A PCRbased method to characterise and identify ...

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/13989102

A PCR-based method to characterise and identify benzimidazole resistance in Helminthosporium solani1 Article in FEMS Microbiology Letters · August 1997 DOI: 10.1111/j.1574-6968.1997.tb10454.x · Source: PubMed

CITATIONS

READS

41

48

2 authors: Gareth J Mckay

Louise Rene Cooke

Queen's University Belfast

Queen's University Belfast

74 PUBLICATIONS 1,003 CITATIONS

81 PUBLICATIONS 818 CITATIONS

SEE PROFILE

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

AsiaBlight: a late blight network for Asia View project

All content following this page was uploaded by Louise Rene Cooke on 23 December 2016. The user has requested enhancement of the downloaded file.

FEMS Microbiology Letters 152 (1997) 371^378

A PCR-based method to characterise and identify benzimidazole resistance in Helminthosporium solani Gareth J. M Kay *, Louise R. Cooke c

a

a;

a ;b

Department of Applied Plant Science, The Queen's University of Belfast, Agriculture and Food Science Centre, Newforge Lane, Belfast BT9 5PX, UK Applied Plant Science Division, Department of Agriculture for Northern Ireland, Newforge Lane, Belfast BT9 5PX, UK b

Received 27 February 1997; revised 5 May 1997; accepted 5 May 1997

Abstract

Control of Helminthosporium solani, the cause of silver scurf in potato tubers, has been impaired by selection of benzimidazole-resistant strains as a result of repeated use of the fungicide thiabendazole. Identification of thiabendazoleresistant strains of H. solani by conventional techniques takes several weeks. Primers designed from conserved regions of the fungal L-tubulin gene were used to PCR amplify and sequence a portion of the gene. A point mutation was detected at codon 198 in thiabendazole-resistant isolates causing a change in the amino acid sequence from glutamic acid to alanine or glutamine. Species-specific PCR primers designed to amplify this region were used in conjunction with a restriction endonuclease to cause cleavage in sensitive isolates only and thus provide a rapid diagnostic test to differentiate field isolates. Keywords: Helminthosporium solani ; L-Tubulin; Resistance; Benzimidazole; Fungicide; Diagnostics; Polymerase chain reaction

1. Introduction

The fungal pathogen Helminthosporium solani causes lesions on potato tubers commonly referred to as silver scurf. These detract from the appearance of tubers, rendering them less acceptable for the quality ware market and for seed. H. solani can be controlled by post-harvest or pre-planting fungicide application. In the UK, the benzimidazole thiabendazole has been widely used on potatoes since the * Corresponding author. Tel.: +44 (1232) 255261; Fax: +44 (1232) 668373; E-mail: [email protected] EMBL accession number: Y10670.

mid-1970s. Thiabendazole-resistant H. solani was ¢rst identi¢ed in 1988 in the UK [1]; its incidence increases rapidly with repeated thiabendazole application [2]. Thiabendazole-resistant H. solani has also been reported from Canada, Sweden and the USA and may be responsible for recent increases in silver scurf incidence (e.g. [3]). Benzimidazoles bind to fungal L-tubulin protein, inhibiting microtubule function. Resistance, which has been detected in many fungal species, results from a mutation in the L-tubulin gene which causes an altered amino acid sequence at the benzimidazole binding site [4,5]. In studies of phytopathogenic fungi, resistance has been associated with amino acid substitutions within the L-tubulin molecule due to point mutations usually in codon 198 or codon 200

0378-1097 / 97 / $17.00 ß 1997 Federation of European Microbiological Societies. Published by Elsevier Science B.V. PII S 0 3 7 8 - 1 0 9 7 ( 9 7 ) 0 0 2 2 9 - 2

G.J. McKay, L.R. Cooke / FEMS Microbiology Letters 152 (1997) 371^378

372

[6,7], although alterations in other regions within the

2.2. DNA extraction

gene cannot be discounted. Currently, strains

detection

H. solani

of

of

is

thiabendazole-resistant

accomplished

by

culturing

the pathogen on fungicide-amended agar [1].

