effect (24 –26). These actions are 1

Correspondence: Department of Neurobiology, Weizmann Institute of Science, Rehovot 76100, Israel. E-mail: [email protected] doi: 10.1096/fj.08-128066 0892-6638/09/0023-2186 © FASEB

absent in CRFR2-deficient mice (27, 28). In addition, Ucn 1, Ucn 2, and Ucn 3 protect against ischemic and reperfusion injury (29, 30) and have beneficial hemodynamic, hormonal, and renal effects in experimental heart failure models (31–33). The expression levels of CRFR2␤ mRNA in the heart are down-regulated by different stressors, including exposure to LPS (34), subcutaneous ACTH or corticosterone injection (35), inflammatory cytokines (36), food deprivation (37), and acute or chronic stress (38). Several natural mutations of GPCRs that have pathophysiological implications cause receptor retention within intracellular compartments [mostly in the endoplasmic reticulum (ER)]. These GPCR mutants often behave as dominant-negative forms by blocking surface expression of the wild-type receptor (39 – 42). In the this study, we present data on the isolation, characterization, and regulation of a cDNA from mouse heart encoding a novel CRFR2␤ splice variant with a dominant-negative activity.

and the light phase. The stressors were scheduled in two different weekly timetables, which were repeated twice to create unpredictability. The weekly stressors regime included unpredictable illuminations during the dark phase, male paired housing for 1 h, 30° cage tilt, damp bedding, lowintensity stroboscopic illumination at 180 strobes/min, 80 dB white noise, 15 min of swim stress in 28-cm-diameter tanks filled with 25°C water, 30 min of immobilization stress within a blunt 50-ml tube, and short periods of either food or water restriction, 4 h each. All experimental protocols were approved by the Institutional Animal Care and Use Committee of The Weizmann Institute of Science.

MATERIALS AND METHODS

Semiquantitative and quantitative RT-PCR

Isolation of the mouse insertion variant CRFR2␤ cDNA

Total RNA preparations derived from mouse tissues were reverse transcribed to generate cDNA pools. The cDNA products were used as templates for semiquantitative and quantitative RT-PCR analysis using specific primers for mCRFR2␤, iv-mCRFR2␤, the ribosomal protein S16, and hypoxanthine phosphoribosyl-transferase (HPRT). To avoid false-positive results caused by DNA contamination, we performed a deoxyribonuclease (DNase) treatment for 30 min at 37°C using the RQ1 ribonuclease-free DNase (Promega, Madison, WI, USA). We used semiquantitative RT-PCR to amplify the levels of endogenous mCRFR2␤ and iv-mCRFR2␤ present in the mouse tissues studied. The expression of ribosomal protein S16 served as an internal control. The PCR conditions were as follows: cDNA equivalent to 50 ng of total RNA was amplified by PCR for 40 cycles at an annealing temperature of 58°C. The final MgCl2 concentration was 2 mM, and each reaction contained 0.5 U of TaqDNA polymerase (Hy Labs, Rehovot, Israel). We used quantitative RT-PCR to amplify the levels of mCRFR2␤ and iv-mCRFR2␤ present in mice hearts after chronic variable stress procedure. The expression of HPRT mRNA served as an internal control. The real-time RT-PCR reaction was performed in a Rotor-Gene 6000 thermocycler using fluorescent SYBR Green technology (ABgene, Epsom, UK). The PCR conditions were as follows: cDNA equivalent to 10 ng of total RNA was amplified by PCR for 45 cycles at an annealing temperature of 61°C. Each qPCR reaction contained 10 ␮l 2⫻ SYBR Green Mastermix, and final primer concentration of 250 nM. The specificity of the amplification products was verified by melting curve analysis.

The oligonucleotide primers 5⬘-TCGGGCAGGGTAGGACAG-3⬘ (sense, exon 1, upstream to the ATG) and 5⬘-CGGGCAGACGGTGACAGA-3⬘ (antisense, exon 14, downstream to the STOP codon) were designed to include the full mouse CRFR2 coding region. These primers were used for PCR amplification of cDNA prepared from mouse heart poly (A)⫹ RNA, which was reverse-transcribed using oligo(dT) primer. PCR was performed at 62°C for 35 cycles with 90-s extension at 72°C. The amplified fragments were subcloned into pCRIITOPO vector (Invitrogen Corp., Carlsbad, CA, USA), and individual colonies were digested using EcoRI to evaluate the inserted transcript size. A cDNA transcript of a larger size (127 bp) was observed, and sequence analysis found it to encode a novel splice variant bearing an insertion of an additional exon in intron 13. Establishment of iv-mCRFR2␤ antisera Antisera were raised in rabbits (PBL 6878, 6879, 6880), immunized with a synthetic peptide fragment encoding the unique C-terminal tail (aa 396-420: CQSSGPEFKPKTQTAEEENLLLNES) of ivCRFR2␤ conjugated to keyhole limpet hemocyanin via maleimide. Coupling protocol, formulation of immunogen for injection, and bleeding of host animals was as described previously in detail for inhibin subunits (43).

RNA preparation Total RNA was extracted from mouse tissues using the TRIzol RNA isolation reagent (Molecular Research Center, Cincinnati, OH, USA), according to the manufacturer’s recommendations. The following mouse peripheral and CNS tissues were dissected and directly subjected to total RNA isolation: skin, skeletal muscle, heart, abdominal fat, and paraventricular nucleus of hypothalamus (PVN). Total RNA was also isolated from mice hearts following chronic variable stress procedure.

Animals Oligonucleotide primers A total of 10 adult wild-type C57BL/6J male mice (Harlan, Jerusalem, Israel) were used for the experimental procedures. Mice were allowed 1 wk to acclimate before the beginning of experiments. Control mice (n⫽5) were housed in a temperature-controlled room (22 ⫾1°C) on a reverse 12:12 light-dark cycle. Food and water were given ad libitum. Chronic variable stress (CVS) mice (n⫽5) were housed in a temperature-controlled room (22 ⫾1°C) and were subjected to the CVS protocol for a period of 4 wk. In brief, mice were exposed to two different stressors per day, both in the dark STRESS-INDUCED HEART CRFR2 NOVEL ISOFORM

Sense and antisense primers were selected, when possible, to be located on different exons to avoid false-positive results caused by DNA contamination. The following specific mCRFR2␤, iv-mCRFR2␤, and S16 oligonucleotide primers were used in the semiquantitative PCR reactions: for mCRFR2␤, 5⬘GGGCTTTACCTTGGTGGGT-AG3⬘ (sense) and 5⬘CTGAAAAATTCCCAGTTGTGGTC3⬘ (antisense); for ivmCRFR2␤, 5⬘ATGACTGCCAAAGCTCAGGAC3⬘ (sense) and 5⬘ACAGCAGGTAT-GTGGAGGTCAG3⬘ (antisense); for S16, 2187

5⬘TGCGGTGTGGAGCTCGTGCTTGT3⬘ (sense) and 5⬘GCTACCAGGCCTTTGAGATGGA3⬘ (antisense). The following specific mCRFR2␤, iv-mCRFR2␤, and HPRT oligonucleotide primers were used in the quantitative PCR reactions: for mCRFR2␤, 5⬘TACCGAATCGCCCTCATTGT3⬘ (sense) and 5⬘CCACGCGATGTTTCTCAGAAT3⬘ (antisense); for ivmCRFR2␤, same primer as in semiquantitative PCR; for HPRT 5, ⬘GCAGTACAGCCCC-AAAATGG3⬘ (sense) and 5⬘GGTCCTTTTCACCAGCAAGCT3⬘ (antisense).

