Avian Pathology ( 2002) 31, 267–270
A potential new serotype of Riemerella anatipestifer isolated from ducks in Thailand Pornpen Pathanasophon1 *, Patchara Phuektes1 , Tipa Tanticharoenyos1 , Watcharachai Narongsak1 and Takuo Sawada2 1
National Institute of Animal Health, Kasetklang, Chatuchak, Bangkok 10900, Thailand, and 2Nippon Veterinary and Animal Science University, Musashino, Tokyo 180, Japan
Eighty isolates of Riemerella anatipestifer representing 71 outbreaks of riemerellosis in Thailand between 1994 and 1999 were serotyped using the gel diffusion precipitin test. Based on the precipitation patterns, 25 serological profiles containing one to three antigenic determinants were recognized. Heatstable antigens of the organism reacted with antisera raised against 16 known serotypes and an untypable strain 698/ 95. The most prevalent serotype appeared to be serotype 7, followed by serotypes 5, 10, 21 and 1. Further study demonstrated that the untypable strain probably represents a new serotype. Analysis of the polymerase chain reaction-amplified rrs genes for restriction fragment length polymorphisms verified the inclusion of strain 698/ 95 within the species R. anatipestifer and supported earlier work excluding strain 670/ 89, which had originally been designated the reference strain of serotype 20. Therefore, it is suggested that the strain 698/ 95 could be adopted as a replacement for the reference strain of serotype 20. Attention should be paid to strains with multiple antigenic factors as they may be useful for the preparation of vaccines.
Introduction Riemerella anatipestifer ( Segers et al., 1993) is the causative agent of an epizootic disease in poultry, especially in ducks ( Brogden, 1989) . Twenty-one serotypes have been reported ( Sandhu & Harry, 1981; Bisgaard, 1982; Sandhu & Leister, 1991; Loh et al., 1992; Pathanasophon et al., 1995) . Inactivated bacterins, live vaccines and concentrated culture filtrates have all been reported to be effective for prevention of the disease ( Layton & Sandhu, 1984; Sandhu, 1991; Pathanasophon et al., 1996). However, there is little or no significant cross-protection between the serotypes ( Sandhu, 1979; Pathanasophon et al., 1996). Serological identification of strains of R. anatipestifer is useful for determination of geographic spread and the reservoirs of infection, and also for recognition of new serotypes. This paper describes the results of serotyping of 80 field isolates, the existence of multiple antigenic factors and an additional R. anatipestifer serotype. Genetic analysis was carried out by restriction
fragment length polymorphism ( RFLP) patterns obtained with HaeIII-digested 16S rDNA polymerase chain reaction ( PCR) to compare with the reference strains to support the strain as R. anatipestifer. Materials and Methods Reference strains of existing serotypes Reference strains of R. anatipestifer representing serotypes 1 to 21, described by Sandhu & Leister ( 1991), Loh et al. ( 1992) and Pathanasophon et al. ( 1995), and their sources are presented in Table 1. Field isolates Eighty R. anatipestifer field isolates were collected from 71 outbreaks between 1994 and 1999. The organisms were isolated from heart, liver, spleen or brain tissue samples of diseased ducks and identified according to their enzymatic activities and phenotypic characters, as described by Pathanasophon et al. ( 1991) and Pathanasophon et al. ( 1994), respectively. Strain 698/95, proposed as a potential new serotype, was isolated from a flock of 55-week-old laying ducks with clinical signs and pathological lesions typical of riemerellosis. It had produced 20% morbidity and 18% mortality in a flock of 2370 birds.