ani

H. sol-

is slow growing and detecting thiabendazole-re-

Fourteen

isolates

H. solani

of

(Table

1)

were

grown over sterile discs of cellophane on MA plates at 15³C for 14 days. Mycelium was removed and DNA

extracted

using

a

phenol/chloroform

extrac-

sistant strains may take several weeks. A rapid de-

tion method derived from that of Raeder and Broda

tection technique would allow rational selection of

[8] but with an additional phenol/chloroform extrac-

fungicides

tion. The genomic DNA pellet was resuspended in

more

to

control

detailed

silver

monitoring

scurf of

and

fungal

also

permit

populations.

Wl

250

U

of sterile distilled water and electrophoresed

This is particularly important as there are relatively

on a 1% agarose (Pharmacia) gel in 1

few fungicides approved for

application to potato

Tris base, 89 mM boric acid, 2 mM EDTA, pH 8.0)

tubers. The aim of this study was two-fold : to iden-

bu¡er, stained in ethidium bromide and visualised

tify the mutations associated with benzimidazole re-

using a UV transilluminator [9].

sistance in

2.3. Polymerase chain reaction

H. solani

; and to develop a rapid molec-

ular detection technique to identify resistant isolates of

H. solani

from the ¢eld. Initial ampli¢cations of the ment

2. Materials and methods

the

region

formed using the primers

L-tubulin

of

gene frag-

interest

were

per-

L-tubf1 and L-tubr1 (Table

2). Primers, based on published sequences of con-

2.1. Fungal cultures H. solani

containing

TBE (89 mM

L-tubulin

served regions of the

gene, were designed

using the computer software package CLUSTAL V was isolated using the method of Hide et

[10]. Ampli¢cations (50

Wl) were performed using 100

al. [1] ; isolates were derived either from single spores

ng of genomic DNA, 1.5 mM MgCl2 , 2 U Ampli-

or from small groups of spores. Sixty isolates were

Taq

obtained from tuber progeny from two ¢eld trials

each

carried out at Newforge Lane, Belfast in 1995. In

dCTP,

addition,

mM Tris-HCl (pH 8.3) and 0.2

19

isolates

of

H. solani

were

obtained

0

polymerase (PE Applied Biosystems), 0.2 mM

of

Wl

deoxyribonucleotide dGTP,

dTTP

triphosphates,

(dNTPs),

1

WM

mM

dATP,

KCl,

10

of each primer.

from seven tuber samples submitted for advisory ex-

A 5

amination. For comparison, nine reference isolates

target DNA as a negative control. A PE Applied

of

Biosystems GeneAmp PCR System 2400 was used

H. solani

(four thiabendazole-resistant, ¢ve thia-

bendazole-sensitive)

from

the

Scottish

Agricultural

aliquot of milliQ

50

water was used instead of

with the following programme : 1 min at 94³C, initial denaturation cycle ; 15 s at 94³C, 20 s at 54³C, 20 s at

Science Agency (SASA) were used. Isolates grown on malt agar (MA) at 15³C were

72³C, 30 cycles ; 7 min at 72³C, 1 cycle.

tested for benzimidazole sensitivity on MA amended

Aliquots of each PCR product from these ampli-

thiabendazole (drug pure,

¢cations were electrophoresed on 1.2% agarose gel

with 0, 5, or 100

Wg

31

ml

MSD Agvet). For each isolate, two plates of each

U

concentration were inoculated, each plate receiving three

mycelial

pieces

(ca.

2

2

mm)

cut

from

the

and visualised as described in Section 2.2.