1:2000. Monoclonal antimyc antibody (Abcam, Cambridge, UK) was used at a final dilution of 1:2000. Antibodies against PDI and P115, kindly provided by Dr. Zima Lev (Weizmann Institute, Rehovot, Israel) were used at a final dilution of 1:50 and 1:600, respectively. Hoechst 33342 (Invitrogen) was used at a final dilution of 1 ␮g/ml. CY2 (Jackson ImmunoResearch, West Grove, PA, USA) and CY3 (Chemicon-Millipore, Schwalbach, Germany) -conjugated secondary antibodies were used at a final dilution of 1:500.

Transient transfection

Surface expression analysis

HEK293T cells were plated at 75% confluence in 6-well plates precoated with poly-l-lysine. Cells were transfected using polyethylenimine (PEI) (Sigma-Aldrich, St. Louis, MO, USA) in a 1:1.5 ratio (DNA:PEI). The cells were washed and incubated in 1.8 ml serum-free DMEM (Invitrogen) per well. DNA mixture in total volume of 0.2 ml of serum-free DMEM was mixed by vortexing with 3 ␮l PEI (1 ␮g/␮l), incubated for 10 min at RT, and the DNA/PEI complex was pipetted over each well. After overnight incubation, medium was replaced by growth medium (DMEM containing 10% FBS). COS-M6 cells were transfected by the DEAE dextran method. The cells were washed with serum-free DMEM and then incubated for 4 h in serum-free DMEM containing DNA, 50 ␮g/ml chloroquine, and 33 ␮g/ml dextran. After incubation, the transfection mixture was discarded, and cells were incubated for 3 min in 660 ␮l serum-free DMEM containing 10% DMSO. Cells were then washed with serum-free DMEM, and medium was replaced by growth medium.

HEK293T cells were used for surface expression studies. The cells were transfected with 2 ␮g of mCRFR2␤-myc or 2 ␮g of iv-mCRFR2␤-myc for the surface expression analysis and cotransfected with 0.75 ␮g of mCRFR2␤-myc and 0 – 0.75 ␮g of iv-mCRFR2␤-myc for the dominant-negative analysis using the PEI method. Twenty-four hours after transfection, cells were harvested using trypsin and replated in a 96-well plate precoated with PLL. Forty hours after transfection, cells were fixed with fresh 4% PFA and stained with anti-myc antibody raised in mice (Abcam) at a final dilution of 1:3000, followed by horseradish peroxidase (HRP)-conjugated anti-mouse antibody (Amersham Biosciences, Piscataway, NJ, USA) at a final dilution of 1:2000. 3,3⬘,5,5⬘-Tetramethylbenzidine (TMB) solution (Chemicon-Millipore) was used as substrate, and absorbance was measured in an ELISA reader (BioTek Instruments, Winooski, VT, USA).

Luciferase assay HEK293T cells were used for the cyclic AMP-responsive element (CRE) activation studies. The cells were transfected with 1.5 ␮g of mCRFR2 or 1.5 ␮g of iv-mCRFR2␤ and 0.5 ␮g of a luciferase reporter containing a fragment of the EVX1 gene with a potent cAMP response element site using the PEI method. For the dominant-negative studies, cells were transfected with 0.75 ␮g of mCRFR2␤ and increasing amounts of iv-mCRFR2␤. Twenty-four hours after transfection, cells were harvested using trypsin and replated in a 96-well plate precoated with PLL. Forty hours after transfection, cells were treated for 4 h with fixed or different concentrations of Ucn 2 for CRFR2 induction. The cells were harvested, and the luciferase reporter activity was assayed as described previously (14). Immunohistochemistry For immunohistochemistry, paraffin-embedded sections of adult mouse hearts were used. Sections were stained with hematoxylin and prepared for avidin– biotin–immunoperoxidase localization of iv-mCRFR2␤ immunoreactivity using Vectastain Elite reagents (Vector Laboratories, Burlingame, CA, USA). Rabbit antiserum against iv-mCRFR2␤ (produced in the laboratory of W.V.) was used at a final dilution of 1:1000. Immunofluorescence COS-M6 cells were used for the immunofluorescence studies. The cells were seeded on coverslips and transfected with 2 ␮g of mCRFR2␤-myc or iv-mCRFR2␤ or iv-mCRFR2␤-myc or empty control vector. Twenty-four hours after transfection, cells were fixed with fresh 4% PFA and prepared for immunostaining. Rabbit antiserum against iv-mCRFR2␤ (produced in the laboratory of W.V.) was used at a final dilution of 2188

Vol. 23

July 2009

Analysis of protein levels HEK293T cells were transfected with 1.5 ␮g of mCRFR2␤, iv-mCRFR2␤ or empty control vector. Twenty-four hours after transfection, cells were harvested in lysis buffer [25 mM Tris-HCl, pH 7.4; 150 mM KCl; 1.5 mM MgCl2; 1% (w/v) glycerol; and 1% (w/v) Nonidet P-40] containing protease inhibitors. The samples were boiled for 5 min with sample buffer, and proteins were electrophoresed on 10% SDSpolyacrylamide gel (Bio-Rad, Hercules, CA, USA), transferred onto nitrocellulose membranes, probed with anti-iv-mCRFR2␤ followed by HRP-conjugated anti-rabbit secondary antibody, and reprobed after stripping with anti-␤-actin (Sigma-Aldrich) followed by HRP-conjugated anti-mouse antibody (Amersham Biosciences). Immunoreactive proteins were visualized using EZ-ECL Chemiluminescence detection kit (Biological Industries, Kibbutz Beit Haemek, Israel). Exonization prediction Prediction of acceptor and donor sites in the intron 13 of the human CRFR2␤ gene was performed using the GeneQuest application of the Lasergene 7.2 software (DNASTAR, Inc., Madison, WI, USA). Statistical analysis All values are expressed as means ⫾ se. Statistical analysis of these data was performed using Student’s t test. A level of P ⬍ 0.05 was accepted as statistically significant.

RESULTS Isolation of mouse CRFR2␤ insertion variant Oligonucleotide primers designed to include the full mouse CRFR2 coding region were used to amplify a

The FASEB Journal

SZTAINBERG ET AL.

cDNA prepared from mouse heart poly (A)⫹ RNA using PCR (Fig. 1A). The amplified fragments were subcloned, and individual colonies were digested to evaluate the inserted transcript size. A cDNA transcript of larger size (127 bp) was observed (Fig. 1C), and sequence analysis found it to encode a novel splice variant bearing an insertion of an additional exon in intron 13 (Fig. 1A, B). The new exon contains applicable acceptor and donor sites important for the regulated alternative splicing of this isoform (Fig. 1A). Translation of this insertion variant transcript (ivCRFR2␤) predicts a 421-aa protein, comprising the extracellular, intracellular, and transmembrane domains of CRFR2␤ but followed by a unique 35-aa C-terminal cytoplasmic tail

(Fig. 1A, D). Screening of GenBank showed homology of the C terminus with no other protein. Bioinformatic analysis of the rat and human genome predicted the presence of a similar insertion variant in exon 13 of the rat CRFR2 gene, with a shorter cytoplasmic tail of 21 aa and homology of 70% in the amino acid sequence (Supplemental Fig. 1A). Exonization prediction of the human CRFR2 gene demonstrated a possible insertion of a short exon in intron 13 that will result in a unique 15-aa C-terminal cytoplasmic tail (Supplemental Fig. 1B). Experimental support for the presence of insertion variants in the CRFR2 gene of organisms other than mouse, which result in alternative cytoplasmic tail, should be further explored.

