PROTOCOL
A protocol for efficiently retrieving and characterizing flanking sequence tags (FSTs) in Brachypodium distachyon T-DNA insertional mutants Vera Thole1, Sı´lvia C Alves1, Barbara Worland1, Michael W Bevan2 & Philippe Vain1 1Department of Crop Genetics, John Innes Centre, Norwich Research Park, Colney Lane, Norwich NR4 7UH, UK. 2Department of Cell and Developmental Biology, John
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
Innes Centre, Norwich Research Park, Colney Lane, Norwich NR4 7UH, UK. Correspondence should be addressed to P.V. (
[email protected]). Published online 9 April 2009; doi:10.1038/nprot.2009.32
Brachypodium distachyon is emerging as a new model system for bridging research into temperate cereal crops, such as wheat and barley, and for promoting research in novel biomass grasses. Here, we provide an adapter ligation PCR protocol that allows the large-scale characterization of T-DNA insertions into the genome of Brachypodium. The procedure enables the retrieval and mapping of the regions flanking the right and left borders (RB and LB) of the T-DNA inserts and consists of five steps: extraction and restriction digest of genomic DNA; ligation of an adapter to the genomic DNA; PCR amplification of the regions flanking the T-DNA insert(s) using primers specific to the adapter and the T-DNA; sequencing of the PCR products; and identification of the flanking sequence tags (FSTs) characterizing the T-DNA inserts. Analyzing the regions flanking both the LB and RB of the T-DNA inserts significantly improves FST retrieval and the frequency of mutant lines for which at least one FST can be identified. It takes approximately 16 or 10 d for a single person to analyze 96 T-DNA lines using individual or batch procedures, respectively.
INTRODUCTION Brachypodium distachyon as a model plant Over the past decade, model plant systems such as Arabidopsis thaliana and rice (Oryza sativa L.) have facilitated numerous fundamental and applied plant biological studies. The availability of genome sequences combined with mutant collections, particularly T-DNA and transposon insertion lines, has provided invaluable resources for gene cloning and analysis of gene function1,2. Rice is currently the foundation model for grass genomics. However, the biology of temperate grasses is sufficiently divergent from rice, which evolved as a semi-aquatic plant in the tropics, to require a more specific genomic and biological model3. In addition, in temperate climates, growing rice plants in large numbers is expensive, difficult and only 1–2 life cycles a year are possible4. Recently, B. distachyon has been proposed as a new model system for bridging research into wheat and barley, and for promoting research in novel biomass crops such as Miscanthus and switchgrass5. B. distachyon belongs to the Brachypodeae subfamily closely related to the Triticeae, Poeae, Bromeae and Avenae, which contain most of the temperate grasses of economic importance. The size of the B. distachyon’s genome is very small (B 275 Mb) and stands between A. thaliana (162 Mb) and rice (441 Mb)4. B. distachyon’s genome contains genes that are highly similar to wheat genes and occur in a closely similar chromosomal order6, suggesting a good synthenic relationship. B. distachyon plants have a small stature, simple growth requirements adapted to temperate environments, extensive natural variation in agronomic traits, a very rapid life cycle of less than 4 months, lack of seed head shatter, high seed set, are self-fertile and diploid inbred lines are available3,4. Genetic and physical mapping programs have been initiated by the International Brachypodium Initiative (IBI) and Bacterial Artificial Chromosome (BAC)/Expressed Sequence Tag (EST) libraries are being established. Sequencing of the community standard inbred line Bd21 genome commenced in April 2007 and the 8 shotgun sequence will be completed, assembled and annotated 650 | VOL.4 NO.5 | 2009 | NATURE PROTOCOLS