2.4. DNA sequencing and data analysis

leading edge of an actively growing colony. Plates were examined for the presence or absence of fungal

Each PCR product was puri¢ed using the Wiz-

1

growth after 14 days and 28 days at 15³C. Isolates

ard

were classi¢ed as sensitive (S) if they grew on un-

to the manufacturer's instructions. Isolates were se-

amended agar, but not on either thiabendazole con-

quenced using double-stranded DNA template (0.2

centration, intermediate (I) if they grew on 5

Wg, but

31 and resistant (R) if not 100 Wg thiabendazole ml 31 . they grew on both 5 and 100 Wg thiabendazole ml

DNA Clean Up System (Promega) according

Wg Wl31 ) and 1 WM of the forward and reverse primers L-tubf1 and L-tubr1 following the protocol supplied with the Prism

1

Ready Reaction DyeDeoxy


373

Table 1 Details of Helminthosporium solani isolates used for DNA sequencing and amino acid change associated with benzimidazole resistance Source of tuber sample/Isolate code Potato cultivar In vitro test result Amino acid changea

Field trial

BL3/95 66 BL2/95 17/2 BL2/95 7/1 BL3/95 1 BL2/95 30/2 BL2/95 14/5

Cultra Kerr's Pink Kerr's Pink Pentland Dell Pentland Dell Pentland Dell

R R S R I S

Glutamine Alanine ^ Alanine Glutamine ^

Deèsireèe-3 TS4/96-4 TS13/96-2 TS10/96-2 TS13/96-4 TS8/96-3 TS7/96-2 TS6/96-2 a Coded for by codon 198 of the L-tubulin gene.

Deèsireèe Home Guard Kerr's Pink Kerr's Pink Kerr's Pink Navan Navan Pentland Dell

I R R S S R I S

Glutamine Glutamine Alanine ^ ^ Glutamine Glutamine ^

Advisory samples

Terminator Cycle Sequencing Kit (PE Applied Biosystems). Sequencing was conducted on a PE Applied Biosystems Model 373A DNA Sequencer as recommended by the manufacturer. In order to sequence both strands completely in both directions, internal primers were designed (Table 2) by primerwalking within the gene fragment and the primers used for cycle sequencing as described. The sequence data of complementary strands were compared visually and sequences aligned using CLUSTAL V [10]. The computer software package, MAPSORT (Daresbury Laboratory, UK), was used to identify any variation in the restriction digest patterns between resistant and sensitive isolates. Due to the probable presence of other fungal material on infected potato tuber surfaces and the high level of conservation of the L-tubulin gene, it was imperative that only H. solani DNA was ampli¢ed during PCR. Speci¢c primers were designed from two regions identi¢ed as unique from published sequence data. Primers, SS-for and SS-rev (PE Applied Biosystems) (Table 2), were synthesised and tested against other fungal DNA (Table 3) using a PCR reaction mix and conditions as described in Section 2.3.

2.5. Ampli¢cation from infected tuber and fungal mycelium Potato tubers suspected of being infected by H. solani were placed under high humidity for 3 days

at 15³C to encourage sporulation. Resultant dark brown conidia were removed microscopically and added to a 0.2 ml MicroAmp0 PCR tube containing 10 Wl of Gene Releaser1 (Bioventures Inc.). Similarly, 88 isolates of H. solani grown on MA (Table 4) were disturbed with a sterile ¢ltered pipette tip and treated as above. All samples were placed in a PE Applied Biosystems GeneAmp PCR System 2400 and subjected to the following programme: 30 s at 65³C, 30 s at 8³C, 90 s at 65³C, 180 s at 97³C, 60 s at 8³C, 180 s at 65³C, 60 s at 97³C, 60 s at 65³C, 5 min Table 2 Nucleotide sequence of PCR and cycle sequencing primers Primer Sequence (5P-3P) L-tubf1 CAGCTCGAGCGTATGAACGTCTG L-tubf2 AGGTTTCCGACACTGTCGT L-tubf3 CGCACACTCCTTCCGTGCCGT L-tubr1 AGTACCAATGCAAGAAAGCCTT L-tubr2 CGGAAGTCAGAGGCAGCCATC L-tubr3 CTCGTCCGAGTTCTCGACAAGCTG SS-for AGCATAGGCTGATGCTCGT SS-rev ACCTTACCACGGAAGATACCAC

374


at 80³C. The PCR reaction mix was added direct at 80³C, and was made up as in Section 2.3 with the exception that the primers used were 0.2 WM of SSfor and SS-rev. The following programme was used on addition of the PCR reaction mix: 3 min at 94³C, 1 cycle; 30 s at 94³C, 15 s at 58³C, 20 s at 72³C, 35 cycles; 7 min at 72³C, 1 cycle. 2.6. Restriction digest The PCR product, 15 Wl, was digested by the addition of 2.5 U BsaI (New England Biolabs), plus 1 Wl of sterile distilled water, at 50³C for 2 h. The results of the digest were analysed on a 2% high resolution agarose (Sigma) using agarose gel electrophoresis and visualised as described in Section 2.2.