Figure 1. Sequence and schematic structure representation of iv-mCRFR2␤. A) Schematic representation of the structure of the mCRFR2 gene, including the nucleotide and translated amino acid sequences of an exon inserted in intron 13. B) Schematic representation of the structure of the known mCRFR2␤ functional transcript (top) and the novel iv-mCRFR2␤ isoform. Locations of the translation start sites (ATG) are indicated for both transcripts. Exons coding for the N-terminal extracellular domain, the seven transmembrane domains, and the C-terminal cytoplasmic domain are indicated. Hatched boxes indicate 5⬘and 3⬘-untranslated regions; open boxes represent coding regions. C) Representative image of electrophoretic analysis of the pCRII-TOPO vector containing the known mCRFR2␤ transcript (clones 1, 2, and 4) and the 127-bp-longer iv-mCRFR2␤ transcript (clone 3), isolated from a mouse heart. Oligonucleotide primers location used for iv-mCRFR2␤ isolation are indicated in A (P, primer; RP, reverse primer). D) Schematic representation of the amino acid sequence of the mCRFR2␤ and the iv-mCRFR2␤, demonstrating a unique 35- vs. 46-aa intracellular tail for iv-mCRFR2␤ and mCRFR2␤, respectively. STRESS-INDUCED HEART CRFR2 NOVEL ISOFORM

2189

Expression of iv-mCRFR2 in mouse heart To determine the tissue distribution of iv-mCRFR2␤, a semiquantitative RT-PCR electrophoretic analysis was performed using mouse skeletal muscle, heart, and skin tissues that are known to express mCRFR2␤ (14) (Fig. 2A). Distinct from mCRFR2␤ mRNA expression, which is highly expressed by skeletal-muscle and heart and to a lesser extent in skin (Fig. 2A, top), the iv-mCRFR2␤ mRNA was found to be restricted to the mouse heart (Fig. 2A, middle). To assess the ivmCRFR2␤ protein expression, a highly specific antiserum was raised in rabbits using a synthetic peptide fragment encoding the unique C-terminal tail of ivmCRFR2␤ (aa 396-420) (Fig. 2Ba). The specificity of the antibody was confirmed using both Western blot analysis (Fig. 2Bb) and immunofluorescence staining (Fig. 2C). The iv-mCRFR2␤ protein was only detected in cells transiently transfected with iv-mCRFR2␤expressing vector (Fig. 2Bb, lane 2; Cb). Cells transiently transfected with empty control vector (Fig. 2Bb, lane 1; Ca) or with mCRFR2␤-myc-expressing vector (Fig. 2Bb, lane 3; Cc), did not demonstrate iv-mCRFR2␤ staining, confirming the specificity of the antibody. COS-M6 cells transfected with mCRFR2␤-myc-expressing vector were positively stained using anti-myc antibody (Fig. 2Cd). The expression of the iv-mCRFR2␤ protein in the mouse heart was further demonstrated using immunohistochemical studies in mouse heart paraffin sections (Fig. 2E) and Western blots of mouse heart extract (Fig. 2D) using the anti-iv-mCRFR2␤ serum. Western immunoblot analysis of mouse heart extract reacted with

anti-iv-mCRFR2␤ serum demonstrated a 45-kDa band (Fig. 2D), which corresponded to the size of the band detected in the iv-mCRFR2␤-transfected cells (Fig. 2Bb). This band could not be observed in the skin extract (Fig. 2D). The cellular distribution of ivmCRFR2␤ immunoreactivity in heart sections was widespread (Fig. 2Ea, c) and could not be demonstrated when heart sections were incubated with normal rabbit serum (Fig. 2Eb, d). Cellular localization and function of iv-mCRFR2␤ Binding of CRFR2 by the urocortin peptides initiates the accumulation of intracellular cAMP and activation of its subsequent signaling pathway (44, 45). To determine the functionality of the iv-mCRFR2␤ splice form, we assessed its ability to activate the cAMP pathway, in comparison to mCRFR2␤, following ligand activation. To investigate the activation of the cAMP signaling in ivCRFR2␤ or mCRFR2␤-expressing cells, we measured the activation of the cAMP response element (CRE) following treatment with different concentrations of Ucn 2 (Fig. 3A). HEK293T cells were cotransfected with a luciferase reporter construct containing a fragment of the EVX1 gene, which contains a potent CRE site, and the iv-mCRFR2␤ or mCRFR2␤ expression constructs. Cells were treated for 4 h with vehicle or with 0.01, 0.1, 1, 10, or 100 nM Ucn 2, and the luciferase reporter activity was measured and normalized on the basis of ␤-galactosidase activity (Fig. 3A). While Ucn 2 demonstrated a potent and dose-dependent activation of CRE

Figure 2. Expression of the iv-mCRFR2␤ transcript in mouse heart. A) Representative image of electrophoretic analysis of the semiquantitative RT-PCR for mCRFR2␤, iv-mCRFR2␤, and the ribosomal protein S16 mRNA. B) A highly specific antiserum raised in rabbit using a synthetic peptide fragment encoding the unique C-terminal tail of iv-mCRFR2␤ (aa 396-420) was used for immunoblot analysis, cytoimmunostaining, and immunohistochemistry (a). Western immunoblot of iv-mCRFR2␤ protein isolated from transiently transfected COS-M6 cells (b). Lanes 1, 2, and 3 correspond to empty control vector, iv-mCRFR2␤, and mCRFR2␤ constructs, respectively. C) Immunofluorescence staining of COS-M6 cells transiently transfected with iv-mCRFR2␤ construct and stained with anti-iv-mCRFR2␤ serum followed by a Cy3-conjugated secondary antibody (b). Cells transiently transfected with empty control vector (a) or mCRFR2␤-myc (c) and stained with anti-iv-mCRFR2␤ serum followed by a Cy3-conjugated secondary antibody did not show any staining. Same mCRFR2␤-myc transiently transfected cells were stained with monoclonal antimyc antibody followed by a Cy2-conjugated secondary antibody (d). D) Western immunoblot of iv-mCRFR2␤ protein isolated from heart (right lane) or skin (left lane) tissue extracts. E) Immunoperoxidase staining for iv-CRFR2␤ in mouse heart (a, c). Incubation of control sections with normal rabbit serum did not result in any staining (b, d). 2190

Vol. 23

July 2009

The FASEB Journal

SZTAINBERG ET AL.