* To whom correspondence should be addressed. E-mail:
[email protected] Received 1 October 2001. Accepted 24 December 2001. ISSN 0307-9457 ( print)/ ISSN 1465-3338 ( online)/ 02/030267-04 © 2002 Houghton Trust Ltd DOI: 10.1080/03079450220136576
268 P. Pathanasophon et al.. Table 1. Reference strains of 21 serotypes of R. anatipestifer used for antiserum preparation Serotype 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
Strain
Sourcea
D-24105 D-24046 D-26338 H-2565 D-24123 P-2123 D-27179 D-26220 H-1785 H-2199 D-28020 8755 11693 D-664 D-743 S-4801 K-1499 540/86 30/ 90 670/89 1062/91
DRL DRL DRL HPRS DRL NADC DRL DRL HPRS HPRS DRL CCUG CCUG CVLS CVLS DRL DRL CVLS CVLS NIAHT NIAHT
a
DRL, Duck Research Laboratory, New York, USA; HPRS, Houghton Poultry Research Station, Houghton, UK; NADC, National Animal Disease Center, Ames, IA, USA; CCUG, Culture Collection, University of Goteborg, Sweden; CVLS, Central Veterinary Laboratory, Singapore; NIAHT, National Institute of Animal Health, Thailand.
primers 16SUNI-L ( 59AGAGTTTGATCATGGCTCAG 39) and 16SUNI-R ( 59GTGTGACGGGCGGTGTGTAC 39) derived from the Escherichia coli rrs sequence ( Carbon et al., 1979). PCR reactions were performed in an automated thermocycler, with initial denaturation at 94°C for 10 min, followed by 35 cycles of 94°C for 1.5 min, 55°C for 1 min and 72°C for 2 min, then a final incubation at 72°C for 5 min. PCR mixture without DNA template was used as a negative control in each experiment. Amplification products were analysed by electrophoresis through 0.7% agarose gels containing 0.1 mg/ml ethidium bromide followed by examination under ultraviolet light transillumination. Restriction fragment length polymorphism Eight microlitres of the amplification products were digested with the restriction endonuclease HaeIII. The fragments were electrophoresed on 2% agarose gels and examined as already described.
Results The results of R. anatipestifer serotyping are presented in Table 2. Of 80 isolates examined, 16 known serotypes were demonstrated in addition to an untypable isolate. Serotypes 7, 5, 10, 21 and 1 were encountered most frequently. Sixty-one isolates ( 76.25%) reacted with only one reference antiserum, 16 isolates ( 23.75%) with two sera, and two isolates reacted with three reference sera. Prolonged heat extraction of the antigens revealed the same results. Infections with multiple types were noted both in different birds and even within a single bird on the same farm. One outbreak was caused by a combination of serotypes 7 and 8, and another by serotypes 1 and 10. Another
Antisera Chicken antisera against reference serotypes and strain 689/95 was prepared as described by Pathanasophon et al. ( 1995). The weak crossreaction between serotypes 3 ( P-1667) and serotype 7 ( P-2361) was eliminated by reciprocal absorption of the antisera with heat-treated cellular antigen.