3. Results 3.1. Polymerase chain reaction and Bsa 1 restriction digest Fourteen isolates of H. solani were sequenced; ¢ve were sensitive to thiabendazole (S), three were intermediate (I) and six were resistant (R) in vitro (Table 1). PCR ampli¢cation of genomic DNA from these isolates using the primers L-tubf1 and L-tubr1 generated a product of 1138 bp in length (Fig. 1). The PCR product from each isolate was DNA nucleotide sequenced in both directions using the primers from Table 2. On the basis of the sequence data, new primers were designed, SS-for and SS-rev (Table 2) for the speci¢c ampli¢cation of a fragment of the L-tubulin gene from H. solani only. Primers SS-for and SS-rev ampli¢ed a product of the expected size (870 bp) from all isolates (Table 1, Fig. 2, lanes 15^ 16). When these primers were also tested against genomic DNA of other potato fungal pathogens and other fungi (Table 3) no ampli¢cation was detected. All benS isolates of H. solani analysed in this study had the sequence GAG (Glu) at codon position 198 of the L-tubulin gene. Of the nine isolates classi¢ed as benR by PCR, six were identi¢ed as having codon 198 converted from GAG (Glu) to CAG (Gln) due to a single base transversion mutation within this codon. The remaining three benR isolates were iden-

Table 3 Fungal species used to test speci¢city of Helminthosporium solani species-speci¢c PCR primers, SS-for and SS-rev Alternaria brassicicola Alternaria solani Botrytis cinerea Colletotrichum destructivum Colletotrichum lindemuthianum Dactylium dendroides Epicoccum nigrum Fusarium avenaceum Fusarium coeruleum Fusarium culmorum Fusarium poae Microdochium nivale Oospora lactis Penicillium chrysogenum Penicillium montanese Phytophthora cactorum Phytophthora cinnamomi Phytophthora erythroseptica Phytophthora fragariae Phytophthora infestans Polyscytalum pustulans Rhizoctonia solani Septoria nodorum Septoria tritici Stemphylium botryosum Trichoderma harzianum Trichoderma pseudokoningii

ti¢ed as also having a single base transversion mutation resulting in an amino acid change at codon 198 from GAG (Glu) to GCG (Ala) (Table 1). Of the six benR isolates with the CAG sequence, three were classi¢ed as R and three as I in vitro, whilst the three benR isolates with the GCG sequence were all classi¢ed as R in vitro. Apart from the mutation at codon 198, DNA sequences for this region of the L-tubulin gene were identical in all H. solani isolates. The DNA nucleotide sequence at codon 198/199 for benS isolates of H. solani equated to a BsaI restriction site (3P-CCAGAG{N}5 -5P) therefore only benS isolates are susceptible to digestion at this site. When ampli¢ed with primers SS-for and SSrev and digested with BsaI, benS isolates of H. solani generate three sub-fragments of the expected sizes 420, 390 and 62 bp, the latter being rarely visible (Fig. 2, lanes 1^5). On the other hand, benR isolates generate two sub-fragments of the expected sizes 482 and 390 bp (Fig. 2, lanes 6^14).