(arbitrary units) Figure 3. Functional analysis and cellular localization of iv-mCRFR2␤. A) Activation of a cAMP response element-luciferase reporter by Ucn 2 in HEK293T cells transiently transfected with mCRFR2␤ or iv-mCRFR2␤. Luciferase reporter containing a fragment of the cAMP response element promoter of the EVX1 gene was cotransfected into HEK293T cells with mCRFR2␤ or iv-mCRFR2␤. Luciferase activity was measured 3 h after treatment with 0.01–100 nM Ucn 2. B) Surface expression of mCRFR2␤ and iv-mCRFR2␤ measured by immunofluorescence. COS-M6 cells were transiently transfected with iv-mCRFR2␤-myc (a, b) or mCRFR2␤-myc (c, d) constructs, with or without Triton, and stained with monoclonal anti-myc antibody followed by a Cy3-conjugated secondary antibody. C) Surface expression of mCRFR2␤ and iv-mCRFR2␤ measured by ELISA assay using monoclonal anti-myc antibody in HEK293T cells transiently transfected with mCRFR2␤-myc or iv-mCRFR2␤-myc constructs. D) Cellular localization of iv-mCRFR2␤. COS-M6 cells were transiently transfected with iv-mCRFR2␤ and double stained with anti-iv-mCRFR2␤ serum and either anti-p115 (a–c) or anti-PDI (d–f) as Golgi or ER markers, respectively. Graphs shows mean of 8 replicates from one experiment. ***P ⬍ 0.001.

in mCRFR2␤-expressing cells, it failed to stimulate the CRE in iv-mCRFR2␤-expressing cells (Fig. 3A). To further investigate the inability of iv-mCRFR2␤ to signal on stimulation with Ucn 2, we examined the surface expression and cellular localization of ivmCRFR2␤ (Fig. 3B, C). A construct containing a myc tag at the first extracellular domain of iv-mCRFR2␤ was generated. COS-M6 cells transiently transfected with iv-mCRFR2␤-myc-expressing plasmid were positively stained with antimyc antibody only following membrane permeabilization with Triton X-100 (Fig. 3Ba, b), demonstrating the absence of iv-mCRFR2␤ on the cell membrane. In contrast, COS-M6 cells transiently transfected with mCRFR2␤-myc-expressing construct showed a strong membrane immunostaining using antimyc antibody, with or without membrane permeabilization (Fig. 3Bc, d). In addition, cell surface expression of iv-mCRFR2␤ and mCRFR2␤ was quantitatively evaluated using ELISA analysis (Fig. 3C). HEK293T cells transiently transfected with iv-mCRFR2␤-myc-ex STRESS-INDUCED HEART CRFR2 NOVEL ISOFORM

pressing construct showed minimal surface expression compared with cells transiently transfected with mCRFR2␤-myc-expressing construct (Fig. 3C). As ivmCRFR2␤ seemed to be retained intracellularly, we examined its internal localization (Fig. 3D). The ivmCRFR2␤ protein expression was limited to the ER-Golgi complex, as determined by costaining of iv-mCRFR2␤, transiently transfected into COS-M6 cells, and p115 (Fig. 3Da–c) or PDI (Fig. 3Dd–f) as markers for Golgi complex and ER, respectively. The dominant-negative effect of iv-mCRFR2␤ Since both mCRFR2␤ and iv-mCRFR2␤ are endogenously coexpressed in the mouse heart, we examined possible functional interactions between these two splice variants by studying the effects of iv-mCRFR2␤ on mCRFR2␤ cAMP signaling. Transfected iv-mCRFR2␤ inhibits, in a dose-dependent manner, the cAMP re2191

sponse to constant Ucn 2 (10 nM) treatment in HEK293T cells transfected with mCRFR2␤, as measured by cAMP response element-luciferase activity of the EVX1 gene (Fig. 4A). Furthermore, the Ucn 2 dose-response activation of CRE-luciferase, mediated via mCRFR2␤, was significantly inhibited by iv-mCRFR2␤ cotransfection, demonstrating 50 and 100% inhibition in 1:0.5 and 1:1 transfection ratios, respectively (Fig. 4B). To further delineate the observed potent dominant negative effect of iv-mCRFR2␤ on mCRFR2␤ cellular signaling, we measured the surface expression (Fig. 4C) and cellular localization (Fig. 4D) of mCRFR2␤ in cells transfected with or without iv-mCRFR2␤ isoform. The surface expression analysis revealed a significant dosedependent inhibition of mCRFR2␤ surface expression following iv-mCRFR2␤ coexpression (Fig. 4C). COS-M6 cells transfected with mCRFR2␤-myc-expressing plasmid

showed a clear membrane expression pattern (Fig. 4Da). In contrast, when cotransfected with iv-mCRFR2␤, the mCRFR2␤-myc was intracellularly retained together with iv-mCRFR2␤ (Fig. 4Db–d). Differential regulation of iv-mCRFR2␤ and mCRFR2␤ by stress To determine the effect of chronic stress on heart iv-mCRFR2␤ and mCRFR2␤ mRNA levels, we subjected mice to a chronic variable stress protocol for 4 wk. Control mice remained undisturbed beyond routine husbandry. The levels of mCRFR2␤ mRNA, determined using real-time PCR, were significantly reduced in mice subjected to chronic variable stress compared with control mice (Fig. 5A) . Similar results were previously

Figure 4. Dominant-negative effects of the iv-mCRFR2␤ isoform. A) Activation of cAMP response element-luciferase reporter by Ucn 2 in HEK293T cells transiently cotransfected with a fixed amount (0.75 ␮g) of mCRFR2␤ construct, a luciferase reporter containing a fragment of the cAMP response element promoter of the EVX1 gene, and increasing amounts of iv-mCRFR2␤ construct (0.1– 0.75 ␮g). Transfections were supplemented with empty pcDNA3 vector to control for total DNA transfected. Luciferase activity was measured 3 h after treatment with 10 nM Ucn 2. B) Activation of cAMP response element-luciferase reporter by Ucn 2 in HEK293T cells transiently cotransfected with 1:0, 1:0.5, and 1:1 ratios of mCRFR2␤ and iv-mCRFR2␤, respectively. Luciferase reporter containing a fragment of the cAMP response element promoter was cotransfected into HEK293T cells with mCRFR2␤ and iv-mCRFR2␤. Luciferase activity was measured 3 h after treatment with 0.001–100 nM Ucn 2. C) Surface expression of mCRFR2␤ measured by ELISA assay using monoclonal anti-myc antibody in HEK293T cells transiently transfected with 1:0, 1:0.5, and 1:1 ratios of mCRFR2␤ and iv-mCRFR2␤, respectively. D) Immunofluorescence staining of COS-M6 cells transiently transfected with mCRFR2␤-myc and stained with monoclonal anti-myc antibody followed by a Cy3-conjugated secondary antibody; note the full membrane expression of mCRFR2␤ (a). Immunofluorescence staining of COS-M6 cells transiently cotransfected with mCRFR2␤-myc and iv-mCRFR2␤ (b–d) and double-stained with monoclonal anti-myc antibody followed by a Cy3-conjugated secondary antibody (b), and anti-iv-mCRFR2␤ serum followed by a Cy2conjugated secondary antibody (c). Note the mCRFR2␤ retention in the ER-Golgi region and the colocalization with iv-mCRFR2␤ (merge and DAPI staining; d). Graphs shows mean of 8 replicates from one experiment. 2192

Vol. 23

July 2009

The FASEB Journal

SZTAINBERG ET AL.

V

V

Figure 5. Differential regulation of iv-mCRFR2␤ and mCRFR2␤ mRNA in mouse heart following chronic variable stress. mRNA levels of iv-mCRFR2␤ and mCRFR2␤ expressed by the mouse heart, with or without exposure to chronic variable stress (CVS) were quantified by real time PCR analysis. mCRFR2␤ mRNA expression levels in mouse heart were significantly down-regulated in the CVS group compared to the control group (A) while iv-mCRFR2␤ mRNA expression levels were significantly up-regulated (B). Data are means ⫾ se; n ⫽ 5/group. *P ⬍ 0.05, **P ⬍ 0.01; Student’s t test.

reported by Pournajafi-Nazarloo et al. (38). In contrast, the levels of iv-mCRFR2␤ mRNA were significantly increased, suggesting that iv-mCRFR2␤ and mCRFR2␤ are differently regulated by chronic stress. Regulated levels of heart iv-mCRFR2␤ support a physiological function for this novel splice form and its up-regulation following chronic stress combined with the down-regulation of mCRFR2␤ mRNA levels, will additively reduce the functionality of this heart beneficial receptor and may contribute to the pathogenesis associated with stress-related heart diseases.