Table 2. Serotypes of 80 R. anatipestifer strains isolated from ducks in Thailand between 1994 and 1999
Antigens
1 1, 5 1, 6 1, 15 2, 5 2, 5, 17 3 5 5, 10 5, 21 6 7 7, 21 8 10 11 11, 15 13 14 15 17 18 19 21 Strain 698/ 95 Total
Heat-extracted antigen was prepared using a modification of the method of Brogden et al. ( 1982). Organisms were grown for 18 to 24 h on blood agar plates prepared from tryptic soy agar ( Difco) supplemented with 5 to 10% defibrinated sheep blood, under 5% CO2 atmosphere incubation. They were suspended in 1.0 ml phosphatebuffered saline ( PBS) ( pH 7.2) and autoclaved at 121°C for 30 min. Cultures showing cross-reactions were investigated by preparation of antigens from 12 single isolated colonies and subsequent prolongation of heat extraction to 1 h to determine whether these cultures had originated from a mixture of strains. Gel-diffusion precipitin test The tests were carried out according to Brogden et al. ( 1982) with some modification. The agar gel consisted of 0.65% Noble agar ( Difco), 8.5% NaCl in PBS and 0.01% thimerosal. Amplification of 16S ribosomal DNA R. anatipestifer type strain ATCC 11845 and reference serotype strains 670/89, 1062/91 and 698/95 were grown on sheep blood agar plates at 37°C under 5% CO2 atmosphere incubation. Chromosomal DNA was prepared using the boiling method ( Corney et al., 1993) and used as template for PCR. PCR was performed with 1 U AmpliTaq Gold DNA polymerase ( Applied Biosystems) in 50 ml reaction mixtures containing 10 to 100 ng extracted DNA in 1 ´ PCR buffer, 2.5 mM MgCl2, 20 pmol each primer, 200 mM each deoxynucleoside triphosphate. The primers used for PCR generation of rrs gene fragments were universal
Serotypea
a
Number of isolates typed
% Positive
4 1 2 1 2 2 1 5 4 1 2 18 4 2 5 2 1 3 5 4 1 2 3 4 1 80
5.00 1.25 2.50 1.25 2.50 2.50 1.25 6.25 5.00 1.25 2.50 22.50 5.00 2.50 6.25 2.50 1.25 3.75 6.25 5.00 1.25 2.50 3.75 5.00 1.25 100
Serotypes 4, 9, 12 and 16 were not detected
Potential new serotype of R. anatipestifer 269
Figure 1. Restriction fragment length polymorphism analysis of R. anatipestifer strains: Lane 1, molecular weight markers; lane 2, ATCC 11845; lane 3, 670/89; lane 4, 1062/91; lane 5, 698/95. Chromosomal DNA was prepared and PCR amplification of 16S rRNA genes was carried out using universal primers. After digestion with enzyme HaeIII, the PCR products were separated by electrophoresis on agarose gel and stained with ethidium bromide.
outbreak included three different serotypes ( 14, 18 and 19) and another included four different serotypes ( 1, 5, 14 and 15). The PCR products of strains ATCC 11845, 670/ 89, 1062/91 and 698/ 95 were identical in size. Further RFLP analysis revealed that the RFLP patterns obtained with HaeIII-digested 16S rDNA PCR products of strain ATCC 11845, 1062/ 91 and 698/ 95 were identical. They showed five fragments whose sizes could be estimated by visual inspection of the gels, as shown in Figure 1. The high-intensity bands were at 504 base pairs ( bp), and four lowintensity bands were at 274, 241, 145 and 124 bp. These are in accordance with the 16S rRNA sequence of R. anatipestifer in the GenBank database. The HaeIII RFLP pattern of strain 670/ 89 was distinctively different from the others. It contained a high-intensity band at 600 bp, and four low-intensity bands at 241, 160, 145 and 130 bp. Discussion The precipitin lines produced in the gel-diffusion precipitin test were very clear and specific. Decreasing the concentration of Noble agar from 0.9 to 0.65% in our study permitted the results of serotyping to be available within 8 h. However, repeated reading of the result at 18 to 24 h was still necessary to confirm the result and to recognize the minor antigenic factor( s) . Change in predominant serotypes from year to year was common. In earlier studies ( Pathanasophon et al., 1995), serotype 1 dominated the outbreaks followed by serotypes 6, 7