in 2009 (funded by the US Department of Energy and the UK Biotechnology and Biological Sciences Research Council). Insertional mutagenesis in plants Insertional mutagenesis is one of the most useful approaches to analyze gene function. The insertion of a genetic element, such as a T-DNA (i.e., transfer DNA from Agrobacterium) or a transposable element, into the plant genome can create a mutation and provide the means to tag the insertion7. The site of insertion can be characterized through the analysis of the junction region between the genetic element and the plant genome sequence. The plant genomic sequence flanking the insert is commonly designated as a FST. Large populations of tagged insertional mutants can be produced so that one or more insertions are available for each putative gene. In model plant species, such as A. thaliana and rice, large tagged mutant resources have been successfully developed using both T-DNA and transposon approaches7,8. In B. distachyon, the characterization of endogenous transposable elements is still in its infancy and the first mutagens to be used were T-DNAs9. Recently, in the context of the BrachyTAG program (http://www.BrachyTAG.org), efficient protocols have been established to produce T-DNA insertion plant lines for the genotype Bd21 of B. distachyon, which is the sequenced line and focus of current biological investigations9. T-DNA integration in plants Agrobacterium is frequently used to deliver foreign DNA into plant genomes. Agrobacterium can process and transfer a discrete portion of its DNA (referred to as T-DNA) flanked by two 25-bp (left and right) border repeats, into the plant nuclear genome. The T-DNA is generally present in a freely replicating plasmid in the bacterium10. In recent years, progress in the understanding of T-DNA transfer and integration into the plant genome has demonstrated that
PROTOCOL T-DNA
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
Figure 1 | Binary vector pVec8-GFP used for Agrobacterium-mediated transformation of Brachypodium. The vector pVec8-GFP16 (14,558 nt) contains two expression units within the T-DNA (5,663 nt). The first unit (represented as a white arrow) contains the sgfpS65T reporter gene driven by the maize ubiquitin1 promoter and intron1 sequence and terminated by the nopaline synthase polyA sequence. The second unit (represented as a black arrow) contains the HPT selectable marker gene (conferring resistance to hygromycin and with an in-frame CAT-1 intron) driven by the cauliflower mosaic virus 35S promoter and terminated by the nopaline synthase polyA signal. A bacterial gene for streptomycin/spectinomycin resistance (represented as a black box) is also present in the vector backbone (8,895 nt). Drawing is not to scale.
RB
LB
pVec8-GFP
Backbone
Agrobacterium can deliver a range of DNA fragments beyond the T-DNA. Plasmid backbone sequences can be transferred along with the T-DNA into the plant genome following poor processing of the resistance gene (HPT) and green fluorescent protein (GFP) gene border repeats11. Agrobacterium chromosomal sequences can also into the plant genome. pVec8-GFP was used as it enables selection be transferred in addition to the T-DNA but at a low frequency12. of genes present at both extremities of the T-DNA—GFP at the LB One or more DNA fragments can also be delivered to a single plant and HPT at the RB)—to favor the recovery of intact T-DNA inserts cell and these can integrate at one or more genetic locations in a into the Bd21 genome9. linked or unlinked manner13. Finally, rearrangements of the DNA fragments can occur during or after integration. In consequence, Regions flanking the T-DNA insert(s) the configuration and number of inserts can vary significantly The number and type of T-DNA flanking regions vary according to between independent T-DNA lines. As an example, in rice around the complexity of the insertions into the plant genome. Simple T-DNA integrations tend to allow an easy retrieval and analysis of 20% of the plants transformed using Agrobacterium contain a single T-DNA copy at one locus, 30% contain two or more T-DNA copies flanking regions, whereas complex integrations may contain many at one locus and 50% contain multiple T-DNA copies at more than flanking regions that cannot all be characterized by a single analysis. one locus14. Novel binary vectors (such as pCLEAN15) have been Examples of regions flanking the RB or LB of the T-DNA for designed to minimize the transfer of superfluous DNA into the different types of T-DNA insertion(s) are provided in Figure 2. plant genome and could improve the efficiency of large-scale Flanking regions can correspond to either B. distachyon genomic T-DNA tagging programs. Considering the potential complexity sequences (Bd21 represented as gray waves) or vector sequences of T-DNA insertion(s), FST analysis must be comprehensive (i.e., vector backbone or T-DNA). Backbone sequences can be enough to characterize all inserts into the plant genome, and adjacent to either the LB (example nos. 2 and 3) or RB following