DISCUSSION In the present study, we identified and characterized a novel heart mCRFR2␤ splice variant (iv-mCRFR2␤), derived from an insertion of an additional exon located in intron 13 of the mCRFR2 gene that encodes a 421-aa protein with a unique C-terminal cytoplasmic tail. The CRFR2 has three known functional membrane splice variants in humans (␣, ␤, and ␥) and two in rodents (␣ and ␤) (10 –14, 16, 19). The expression of CRFR2␣ was STRESS-INDUCED HEART CRFR2 NOVEL ISOFORM

found to be restricted mainly to brain structures of the rodent brain (20), whereas CRFR2␤ was found to be most highly expressed in rodent skeletal muscle, heart, and skin tissues (10). C-terminal splice variants of GPCRs have been previously reported, including variants of adrenergic, GABAergic, metabotropic glutamate (mGlu), mu-opioid, prostanoid, serotonin (5HT), and somatostatin receptors (for a review, see ref. 46). Particularly, C-terminal splice variants of the 5HT7 receptor (47) and the mGluR5 (48) result from an insertion of a small sequence within the C-terminal tail. To the best of our knowledge, this is the first report of an insertion variant in the class B of GPCRs causing an amino acid replacement restricted to the cytoplasmic C-terminal tail. Although mCRFR2␤ is highly expressed by both the skeletal muscle and heart, we found the iv-mCRFR2␤ expression to be restricted to heart tissue, indicating a selective and regulated alternative splicing of the CRFR2 gene in the mouse heart. The presence of a different cytoplasmic C-terminal tail in the iv-mCRFR2␤ splice form limited its ability to reach the plasma membrane of transfected HEK293T or COS-M6 cells. Although mCRFR2␤ protein showed a uniform plasma membrane pattern of cellular distribution, our cellular localization studies revealed that iv-mCRFR2␤ is concentrated around the nucleus and was colocalized with ER and Golgi markers, which corresponded to ER-Golgi retention. The intracellular retention of iv-mCRFR2␤ can be a result of the aa sequence modification in its C-terminal tail. In contrast to mCRFR2␤ that contains only one diarginine ER retention motif of the RXR type in its C-terminal tail, the iv-mCRFR2␤ C-terminal tail amino acid sequence includes a diarginine RRXRR ER retention motif, a dilysine KXK ER retention motif (49, 50), and an acidic dileucine EXXXLL motif, known to mediate internalization targeting to endosomal-lysosomal compartments (51, 52). The activation of mCRFR2␤ in distinct tissues or cell types by selective CRF and urocortin peptides initiates a variety of signaling pathways (for reviews, see refs. 53–55), which commonly involve an increase in cellular levels of cAMP. Our functional analysis studies demonstrated the inability of iv-mCRFR2␤ to induce cAMP/ PKA signaling following Ucn 2 stimulation, probably due to its inability to reach the plasma membrane. Furthermore, coexpression of iv-mCRFR2␤ and mCRFR2␤ splice forms lead to a dose-dependent dominant-negative effect of iv-mCRFR2␤ on mCRFR2␤-mediated cAMP pathway activation. Using cellular localization and surface expression analysis, we demonstrated that when cotransfected, iv-mCRFR2␤ impaired, in a dose-dependent manner, the mCRFR2␤ function by retaining its cellular location to the ER-Golgi complex. Several examples in the literature describe mutations in GPCRs that result in a truncated receptor retained in the ER with a similar dominant-negative effect (39–42). Two natural dominant-negative genetic mutations of the human chemokine receptor 5 (CCR5), an essential coreceptor for the cellular entry 2193

of the human immunodeficiency virus type 1 (HIV-1) (56, 57), were reported. The ccr5⌬32 (58) and the CCR5-893(⫺) (40) truncated forms of CCR5 were shown to be retained in the ER and inhibit the CCR5 surface expression by heterodimerization, conferring the cells’ resistance to HIV-1 infection. Another example exists in the Frizzled family of Wnt receptors. A mutant allele of Fz4, linked to the retinal degenerative disease familial exudative vitreoretinopathy, oligomerizes with wild-type Fz4, retains it in the ER, and inhibits its signaling (41). Recently, it has been demonstrated that coexpression of human skin CRFR1 splice variants with WT CRFR1 in epidermal keratinocytes resulted in intracellular retention of WT CRFR1. However, the functional importance of this intracellular retention was not reported (18). To our knowledge, iv-mCRFR2␤ is the only known isoform with a cellular dominantnegative effect at the CRF family. Several studies have proposed an important endogenous cardioprotective role for CRFR2␤ in heart physiology (for a review, see refs. 21–23). The beneficial effects of urocortins, via activation of CRFR2␤, include coronary vasodilatation, increased cardiac contractility, coronary blood flow and conductance, cardiac output, and heart rate, as well as protection against ischemia-reperfusion injury (24 –26, 29, 30, 31–33). In addition, it was demonstrated that the expression of CRFR2␤ in the rodent cardiovascular system is down-regulated by different stressors (34 – 38). Systemic injection of LPS, a model of systemic immune activation and inflammation, markedly down-regulates CRFR2␤ mRNA levels in the heart in a dose-dependent manner (34). In the same vein, systemic administration of inflammatory cytokines like IL-1␣ and TNF-␣ also reduced the CRFR2␤ expression in heart (35, 36). Nutritional stress induced by food deprivation, acute physical restraint stress, and chronic isolation stress decreased CRFR2␤ mRNA expression in the atria ventricle, as well as the aorta of both female and male prairie voles (37, 38). In the present study, we showed, in concordance with the above previous studies, that the mCRFR2␤ mRNA levels were indeed down-regulated in hearts of mice that undergo chronic variable stress. In contrast, the iv-mCRFR2␤ mRNA levels were up-regulated, suggesting differential regulation by stress. It has been recognized that psychological stress may be a trigger of CVD, including myocardial ischemia, myocardial infarction (MI), ventricular arrhythmia, and sudden cardiac death (for reviews, see refs. 1, 59, 60). The INTERHEART study (61) investigated the relation of chronic stressors to the incidence of MI in a sample of ⬃25,000 people from 52 countries. Those who reported “permanent stress” at work or at home had ⬎2.1 times the risk for developing MI. The Whitehall II study (62) found 2.15fold increased risk for new coronary heart disease in men who experienced a mismatch between effort and reward at work. However, downstream signals converting psychological stress into cellular dysfunc2194