and 10, while serotype 5 was not found. The proportion of R. anatipestifer isolates that reacted with more than one reference antisera was rather high ( 23.75%) in the current study. A similar phenomenon was reported by Brogden et al. ( 1982) in a study where seven antisera were used and two isolates reacted with five serotypes ( 1, 2, 5, 6 and 7) . Thus, this report documents the existence of multiple antigenic factors within a single strain of R. anatipestifer. The same phenomenon has been observed in Pasteurella multocida, especially the cultures isolated from turkeys ( Basin, 1982). Blackburn et al. ( 1975) noted that the early isolates appeared to have only one antigenic determinant, whereas further studies revealed strains with two, and one with three. Mushin ( 1979) also reported that strains of P. multocida from turkeys mostly had two, and occasionally three to five, components, and suggested that these strains may influence the production of vaccines. Thus, the components should be analysed both qualitatively and quantitatively. Since there is very little or no cross-protection against virulent strains of heterologous serotype ( Sandhu, 1979; Pathanasophon et al., 1996) , a vaccine prepared from a single antigenic factor might not protect well against infection with a strain with multiple antigenic factors. Conversely, a vaccine prepared from a strain with multiple antigenic factors might protect against infections with several serotypes that contain the homologous antigenic factors. Full characterization of these strains is therefore important. Heat-extracted antigen of strain 698/ 95 reacted only with its homologous antiserum. Thus, it is suggested that it is a new serotype of R. anatipestifer. Its identity was confirmed by RFLP of the rrs genes since Subramaniam et al. ( 1997) reported that the HaeIII restriction profile of rrs genes of all R. anatipestifer strains were identical. Based on the RFLP pattern ( Figure 1), strain 698/ 95 was identical to type strain ATCC 11845 and to reference serotype strain 1062/ 95. Additional comparison with the sequence database of 16S rRNA of R. anatipestifer indicated that strain 698/ 95 was R. anatipestifer. Although the PCR product of the 16S ribosomal DNA of strain 670/89 was identical to other strains, the HaeIII restriction profile was clearly different, suggesting that it was not R. anatipestifer. Thus, the result supports the proposal of Ryll & Hinz ( 2000) to exclude strain 670/ 89 as the reference strain for serotype 20. It is suggested, therefore, that strain 698/95 might replace strain 670/ 89 as the representative of serotype 20. Acknowledgements The authors would like to thank Dr Martin Ryll, School of Veterinary Medicine Hannover, Germany, for providing the strain HPRS 2565 of sreotype 4, Sommai Yuwapanichsampan for preparing the media and reagents throughout the experiments, and all of the Bacteriology staff of the NIAH.
270 P. Pathanasophon et al..