particularly those occurring at different genetic location(s) (i.e., poor processing of the border repeats (leading to backbone at different transgenic loci) as they represent putative independent transfer). T-DNA sequences can flank the LB or RB following mutations. Failure to detect a transgenic locus would result in a integration of more than one copy of the T-DNA, either with poor correspondence between genotype (tag) and phenotype. (example no. 3) or without (example nos. 4–6) rearrangements. In B. distachyon, we transformed the community standard inbred Insertion can also occur either at a single locus (example nos. 1–5) line Bd21 to maximize the possibility of positioning FSTs onto the or multiple transgenic loci (example no. 6). In some cases, two FSTs available genome sequence. The Agrobacterium strain AGL1, harbouring the pVec8GFP binary vector16 (Fig. 1), was used to No. of No. of No. of Insert(s) in the plant genome Type of flanking region loci T-DNAs flanking deliver a T-DNA containing the hygromycin Figure 2 | Examples of regions flanking the right or left border of the T-DNA for different types of inserts into the plant genome. Brachypodium Bd21 plants were transformed using the vector pVec8GFP16 (Fig. 1). Flanking regions correspond to either Bd21 genomic sequence (represented as gray waves) or vector sequence (i.e., vector backbone or T-DNA). The dotted arrows indicate the position of the flanking sequence(s) retrievable. Gray dotted arrows correspond to Bd21 genomic sequences (i.e., flanking sequence tags, FSTs) and black dotted arrows represent vector sequences (either backbone or T-DNA). a–fFSTs followed by the same letter are characterizing the same mutation (i.e., the same transgenic locus). *One of the T-DNA copies is partially deleted (i.e., the GFP expression unit is missing). Drawing is not to scale.
1.
LB
2.
RB
3.
RB
4.
LB
RB RB
5.
LB
RB LB
6.
LB
RB
RB
LB LB
regions
Outside LB
Outside RB
1
1
2
Bd21a
Bd21a
RB
1
1
2
Backbone
Bd21b
RB
1
1½*
2
Backbone
T-DNA (2 identical)
LB
1
2
3
Bd21c Bd21c
T-DNA (2 identical)
RB
1
2
4
Bd21d T-DNA
T-DNA Bd21d
2
3
5
Bd21e
Bd21e
T-DNA (2 identical)
Bd21f Bd21f
RB
LB
LB
RB
NATURE PROTOCOLS | VOL.4 NO.5 | 2009 | 651
PROTOCOL are available to characterize the same mutation (Bd21 FSTs followed by the same letter in Fig. 2). In examples nos. 1–3, insertion of T-DNA(s) has occurred at a single genomic location; however, two, one or no FSTs are available to characterize each mutation, respectively.
a
b
Bfal LB
GFP
I
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
HPT
I
RB
TDNA1 TDNA2 Seq1
AP1 AP2 Adapter
LB
AT
II
GFP
II
HPT
TA
RB
Adapter
Seq2 TDNA4 TDNA3 PCR1
Overview of the procedure Here, we describe a protocol for an adapter ligation polymerase chain reaction (PCR) procedure for B. distachyon based on previous approaches set up for A. thaliana17,18 or developed for B. distachyon by our group9. The procedure enables the retrieval and mapping of the regions flanking both the RB and LB of the T-DNA inserts, and consists of five stages, which are summarized in Figure 3. The procedure can be used for small-scale (individual analysis) or large-scale (batch analysis) identification of FSTs to allow protocol optimization or pipeline production, respectively. The protocol could also be semi-automated for high-throughput production.
Bfal
PCR2
Sequence
Adapter
FST
AP2 AP1
IIIa
IIIa
IIIb
IIIb
IV
IV
V
V
T-DNA footprint
PCR1 PCR2
Sequence
T-DNA footprint
FST
Adapter
Figure 3 | Analysis of flanking regions adjacent to the left or right border of the T-DNA. Brachypodium Bd21 plants were transformed using the vector pVec8-GFP16 (Fig. 1). In this example, the regions flanking the T-DNA correspond to Bd21 genomic sequence (gray waves) and therefore the sequences retrieved from left (a) and right (b) border analyses are flanking sequence tags (FSTs). Stage I: extraction and digestion of genomic DNA with BfaI. Stage II: ligation of BfaI adapter. Stage IIIa: PCR1 using primers specific to adapter and T-DNA (i.e., AP1+TDNA3 for LB analysis or AP1+TDNA1 for RB analysis). Stage IIIb: PCR2 using nested primer pairs (i.e., AP2+TDNA4 for LB analysis or AP2+TDNA2 for RB analysis). Stage IV: sequencing of PCR2 products (i.e., primer Seq2 for LB analysis or primer Seq1 for RB analysis). Stage V: identification of T-DNA footprint, FST and adapter sequences. The sequence of the left (5¢-GTTTACACCAC) or right (5¢-TGA) border footprint (i.e., part of the border sequence inserted into the plant genome) is boxed. Drawing is not to scale.