Vol. 23

July 2009

tion and finally into vascular disease are still largely unknown. Several diseases were demonstrated to result from mislocalization of cell-surface GPCRs within cells. For example, retinitis pigmentosa is caused by a nonfunctional rhodopsin protein retained in the ER (63, 64), and nephrogenic diabetes insipidus is caused by intracellular retention of the vasopressin V2 receptor (64, 65). Furthermore, a recent study has demonstrated the association of abnormal C-terminal splicing variant in the cardiac sodium channel with human heart failure (66). The iv-mCRFR2 intracellular retention, the stressinduced change in the mCRFR2␤ to iv-mCRFR2␤ ratio, and the dominant-negative effect of iv-mCRFR2␤ on mCRFR2␤, together suggest a possible mechanism for stress-induced heart diseases. Interestingly, we found high homology between the mouse and rat intron 13 at the insertion site of iv-mCRFR2␤, and acceptor and donor sequences in the human intron 13, predicting the possibility of alternative splicing leading to exonization at the intron, which will result in the replacement of the C-terminal intracellular tail. In conclusion, we found a novel heart mCRFR2␤ splice variant (iv-mCRFR2␤) that acts as a dominantnegative regulator of mCRFR2␤ surface expression and which is up-regulated by chronic stress. The role of iv-mCRFR2␤ as a dominant-negative regulator of mCRFR2␤ under physiological and pathological conditions remains to be determined. The sequence data from this study have been submitted to GenBank as follows: iv-mCRFR2beta (GenBank no. FJ548565). We thank Ms. E. Dunn (The Salk Institute) and Mr. O. Laufer and Mr. A. Biran (The Weizmann Institute) for technical assistance. We thank Dr. J. Gulyas and R. Kaiser (The Salk Institute) for peptide synthesis. A.C. is incumbent of the Philip Harris and Gerald Ronson Career Development Chair. W.V. is a Clayton Medical Research Foundation, Inc., Senior Investigator and is the Helen McLoraine Professor of Molecular Neurobiology. J.R. is the Dr. Frederik Paulsen Chair in Neurosciences Professor. This work is supported (for A.C.) by research grants from the Israel Science Foundation, the Israel Ministry of Health, Roberto and Renata Ruhman, Mr. and Mrs. Mike Kahn, Mr. Jorge David Ashkenazi, Mr. and Mrs. Barry Wolfe, The Irving B. Harris Foundation, Green Irwin Alzheimer’s Research, The Joseph D. Shane Fund for Neuroscience, the estate of Ernst and Anni Deutsch (RPH Promotor Stiftung), the Hana and Julius Rosen Fund, the Mel and Joyce Eisenberg Keefer Professional Chair for New Scientists, Mr. and Mrs. Gerhard and Hannah Bacharach, the Nella and Leon Benoziyo Center for Neurosciences, Fondation Fernande et Jean Gaj, the Woman’s Health Research Center, the Abisch–Frenkel Foundation for the Promotion of Life Sciences, and the Carl and Micaela Einhorn–Dominic Institute for Brain Research. This work is supported (for W.V. and J.R.) by award 5P01DK026741-29 from the National Institute of Diabetes and Digestive and Kidney Diseases. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of Diabetes and Digestive and Kidney Diseases or the National Institutes of Health. This research was supported in part by the Clayton Medical Research Foundation, Inc.

The FASEB Journal

SZTAINBERG ET AL.

REFERENCES 1. 2.

3.

4.

5. 6.

7. 8.

9.

10.

11.

12.

13.

14.

15. 16.

17.

Dimsdale, J. E. (2008) Psychological stress and cardiovascular disease. J. Am. Coll. Cardiol. 51, 1237–1246 Vale, W., Spiess, J., Rivier, C., and Rivier, J. (1981) Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and beta-endorphin. Science 213, 1394 –1397 Vaughan, J., Donaldson, C., Bittencourt, J., Perrin, M. H., Lewis, K., Sutton, S., Chan, R., Turnbull, A. V., Lovejoy, D., Rivier, C., Rivier, J., Sawchenko, P. E., and Vale, W. (1995) Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropin-releasing factor. Nature 378, 287–292 Reyes, T. M., Lewis, K., Perrin, M. H., Kunitake, K. S., Vaughan, J., Arias, C. A., Hogenesch, J. B., Gulyas, J., Rivier, J., Vale, W. W., and Sawchenko, P. E. (2001) Urocortin II: a member of the corticotropin-releasing factor (CRF) neuropeptide family that is selectively bound by type 2 CRF receptors. Proc. Natl. Acad. Sci. U. S. A. 98, 2843–2848 Hsu, S. Y., and Hsueh, A. J. (2001) Human stresscopin and stresscopin-related peptide are selective ligands for the type 2 corticotropin-releasing hormone receptor. Nat. Med. 7, 605– 611 Lewis, K., Li, C., Perrin, M. H., Blount, A., Kunitake, K., Donaldson, C., Vaughan, J., Reyes, T. M., Gulyas, J., Fischer, W., Bilezikjian, L., Rivier, J., Sawchenko, P. E., and Vale, W. W. (2001) Identification of urocortin III, an additional member of the corticotropin-releasing factor (CRF) family with high affinity for the CRF2 receptor. Proc. Natl. Acad. Sci. U. S. A. 98, 7570 – 7575 Chen, R., Lewis, K. A., Perrin, M. H., and Vale, W. W. (1993) Expression cloning of a human corticotropin-releasing-factor receptor. Proc. Natl. Acad. Sci. U. S. A. 90, 8967– 8971 Vita, N., Laurent, P., Lefort, S., Chalon, P., Lelias, J. M., Kaghad, M., Le Fur, G., Caput, D., and Ferrara, P. (1993) Primary structure and functional expression of mouse pituitary and human brain corticotrophin releasing factor receptors. FEBS Lett. 335, 1–5 Chang, C. P., Pearse, R. V., 2nd, O’Connell, S., and Rosenfeld, M. G. (1993) Identification of a seven transmembrane helix receptor for corticotropin-releasing factor and sauvagine in mammalian brain. Neuron 11, 1187–1195 Perrin, M., Donaldson, C., Chen, R., Blount, A., Berggren, T., Bilezikjian, L., Sawchenko, P., and Vale, W. (1995) Identification of a second corticotropin-releasing factor receptor gene and characterization of a cDNA expressed in heart. Proc. Natl. Acad. Sci. U. S. A. 92, 2969 –2973 Stenzel, P., Kesterson, R., Yeung, W., Cone, R. D., Rittenberg, M. B., and Stenzel-Poore, M. P. (1995) Identification of a novel murine receptor for corticotropin-releasing hormone expressed in the heart. Mol. Endocrinol. 9, 637– 645 Kishimoto, T., Pearse, R. V. 2nd, Lin, C. R., and Rosenfeld, M. G. (1995) A sauvagine/corticotropin-releasing factor receptor expressed in heart and skeletal muscle. Proc. Natl. Acad. Sci. U. S. A. 92, 1108 –1112 Lovenberg, T. W., Liaw, C. W., Grigoriadis, D. E., Clevenger, W., Chalmers, D. T., De Souza, E. B., and Oltersdorf, T. (1995) Cloning and characterization of a functionally distinct corticotropin-releasing factor receptor subtype from rat brain. Proc. Natl. Acad. Sci. U. S. A. 92, 836 – 840 Chen, A., Perrin, M., Brar, B., Li, C., Jamieson, P., Digruccio, M., Lewis, K., and Vale, W. (2005) Mouse corticotropin-releasing factor receptor type 2␣ gene: isolation, distribution, pharmacological characterization and regulation by stress and glucocorticoids. Mol. Endocrinol. 19, 441– 458 Pisarchik, A., and Slominski, A. (2004) Molecular and functional characterization of novel CRFR1 isoforms from the skin. Eur. J. Biochem. 271, 2821–2830 Grammatopoulos, D. K., Dai, Y., Randeva, H. S., Levine, M. A., Karteris, E., Easton, A. J., and Hillhouse, E. W. (1999) A novel spliced variant of the type 1 corticotropin-releasing hormone receptor with a deletion in the seventh transmembrane domain present in the human pregnant term myometrium and fetal membranes. Mol. Endocrinol. 13, 2189 –2202 Slominski, A., Zbytek, B., Zmijewski, M., Slominski, R. M., Kauser, S., Wortsman, J., and Tobin, D. J. (2006) Corticotropin releasing hormone and the skin. Front. Biosci. 11, 2230 –2248

STRESS-INDUCED HEART CRFR2 NOVEL ISOFORM

18. 19.