References Basin, J.L. ( 1982). Serological types of Pasteurella multocida isolated from turkeys and chickens in Canada. Canadian Journal of Microbiology, 28, 1078–1080. Bisgaard, M. ( 1982). Antigenic studies on Pasteurella anatipestifer, species incertae sedis, using slide and tube agglutination. Avian Pathology, 11, 341–350. Blackburn, B.O., Heddleston, K.L. & Pfow, C.J. ( 1975). Pasteurella multocida serotyping results ( 1971–1973). Avian Diseases, 19, 354–356. Brogden, K.A. ( 1989). Pasteurella anatipestifer infection. In C. Adlam & J.M. Rutter ( Eds.), Pasteurella and Pasteurellosis. ( pp. 115–129). London: Academic Press. Brogden, K.A., Rhoades, K.R., & Rimler, R. B. ( 1982). Serologic types and physiological characteristics of 46 avian cultures. Avian Diseases, 26, 891–896. Carbon, P., Ehresmann, C., Ehresmann, B. & Ebel, J.P. ( 1979). The complete nucleotide sequence of the ribosomal 16-S RNA from Escherichia coli. European Journal of Biochemistry, 100, 399–410. Corney, B.G., Colley, J., Djordjevic, S.P., Whittington, R. & Graham, G.C. ( 1993). Rapid identification of some Leptospira isolates from cattle by random amplified polymorphic DNA fingerprinting. Journal of Clinical Microbiology, 31, 2927–2932. Glunder, G. & Hinz, K.H. ( 1989). Isolation of Moraxella anatipestifer from embryonated goose eggs. Avian Pathology, 18, 351–355. Layton, H.W. & Sandhu, T.S. ( 1984). Protection of ducklings with a broth-grown Pasteurella anatipestifer bacterin. Avian Diseases, 28, 718–726. Loh, H., Teo, T.P. & Tan, H.C. ( 1992). Serotypes of Pasteurella anatipestifer isolates from ducks in Singapore: a proposal of new serotypes. Avian Pathology, 21, 453–459. Mushin, R. ( 1979). Serotyping of Pasteurella multocida isolants from poultry. Avian Diseases, 23, 608–615. Pathanasophon, P., Tanticharoenyos, T. & Morozumi T. ( 1991). Identification of Pasteurella anatipestifer by APIZYM. The Thai Journal of Veterinary Medicine, 21, 235–243. Pathanasophon, P., Tanticharoenyos, T. & Sawada, T. ( 1994). Physiological characteristics, antimicrobial susceptibility and serotypes of Pasteurella anatipestifer isolated from ducks in Thailand. Veterinary Microbiology, 39, 179–185. Pathanasophon, P., Sawada, T. & Tanticharoenyos, T. ( 1995). New serotypes of Riemerella anatipestifer isolated from ducks in Thailand. Avian Pathology, 24, 195–199. Pathanasophon, P., Sawada, T., Pramoolsinsap, T. & Tanticharoenyos, T. ( 1996). Immunogenicity of Riemerella anatipestifer broth culture bacterin and cell-free culture filtrate in ducks. Avian Pathology, 25, 705–719. Ryll, M. & Hinz, K.H. ( 2000). Exclusion of strain 670/89 as type strain for serovar 20 of Riemerella anatipestifer. Berliner und Munchener Tierarztliche Wochenschrift, 113, 65–66. Sandhu, T.S. ( 1979). Immunization of White Pekin ducklings against Pasteurella anatipestifer infection. Avian Diseases, 23, 662–669. Sandhu, T.S. ( 1991). Immunogenicity and safety of a live Pasteurella anatipestifer vaccine in White Pekin ducklings: laboratory and field trials. Avian Pathology, 20, 423–432. Sandhu, T.S. & Harry, E.G. ( 1981). Serotypes of Pasteurella anatipestifer isolated from commercial White Pekin ducks in the United States. Avian Diseases, 25, 497–502. Sandhu, T.S. & Leister, M.L. ( 1991) . Serotypes of Pasteurella anatipestifer isolated from poultry in different countries. Avian Pathology, 20, 233–239. Segers, P., Mannheim, W., Vancanneyt, M., Brandt, K., Hinz, K-H. & Kersters, K. ( 1993). Riemerella anatipestifer gen. nov., comb. nov., the causative agent of septicemia anserum exsudativa, and its phylogenetic affiliation within the Flavobacterium-/Cytophaga ribosomal-RNA homology group. International Journal of Systematic Bacteriology, 43, 768–776. Subramaniam, S., Chua, K.L., Tan, H.M., Loh, H.L. & Kuhnert, P. ( 1997). Phylogenetic position of Riemerella anatipestifer based on 16S rRNA gene sequences, International Journal of Systematic Bacteriology, 47, 562–565.