375


3.2. Direct ampli¢cation from infected potato tubers and fungal mycelium

The H. solani speci¢c PCR primers, SS-for and SS-rev, were used in conjunction with Gene Releaser1 (Bioventures Inc.) to amplify a L-tubulin gene fragment directly from H. solani mycelium and conidia. Results achieved were consistent with previous ¢ndings, although the banding patterns observed were not as intense as those obtained using pure genomic DNA. The overall time taken from sample preparation to visualising the agarose gel results was approximately 4 h. 3.3. Benzimidazole sensitivity

Twenty-two isolates designated as S by in vitro testing were subjected to the PCR-based technique and all were classi¢ed as benS by this method (Table 4). Thirty-nine isolates designated as R in vitro were tested by PCR; 37 were classi¢ed as benR and two as benS . The two isolates which gave di¡erent results by the two techniques were tested twice in vitro and again gave a R response. They were also tested three times by PCR, one consistently gave a benS reaction, the other gave a benS reaction twice and a benR reaction once. Of 18 isolates designated as I in vitro, 13 were classi¢ed as benR by PCR and ¢ve as benS . The ¢ve thiabendazole-sensitive reference isolates

from SASA were all classi¢ed as benS by PCR, while the four resistant isolates all gave a benR result. 4. Discussion

The sequence of the L-tubulin gene fragment from

H. solani exhibited 99% homology with the L-tubulin gene of Venturia inaequalis [6]. May et al. [11] iden-

ti¢ed 12 amino acid homologies unique to fungal Ltubulins; of these 12, nine lie within the region sequenced for H. solani, all of which correlate to this `fungal signature' (Fig. 1, amino acids highlighted in bold type and underlined). In H. solani, two transversion mutations involving a single base change at codon 198 were linked to benzimidazole resistance. However, as DNA sequencing has been limited to a 1138 bp fragment, changes in other regions of the L-tubulin gene cannot be ruled out. These mutations caused amino acid changes of Glu to Gln and Glu to Ala at codon 198. This agrees with results from ¢eld isolates of other plant pathogenic fungi, where benzimidazole resistance has been associated with a single base mutation at either codon 198 or, more rarely, at codon 200 (the latter conferring only medium level resistance [6]). Of more than 15 previously analysed fungal plant pathogens, the authors have found no reference to an amino acid shift from Glu to Gln

Table 4 Response of isolates of Helminthosporium solani to thiabendazole as assessed by in vitro testing and by the PCR-based technique Source of tuber sample In vitro test result No. of isolates tested by PCR benS benR Field trialsa S 0 14 I 10 5 R 30 1 Advisory samplesb

Reference isolatesc

S I R

0 3 7

8 0 1

S 0 5 R 4 0 a Isolates from cvs Cultra, Fianna, Kerr's Pink, Pentland Dell, Record, Rooster. b Isolates from cvs De è sireèe, Home Guard, Kerr's Pink, Navan, Pentland Dell. c Obtained from the Scottish Agricultural Science Agency (SASA). Isolate codes are as follows: thiabendazole-resistant isolates, H.S/S/W2, H.S/S/W3, H.S/S/R1, H.S/S/P4; thiabendazole-sensitive isolates, H.S/S/A1, H.S/S/C1, H.S/S/J1, H.S/S/P1, H.S/S/W1.

376



Fig. 1. Nucleotide sequence of a thiabendazole-sensitive allele of

377

Helminthosporium solani. Numbering of the nucleotide sequence begins at

codon 50. 5P-Donor and 3P-acceptor sites are underlined. Splice branch sites are double underlined. Conserved fungal

L-tubulin

amino

acids are in bold type and underlined. Codon 198, the site of the mutation, is enclosed by a box.

conferring benzimidazole resistance in ¢eld isolates, although this shift has been detected in a benzimidazole-resistant laboratory mutant of [12]. The current in vitro method for assessing thiabendazole resistance in is relatively labour-intensive, time-consuming and tedious if large numbers of isolates require testing. It cannot produce results rapidly enough to provide guidance for potato growers on selection of post-harvest fungicides. The technique described here uses PCR technology to provide a simple, rapid and non-isotopic method of detecting a point mutation associated with benzimidazole resistance in . The results correlate closely with those obtained by conventional in vitro

Aspergillus nidu-

lans

H. solani

H. solani

testing. In only two of the 79 isolates tested was there a discrepancy between results given by the different techniques and this was probably due to these isolates being mixed cultures derived from more than one spore. Using a simple thermocycler-based procedure, this technology allows rapid detection of the benzimidazole resistance status of recovered from infected tissue without the need for plating or DNA extraction. This is particularly valuable for a very slow-growing pathogen such as .