Stage I: extraction of genomic DNA from primary Bd21 transgenic plants and restriction digest using the BfaI enzyme. Bd21 genomic DNA is digested using the BfaI restriction enzyme that targets a 4-bp-long sequence (i.e., CTAG). BfaI was identified as a frequent cutter of the Brachypodium nuclear genome with an average restriction fragment size of less than 500 bp following restriction analysis of B. sylvaticum BACs9. We use the pVec8-GFP vector, which does not contain a BfaI site near the inner LB and RB of the T-DNA—thereby leaving sufficient sequence stretches for designing T-DNA-specific primers (Table 1). Stage II: ligation of BfaI adapter to the genomic DNA. At this stage, ligation can occur between any two DNA fragments (genomic and/or adapter) terminated by a BfaI overhang. The asymmetrical BfaI adapter was designed using a previously trialled and tested architecture17 and is composed of a short (ADP3; Table 1) and a long (ADP2; Table 1) oligonucleotide strand sharing a short
8-bp region of complementarity. The short strand renders a 5¢-TA3¢ overhang complementary to the one produced by the BfaI enzyme. The long strand serves as a template for the adapterspecific primers AP1 and AP2 (Table 1). Stage III: two rounds of PCR with primers specific to the BfaI adapter and pVec8-GFP T-DNA. This stage is designed to specifically amplify the T-DNA:flanking region:adapter fragment. The first round of PCR (stage IIIa) is conducted using primers AP1 and TDNA3 for LB analysis (Fig. 3a) or AP1 and TDNA1 for RB analysis (Fig. 3b). The second round of PCR (stage IIIb) is performed using nested primers AP2 and TDNA4 for LB analysis (Fig. 3a) or AP2 and TDNA2 for RB analysis (Fig. 3b). The sequence of the primers is detailed in Table 1 and examples of
TABLE 1 List of oligonucleotides. Name ADP2 ADP3 AP1 AP2 TDNA1 TDNA2 Seq1 TDNA3 TDNA4 Seq2
Description Used with ADP3 to generate the BfaI adapter Used with ADP2 to generate the BfaI adapter Adapter primer used with TDNA1 or TDNA3 for first round of PCR Nested adapter primer used with TDNA2 or TDNA4 for second round of PCR T-DNA primer near RB used with AP1 for first round of PCR Nested T-DNA primer near RB used with AP2 for second round of PCR Nested T-DNA primer near RB used to sequence PCR2 products T-DNA primer near LB used with AP1 for first round of PCR Nested T-DNA primer near LB used with AP2 for second round of PCR Nested T-DNA primer near LB used to sequence PCR2 products
Bold letters: sequence complementarity between the short (ADP3) and long (ADP2) oligonucleotide of the BfaI adapter.