20.

21. 22. 23.

24. 25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

Zmijewski, M. A., and Slominski, A. T. (2009) CRF1 receptor splicing in epidermal keratinocytes: potential biological role and environmental regulations. J. Cell. Physiol. 218, 593– 602 Kostich, W. A., Chen, A., Sperle, K., and Largent, B. L. (1998) Molecular identification and analysis of a novel human corticotropin-releasing factor (CRF) receptor: the CRF2␥ receptor. Mol. Endocrinol. 12, 1077–1085 Lovenberg, T. W., Chalmers, D. T., Liu, C., and De Souza, E. B. (1995) CRF2␣ and CRF2␤ receptor mRNAs are differentially distributed between the rat central nervous system and peripheral tissues. Endocrinology 136, 4139 – 4142 Charles, C. J., Rademaker, M. T., and Richards, A. M. (2004) Urocortins: putative role in cardiovascular disease. Curr. Med. Chem. Cardiovasc. Hematol. Agents 2, 43– 47 Boonprasert, P., Lailerd, N., and Chattipakorn, N. (2008) Urocortins in heart failure and ischemic heart disease. Int. J. Cardiol. 127, 307–312 Hashimoto, K., Nishiyama, M., Tanaka, Y., Noguchi, T., Asaba, K., Hossein, P. N., Nishioka, T., and Makino, S. (2004) Urocortins and corticotropin releasing factor type 2 receptors in the hypothalamus and the cardiovascular system. Peptides 25, 1711– 1721 Parkes, D. G., Vaughan, J., Rivier, J., Vale, W., and May, C. N. (1997) Cardiac inotropic actions of urocortin in conscious sheep. Am. J. Physiol. 272, H2115–H2122 Terui, K., Higashiyama, A., Horiba, N., Furukawa, K. I., Motomura, S., and Suda, T. (2001) Coronary vasodilation and positive inotropism by urocortin in the isolated rat heart. J. Endocrinol. 169, 177–183 Rademaker, M. T., Charles, C. J., Espiner, E. A., Fisher, S., Frampton, C. M., Kirkpatrick, C. M., Lainchbury, J. G., Nicholls, M. G., Richards, A. M., and Vale, W. W. (2002) Beneficial hemodynamic, endocrine, and renal effects of urocortin in experimental heart failure: comparison with normal sheep. J. Am. Coll. Cardiol. 40, 1495–1505 Bale, T. L., Contarino, A., Smith, G. W., Chan, R., Gold, L. H., Sawchenko, P. E., Koob, G. F., Vale, W. W., and Lee, K. F. (2000) Mice deficient for corticotropin-releasing hormone receptor-2 display anxiety-like behaviour and are hypersensitive to stress. Nat. Genet. 24, 410 – 414 Coste, S. C., Kesterson, R. A., Heldwein, K. A., Stevens, S. L., Heard, A. D., Hollis, J. H., Murray, S. E., Hill, J. K., Pantely, G. A., Hohimer, A. R., Hatton, D. C., Phillips, T. J., Finn, D. A., Low, M. J., Rittenberg, M. B., Stenzel, P., and Stenzel-Poore, M. P. (2000) Abnormal adaptations to stress and impaired cardiovascular function in mice lacking corticotropin-releasing hormone receptor-2. Nat. Genet. 24, 403– 409 Brar, B. K., Jonassen, A. K., Stephanou, A., Santilli, G., Railson, J., Knight, R. A., Yellon, D. M., and Latchman, D. S. (2000) Urocortin protects against ischemic and reperfusion injury via a MAPK-dependent pathway. J. Biol. Chem. 275, 8508 – 8514 Brar, B. K., Jonassen, A. K., Egorina, E. M., Chen, A., Negro, A., Perrin, M. H., Mjøs, O. D., Latchman, D. S., Lee, K. F., and Vale, W. (2004) Urocortin-II and urocortin-III are cardioprotective against ischemia reperfusion injury: an essential endogenous cardioprotective role for corticotropin releasing factor receptor type 2 in the murine heart. Endocrinology 145, 24 –35 Rademaker, M. T., Charles, C. J., Espiner, E. A., Frampton, C. M., Lainchbury, J. G., and Richards, A. M. (2005) Four-day urocortin-I administration has sustained beneficial haemodynamic, hormonal, and renal effects in experimental heart failure. Eur. Heart. J. 26, 2055–2062 Rademaker, M. T., Cameron, V. A., Charles, C. J., and Richards, A. M. (2005) Integrated hemodynamic, hormonal, and renal actions of urocortin 2 in normal and paced sheep: beneficial effects in heart failure. Circulation 112, 3624 –3632 Rademaker, M. T., Cameron, V. A., Charles, C. J., and Richards, A. M. (2006) Urocortin 3: haemodynamic, hormonal, and renal effects in experimental heart failure. Eur. Heart. J. 27, 2088 – 2098 Heldwein, K. A., Duncan, J. E., Stenzel, P., Rittenberg, M. B., and Stenzel-Poore, M. P. (1997) Endotoxin regulates corticotropin-releasing hormone receptor 2 in heart and skeletal muscle. Mol. Cell. Endocrinol. 131, 167–172 Kageyama, K., Gaudriault, G. E., Bradbury, M. J., and Vale, W. W. (2000) Regulation of corticotropin-releasing factor receptor type 2 beta messenger ribonucleic acid in the rat cardiovas-

2195

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46. 47.

48.

49. 50.