H. solani

H. solani

Acknowledgments The authors thank Mr Douglas Mc Reynolds for his technical assistance with the automated DNA sequencing, Mr George Little for providing the tuber samples and overseeing the pathogen isolation and testing, and Mrs Marie Corrigan and Mr Darryl Wilson for maintaining the fungal cultures and carrying out the in vitro testing. Mrs Arlene Cameron of SASA is thanked for the reference isolates of , Mr Damian Egan (University College, Dublin) for his technical advice and Dr Averil Brown for helpful discussion and comments on the manuscript.

H.

solani

References [1] Hide, G.A., Hall, S.M. and Boorer, K.J. (1988) Resistance to Fig. 2. Rapid identi¢cation of benzimidazole resistance in

lani.

H. so-

All isolates have been PCR-ampli¢ed using the primers SS-

thiabendazole in isolates of

Helminthosporium solani, the cause

of silver scurf disease of potatoes. Plant Pathol. 37, 377^380. [2] Hide, G.A. and Hall, S.M. (1993) Development of resistance

Helminthosporium solani (silver scurf) as a

for and SS-rev. Lanes 1^5 represent benS isolates which have

to thiabendazole in

been digested with the restriction enzyme,

result of potato seed tuber treatment. Plant Pathol. 42, 707^

BsaI,

generating three

sub-fragments, 420, 390 and 62 bp in size. Lanes 6^14 are benR isolates generating two sub-fragments, 482 and 390 bp, after digestion with

BsaI.

Lanes 15 and 16 contain undigested PCR

product of a benS and a benR isolate respectively.

714. [3] Bains, P.S., Bisht, V.S. and Benard, D.A. (1996) Soil survival and sensitivity of

Helminthosporium solani isolates from Alber-

ta, Canada. Potato Res. 39, 23^30.


378

[4] Davidse, L.C. and Flach, W. (1978) Interaction of thiabendazole with fungal tubulin. Biochim. Biophys. Acta 543, 82^90.

[8] Raeder, U. and Broda, P. (1985) Rapid preparation of DNA from ¢lamentous fungi. Lett. Appl. Microbiol. 1, 17^20.

[5] Osmani, S.A. and Oakley, B.R. (1991) Cell cycle and tubulin

[9] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1987) Molecular

mutations in ¢lamentous fungi. In : More Gene Manipulations

Cloning : A Laboratory Manual. Cold Spring Harbor Labo-

in Fungi (Bennett, J.W. and Lasure, L.L., Eds.), pp. 107^125.

[6] Koenraadt, H., Somerville, S.C. and Jones, A.L. (1992) Characterization of mutations in the resistant ¢eld strains of

L-tubulin

Venturia inaequalis

gene of benomyl and other plant

pathogenic fungi. Phytopathology 82, 1348^1354. [7] Yarden, O. and Katan, T. (1993) Mutations leading to substitutions at amino acids 198 and 200 of beta-tubulin that correlate with benomyl-resistance phenotypes of ¢eld strains of

Botrytis cinerea

ratory Press, Cold Spring Harbor, NY. [10] Higgins, D.G., Bleasby, A.J. and Fuchs, R. (1992) CLUSTAL

Academic Press, London.

. Phytopathology 83, 1478^1483.

V : improved software for multiple sequence alignments. Comput. Appl. Biosci. 8, 189^191. [11] May, G.S., N.R. (1987)

Tsang, L.-S., Smith,

Aspergillus nidulans L

S. and

Morris,

divergent. Gene 55, 231^243. [12] Jung, M.K., Wilder, I.B. and Oakley, B.R. (1992) Amino acid alterations in the

dulans

ben

A (beta-tubulin) gene of

Aspergillus ni-

that confer benomyl resistance. Cell Motil. Cytoskele-

ton 22, 170^174.

View publication stats

H., Fidel,

-tubulin genes are unusually