652 | VOL.4 NO.5 | 2009 | NATURE PROTOCOLS
Sequence (5¢–3¢) CTAATACGACTCACTATAGGGCTCGAGCGGCCGGGCAGGT TAACCTGCCCAA GGATCCTAATACGACTCACTATAGGGC TATAGGGCTCGAGCGGC CTGATAGTGACCTTAGGCGA GGCTGAGTGGCTCCTTCAA GGTCATAACGTGACTCCCTTA GCAAGCTGGCATGCAAGCTT CGGCCGCATGCATAAGCTTA CGATGATAAGCTGTCAAA
PROTOCOL PCR2 product amplification from 58 independent Bd21 T-DNA plant lines are shown in Figure 4. L
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
Stage IV: sequencing of PCR2 products using primers Seq2 for LB analysis or Seq1 for RB analysis. The sequencing primers (Table 1) are located between the T-DNA specific primers, previously used in stage III, and the border repeats (Fig. 3). When more than one PCR2 product is amplified (i.e., more than one region flanking a T-DNA border is present), some sequences of flanking regions will overlap and will require to be resolved (see next section). Stage V: identification of T-DNA footprint, flanking region(s) and adapter(s). The sequence from stage IV is aligned to the sequence of the RB and LB regions of pVec8-GFP as well as to the adapter sequence. When a T-DNA footprint is identified, the sequence present between the footprint and the adapter is retrieved as a flanking region sequence. This sequence is aligned to the entire vector and Bd21 genomic sequence to determine its nature, and in the case of FSTs (i.e., Bd21 sequence) its location in the genome sequence. An example of raw PCR2 product sequence and its analysis is presented in Figure 5. Characterization of multiple flanking regions An example of characterization of regions flanking the RB of two T-DNA inserts (genetically linked or unlinked) in one plant genome is provided in Figure 6. In this example, both inserts are flanked by plant genomic sequences (i.e., FSTs). Two PCR2 products of different length are obtained, one corresponding to the region flanking insert1 and the other to the region adjacent to insert2 (Fig. 6a). The resulting sequence contains the following elements (Fig. 6b): Sequence of T-DNA footprint. The T-DNA sequence is generally common to both inserts. However, due to variation in T-DNA processing and integration, the length of the border repeat sequence present in the genome can differ between independent T-DNA inserts. Sequence of FST1 corresponding to the shortest PCR2 product. This is generally a double sequence but the FST1 sequence is dominant (i.e., higher peaks in the sequence chromatogram) due to the greater abundance of short PCR2 products containing FST1. In some cases, this can generate sufficient sequencing error to prevent the precise identification of FST1 or its anchoring to the plant genome sequence. Sequence of the first adapter ligated at the end of FST1. Sequence of FST2 corresponding to the longest PCR2 product. This is a direct reading of the sequence flanking insert2 (peaks in the sequence chromatogram have a lower intensity than the ones of the FST1 sequence). FST2 does not provide an exact genomic location of insert2 as it is separated by the FST1+adapter1 sequence from the RB. The continuity of FST2 with the TDNA can be verified by PCR using primers specific to the TDNA (i.e., TDNA1 for RB) and the FST2. Sequence of the second adapter ligated at the end of FST2. This approach can also be used for transgenic plants containing more than two T-DNA inserts to retrieve an FST3 and more rarely an FST4. In the case of three flanking regions, the combined sequence of the three PCR2 products would be: footprint:FST1: adapter1:FST2:adapter2:FST3:adapter3.
H M
Figure 4 | PCR amplification of the sequences flanking the left border of the T-DNA(s) inserted into 58 independently transformed Bd21 plant lines. Brachypodium Bd21 plants were transformed using the vector pVec8-GFP16 (Fig. 1). PCR2 products were separated by gel electrophoresis. The first lane of each row contains a molecular marker (size of bottom five bands: 200, 400, 600, 800 and 1,000 nt). Example of bands with low (L), medium (M) or high (H) fluorescence intensity are indicated.
Experimental design Adapter ligation PCR method. In the past, several strategies have been developed to identify the location of T-DNAs in large populations of A. thaliana19 or rice mutants20–22. Adapter ligation PCR methods have been particularly efficient to specifically identify the location of T-DNA insertions and the principles underlying this approach have been detailed by O’Malley23. This publication also provides information regarding the design of efficient primers and adapters for the adapter ligation PCR method. Alternative approaches to identify regions flanking T-DNA inserts include thermal asymmetric interlaced-PCR20 and inverse PCR22. Both
Figure 5 | Example of a raw PCR2 product sequence retrieved from the transgenic line BdAA1. The Brachypodium plant BdAA19 was transformed using the vector pVec8-GFP16 (Fig. 1) and the procedure to retrieve and analyze the region flanking the right border repeat (RB) of the T-DNA is described in Figure 3b. One T-DNA footprint (red), flanking region (black) and BfaI adapter (green) sequence were identified. The footprint of the RB (TGA) is highlighted in yellow. The sequence in black corresponds to a Bd21 sequence and is available as a Flanking Sequence Tag in GenBank (accession number ER987315). The sequence in bold is similar to a ferric reductase gene from Nicotiana sp. NATURE PROTOCOLS | VOL.4 NO.5 | 2009 | 653
PROTOCOL Figure 6 | Analysis of flanking regions adjacent to the right border of two T-DNA inserts (genetically linked or unlinked) into the plant genome. Brachypodium Bd21 plants were transformed with the pVec8-GFP16 vector (Fig. 1). In this example, the regions flanking the two inserts correspond to Bd21 genomic sequence (gray waves) and the sequences retrieved are flanking sequence tags (FSTs). (a) One PCR2 fragment is produced for each insert. (b) A mixture of two PCR2 products is sequenced. Dotted lines indicate the portion of each PCR2 product represented in the final sequence. Two FSTs can be identified in the sequence chromatogram: FST1 corresponding to insert1 (‘high-intensity’ peaks) and FST2 corresponding to insert2 (‘low-intensity’ peaks). Both FSTs are separated by an adapter sequence. The sequence of the right border footprint (5¢-TGA) is boxed. Drawing is not to scale.