2196

cular system by urocortin, glucocorticoids, and cytokines. Endocrinology 141, 2285–2293 Coste, S. C., Heldwein, K. A., Stevens, S. L., Tobar-Dupres, E., and Stenzel-Poore, M. P. (2001) IL-1␣ and TNF␣ down-regulate CRH receptor-2 mRNA expression in the mouse heart. Endocrinology 142, 3537–3545 Nazarloo, H. P., Nishiyama, M., Tanaka, Y., Asaba, K., and Hashimoto, K. (2002) Down-regulation of corticotropin-releasing hormone receptor type 2␤ mRNA expression in the rat cardiovascular system following food deprivation. Regul. Pept. 105, 121–129 Pournajafi-Nazarloo, H., Partoo, L., Sanzenbacher, L., Azizi, F., and Carter, C. S. (2007) Modulation of corticotropin-releasing hormone type 2 receptor and urocortin 1 and urocortin 2 mRNA expression in the cardiovascular system of prairie voles following acute or chronic stress. Neuroendocrinology 86, 17–25 Benkirane, M., Jin, D. Y., Chun, R. F., Koup, R. A., and Jeang, K. T. (1997) Mechanism of transdominant inhibition of CCR5mediated HIV-1 infection by ccr5delta32. J. Biol. Chem. 272, 30603–30606 Shioda, T., Nakayama, E. E., Tanaka, Y., Xin, X., Liu, H., Kawana-Tachikawa, A., Kato, A., Sakai, Y., Nagai, Y., and Iwamoto, A. (2001) Naturally occurring deletional mutation in the C-terminal cytoplasmic tail of CCR5 affects surface trafficking of CCR5. J. Virol. 75, 3462–3468 Kaykas, A., Yang-Snyder, J., He´roux, M., Shah, K. V., Bouvier, M., and Moon, R. T. (2004) Mutant Frizzled 4 associated with vitreoretinopathy traps wild-type Frizzled in the endoplasmic reticulum by oligomerization. Nat. Cell Biol. 6, 52–58 Harada, N., Yamada, Y., Tsukiyama, K., Yamada, C., Nakamura, Y., Mukai, E., Hamasaki, A., Liu, X., Toyoda, K., Seino, Y., and Inagaki, N. (2008) A novel GIP receptor variant influences GIP sensitivity of pancreatic ␤-cells in obese mice. Am. J. Physiol. Endocrinol. Metab. 294, E61–E68 Vaughan, J. M., Rivier, J., Corrigan, A. Z., McClintock, R., Campen, C. A., Jolley, D., Voglmayr, J. K., Bardin, C. W., Rivier, C., and Vale, W. (1989) Detection and purification of inhibin using antisera generated against synthetic peptide fragments. Methods Enzymol. 168, 588 – 617 Heldwein, K. A., Redick, D. L., Rittenberg, M. B., Claycomb, W. C., and Stenzel-Poore, M. P. (1996) Corticotropin-releasing hormone receptor expression and functional coupling in neonatal cardiac myocytes and AT-1 cells. Endocrinology 137, 3631– 3639 Hoare, S. R., Sullivan, S. K., Fan, J., Khongsaly, K., and Grigoriadis, D. E. (2005) Peptide ligand binding properties of the corticotropin-releasing factor (CRF) type 2 receptor: pharmacology of endogenously expressed receptors, G-protein-coupling sensitivity and determinants of CRF2 receptor selectivity. Peptides 26, 457– 470 Minneman, K. P. (2001) Splice variants of G protein-coupled receptors. Mol. Interv. 1, 108 –116 Jasper, J. R., Kosaka, A., To, Z. P., Chang, D. J., and Eglen, R. M. (1997) Cloning, expression and pharmacology of a truncated splice variant of the human 5-HT7 receptor (h5-HT7b). Br. J. Pharmacol. 122, 126 –132 Minakami, R., Katsuki, F., and Sugiyama, H. (1993) A variant of metabotropic glutamate receptor subtype 5: an evolutionally conserved insertion with no termination codon. Biochem. Biophys. Res. Commun. 194, 622– 627 Teasdale, R. D., and Jackson, M. R. (1996) Signal-mediated sorting of membrane proteins between the endoplasmic reticulum and the golgi apparatus. Annu. Rev. Cell Dev. Biol. 12, 27–54 Dong, C., Filipeanu, C. M., Duvernay, M. T., and Wu, G. (2007) Regulation of G protein-coupled receptor export trafficking. Biochim. Biophys. Acta 1768, 853– 870

Vol. 23

July 2009

51. 52. 53. 54. 55.

56.

57.

58.

59. 60. 61.

62. 63. 64. 65.

66.

Bonifacio, J. S., and Traub, L. M. (2003) Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annu. Rev. Biochem. 72, 395– 447 Marchese, A., Paing, M. M., Temple, B. R. S., and Trejo, J. (2007) G protein-coupled receptor sorting to endosomes and lysosomes. Annu. Rev. Pharmacol. Toxicol. 48, 601– 629 Bale, T. L., and Vale, W. W. (2004) CRF and CRF receptors: role in stress responsivity and other behaviors. Annu. Rev. Pharmacol. Toxicol. 44, 525–557 Perrin, M. H., and Vale, W. W. (1999) Corticotropin releasing factor receptors and their ligand family. Ann. N. Y. Acad. Sci. 885, 312–328 Brar, B. K., Vale, W., and Perrin, M. (2002) Corticotropinreleasing hormone receptor signaling. In Encyclopedia of Hormones and Related Cell Regulators (Henry, H. L, and Norman, A. W., eds) pp 313–325, Academic Press, San Diego, CA, USA Alkhatib, G., Combadiere, C., Broder, C. C., Feng, Y., Kennedy, P. E., Murphy, P. M., and Berger, E. A. (1996) CC CKR5: a RANTES, MIP-1␣, MIP-1␤ receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 272, 1955–1958 Deng, H., Liu, R., Ellmeier, W., Choe, S., Unutmaz, D., Burkhart, M., Di Marzio, P., Marmon, S., Sutton, R. E., Hill, C. M., Davis, C. B., Peiper, S. C., Schall, T. J., Littman, D. R., and Landau, N. R. (1996) Identification of a major co-receptor for primary isolates of HIV-1. Nature 381, 661– 666 Samson, M., Libert, F., Doranz, B. J., Rucker, J., Liesnard, C., Farber, C. M., Saragosti, S., Lapoumeroulie, C., Cognaux, J., Forceille, C., Muyldermans, G., Verhofstede, C., Burtonboy, G., Georges, M., Imai, T., Rana, S., Yi, Y., Smyth, R. J., Collman, R. G., Doms, R. W., Vassart, G., and Parmentier, M. (1996) Resistance to HIV-1 infection in caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene. Nature 382, 722–725 Vale, S. (2005) Psychosocial stress and cardiovascular diseases. Postgrad. Med. J. 81, 429 – 435 Jiang, W. (2008) Impacts of depression and emotional distress on cardiac disease. Cleve. Clin. J. Med. 75(Suppl. 2), S20 –S25 Rosengren, A., Hawken, S., Ounpuu, S., Sliwa, K., Zubaid, M., Almahmeed, W. A., Blackett, K. N., Sitthi-amorn, C., Sato, H., and Yusuf, S. (2004) Association of psychosocial risk factors with risk of acute myocardial infarction in 11119 cases and 13648 controls from 52 countries (the INTERHEART study): casecontrol study. Lancet 364, 953–962 Bosma, H., Peter, R., Siegrist, J., and Marmot, M. (1998) Two alternative job stress models and the risk of coronary heart disease. Am. J. Public. Health 88, 68 –74 Dryja, T. P., and Li, T. (1995) Molecular genetics of retinitis pigmentosa. Hum. Mol. Genet. 4, 1739 –1743 Edwards, S. W., Tan, C. M., and Limbird, L. E. (2000) Localization of G-protein-coupled receptors in health and disease. Trends Pharmacol. Sci. 21, 304 –308 Morello, J. P., Salahpour, A., Laperrie`re, A., Bernier, V., Arthus, M. F., Lonergan, M., Peta¨ja¨-Repo, U., Angers, S., Morin, D., Bichet, D. G., and Bouvier, M. (2000) Pharmacological chaperones rescue cell-surface expression and function of misfolded V2 vasopressin receptor mutants. J. Clin. Invest. 105, 887– 895 Shang, L. L., Pfahnl, A. E., Sanyal, S., Jiao, Z., Allen, J., Banach, K., Fahrenbach, J., Weiss, D., Taylor, W. R., Zafari, A. M., and Dudley, S. C. Jr. (2007) Human heart failure is associated with abnormal C-terminal splicing variants in the cardiac sodium channel. Circ. Res. 101, 1146 –1154

The FASEB Journal

Received for publication December 23, 2008. Accepted for publication February 12, 2009.

SZTAINBERG ET AL.