´ RESUM E´ Un s´erotype nouveau et potentiel de Riemerella anatipestifer isol´e chez le canard en Tha¨õ lande Huit souches de Riemerella anatipestifer ( R. anatipestifer) repr´esentant 71 cas de riemerellose survenus en Tha¨õ lande entre 1994 et 1999 ont e´ t´e s´erotyp´ees par la technique d’immunodiffusion en g´elose. Vingt cinq profils s´erologiques contenant un a` trois d´eterminants antig´eniques ont e´ t´e identifi´es. Les antig`enes stables a` la chaleur des organismes ont r´eagi vis-`a-vis de s´erums correspondant a` 16 s´erotypes connus et un non typable correspondant a` la souche 698/95. Le s´erotype le plus pr´evalent a sembl´e eˆ tre le s´erotype 7 suivi par les s´erotypes 5, 10, 21 et 1. Des e´ tudes compl´ementaires ont d´emontr´e que la souche non typable repr´esente probablement un nouveau s´erotype. L’analyse des g`enes rrs correspondant aux fragments de restriction de l’ADN, amplifi´es par PCR, a permis de v´erifier que la souche 698/95 e´ tait bien une souche de l’esp`ece R. anatipestifer et a confirm´e les travaux ant´erieurs excluant la souche 670/89, qui avait e´ t´e pr´ec´edemment d´esign´ee comme souche de r´ef´erence pour le s´erotype 20. Une attention doit eˆ tre prˆet´ee aux souches pr´esentant des facteurs antig´eniques multiples du fait qu’elles peuvent eˆ tre utiles a` la pr´eparation de vaccin. ZUSAMMENFASSUNG Ein potentiell neuer Serotyp von Riemerella anatipestifer, der aus Enten in Thailand isoliert wurde Achtzig Isolate von Riemerella anatipestifer, die 71 RiemerelloseAusbr¨u che in Thailand zwischen 1994 und 1999 repr¨asentierten, wurden mit dem Agargel-Pr¨azipitationstest serotypisiert. Auf der Grundlage der Pr¨azipitationsmuster wurden 25 serologische Profile identifiziert, die eine bis drei Antigendeterminanten enthielten. Thermostabile Antigene des Erregers reagierten mit Immunseren gegen 16 bekannte Serotypen und einen nicht typisierbaren Stamm 698/95. Der am h¨aufigsten vorkommende Serotyp war offenbar der Serotpy 7, gefolgt von den Serotypen 5, 10, 21 und 1. Die weitere Untersuchung zeigte, dass der nicht typisierbare Stamm wahrscheinlich einen neuen Serotyp darstellt. Die Analyse der PCR-amplifizierten rrs-Gene hinsichtlich der Restriktionsfragmentl¨angen-Polymorphismen best¨atigte die Aufnahme des Stammes 698/95 in die Spezies R. anatipestifer und bekr¨aftigten eine fr¨uhere Arbeit, die den urspr¨unglich als Referenzstamm des Serotyps 20 bestimmten Stamm 670/ 89 ausschloss. Deshalb wird vorgeschlagen, dass der Stamm 698/95 als ein Ersatz f¨ur den Referenzstamm des Serotyps 20 u¨ bernommen werden sollte. St¨ammen mit multiplen Antigenfaktoren sollte Beachtung geschenkt werden, da sie f¨ur die Herstellung von Vakzinen nu¨ tzlich sein k¨onnen. RESUMEN Un posible nuevo serotipo de Riemerella anatipestifer aislada de patos en Tailandia Se serotiparon ochenta cepas de Riemerella anatipestifer ( R. anatipestifer ) que representaban 71 brotes de riemerelosis en Tailandia entre 1994 y 1999, mediante una t´ecnica de precipitaci´on en gel de difusi´on. En base a los patrones de precipitaci´o n, se reconocieron 25 perfiles serol´o gicos que conten´õ an de uno a tres determinantes antig´enicos. Los ant´õ genos estables al calor del organismo reaccionaron con antisueros obtenidos a partir de 16 serotipos conocidos y una cepa no tipificable 698/95. El serotipo m´as prevalente result´o ser el 7, seguido de los serotipos 5, 10, 21 y 1. Estudios posteriores demostraron que la cepa no tipificable representa probablemente un nuevo serotipo. El an´alisis de los genes rrs amplificados por PCR mediante la t´ecnica de polimorfismo de la longitud de los fragmentos de restriccio´ n confirm´o la clasificaci o´ n de la cepa 698/95 en la especie R. anatipestifer y sostuvo un trabajo previo excluyendo la cepa 670/89, que originalmente fue designada como la cepa de referencia del serotipo 20. As´õ pues, se sugiere que la cepa 698/ 95 puede ser adoptada como una nueva cepa de referencia del serotipo 20. Se tiene que tener en cuenta la existencia de cepas con m´u ltiples factores antig´enicos pues pueden ser u´ tiles para la preparaci´on de vacunas.