a
TDNA1 TDNA2 Seq1
Insert1:
HPT
RB
TA
Adapter AP2 AP1
PCR1 PCR2 TDNA1 TDNA2 Seq1
Insert2:
HPT
TA
RB
Adapter AP2 AP1
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
PCR1 PCR2
strategies have proven to be effective and scalable. These methods can be implemented with crude DNA extracts but they may have a higher tendency to produce artifact PCR products and therefore may require more extensive use of controls and validation procedures (see the section below). Considerations in choosing the appropriate restriction enzyme(s). The choice of restriction enzyme to cut the nuclear genome is key for an efficient recovery of FSTs. The success of subsequent PCR amplifications is a length-dependent process; therefore, the greater the distance between the restriction site and the random T-DNA insert, the lower the chance for amplifying the flanking sequence between the T-DNA and adapter. There are advantages in using a frequent cutter such as BfaI18. It avoids the need to conduct multiple restriction digest analyses (as previously carried out in A. thaliana23 or rice21) with enzymes that have 6-bplong recognition sites and that cut the plant genomes less frequently (every 2,000–4,000 bp). The time and effort saved using a single restriction digest can be used to analyze the regions flanking both borders of the T-DNA to enhance the likelihood of identifying FSTs from a complex transgenic locus (i.e., locus containing more than one T-DNA copy). ‘One enzyme–two border’ strategy. Generating a pipeline for efficient and economical generation of FSTs characterizing all transgenic loci in the plant genome (i.e., putative mutations) is key to reverse genetic approaches using T-DNAs as mutagens. This can be hampered by the fact that multiple T-DNA integrations (at linked or unlinked genetic locations; Fig. 2) can occur very frequently13. Therefore, protocols must maximize the ability to identify at least one plant genomic FST for each transgenic locus. Unfortunately, there is a limit to the number of T-DNA flanking regions that can be adequately described using a single analysis. One sequence (Fig. 6b) can satisfactorily characterize two, sometimes three and rarely four different PCR2 products (Fig. 6a) some of which can be vector sequence(s) (i.e., in the case of T-DNA rearrangement(s) or vector backbone transfer). In addition, short PCR2 products (corresponding to short flanking sequences) are generally over-represented, and can mask PCR amplification of other flanking regions, especially those characterized by a restriction site more distant to the T-DNA border. In the past, this has generally been addressed by conducting multiple analyses, involving either different restriction enzymes21,23 or adapter designs18, but rarely through the concomitant analysis of the regions flanking both T-DNA borders. The ‘one enzyme–two border’ approach
654 | VOL.4 NO.5 | 2009 | NATURE PROTOCOLS
b
Single sequence covering both PCR2 products
T-DNA footprint
FST1 (insert1)
First adapter
FST2 (insert2)
Second adapter
developed here, can minimize failure of PCR amplification (when using a 6-bp low-frequency cutting enzyme) or the retrieval of identical FSTs (when analyzing the same border region with different restriction enzymes by the ‘multiple enzymes–one border’ approach). It can also promote the retrieval of plant genomic FSTs when one of the borders is neighbored by vector sequence (i.e., following head-to-head or tandem insertion, T-DNA rearrangements or partial backbone transfer; Fig. 2). Finally, it can provide confirmatory information by anchoring both sides of a single TDNA insert into the plant genome. This combined information on both sides of the T-DNA is particularly useful to position the insert at a unique genome location (i.e., when one of the FSTs is homologous to multiple genomic locations and cannot be precisely located). Controls and validation of FSTs. Initially, the efficiency and accuracy of the protocol were assessed using a wild-type Bd21 plant and a previously characterized Bd21 T-DNA line9. The former control was used to confirm that the protocol did not produce artifact PCR bands. The latter control evaluated the ability to retrieve FSTs. When batch analysis is undertaken, negative and positive controls (i.e., leaf sample from a wild-type and a known T-DNA line, respectively) are included in 96-well plates. It is also important to validate the T-DNA:FST junction sequence, particularly for FST2, FST3 or FST4 sequences (Fig. 6). The continuity of FSTs with the T-DNA is verified by PCR using primers specific to the T-DNA (i.e., TDNA1 for RB and TDNA3 for LB) and the particular FST. It is advisable to validate all the FSTs retrieved from the first 96 samples to determine the percentage of artifactual FSTs, if any. Multiple independent analyses of a given T-DNA line using BfaI as well as other enzymes producing compatible ends (i.e., 5¢TA-3¢ overhang) such as NdeI, or AseI, are also useful to assess the robustness of the protocol.
PROTOCOL
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
MATERIALS REAGENTS m CRITICAL Risk (R) and Safety (S) codes and statements of dangerous substances are provided based on the European Union Commission Directive 2001/59/EC. m CRITICAL Reagents stored at 20 1C are kept up to 1 year unless indicated otherwise. . Primary (T0) transgenic B. distachyon plants (genotype Bd21)9 . Agarose (e.g., SeaKem LE agarose; Cambrex Bio Science, cat. no. 50004) . Ethidium bromide, 10 mg ml1 (e.g., Bio-Rad, cat. no. 161-0433) ! CAUTION Mutagen and toxic substance that is irritating to eyes, respiratory system and skin and toxic by inhalation. R21/22, R23, R26, R40, R46, S20, S36/37/39, S44, 53, S45, S60. . Tris-borate-EDTA buffer (TBE 10; Severn Biotech Ltd, cat. no. 20-6000-10) contains 0.89 M Tris-base, 0.89 M boric acid, 0.025 M EDTA, pH 8 ! CAUTION Irritant substance, avoid inhalation, contact to skin and eyes. R36/37/38, S26,36. . Sterile ultrapure H2O . Ethanol ! CAUTION Flammable substance. R10, S16. . Restriction enzyme BfaI (50 U ml1; New England Biolabs, cat. no. R0568L) m CRITICAL Store stock at 80 1C and working tube at 20 1C for up to 3 months. . NEBuffer 4 (10; New England Biolabs, cat. no. B7004S). Store at 20 1C. . Adenosine triphosphate (ATP 100 mM; GE Healthcare UK Ltd, cat. no. 27-2056-01). Store at 20 1C. m CRITICAL Aliquot for 96 samples. Do not unthaw/freeze ATP solutions repeatedly. . Bovine serum albumin (BSA 10 mg ml1; New England Biolabs, cat. no. B9001S). Store at 20 1C. ! CAUTION Corrosive substance that will seriously damage or destroy living tissue on contact. R34-37, S26-36/37/39-45. . T4 DNA ligase (400 cohesive end units per ml; New England Biolabs, cat. no. M0202S). Store at 20 1C. . dNTPs (100 mM stock solutions; GE Healthcare UK Ltd, cat. no. 28-4065-51). Store at 20 1C. . Oligonucleotide stock solutions (see REAGENT SETUP and Table 1 for list). Store at 20 1C. . Taq DNA polymerase (5 U ml1; e.g., GE Healthcare UK Ltd, cat. no. 27-0799-06). Store at 20 1C. ! CAUTION Hazardous substance that is irritating to eyes, respiratory system and skin. R36/37/38. . Taq DNA polymerase reaction buffer (10). Store at 20 1C. ! CAUTION Irritant substance, avoid contact with skin or eyes. R36/38, S24/25. . DNA ladder (1 mg per 5 ml; e.g., HyperLadderI; BIOLINE, cat. no. BIO-33053). Store stock at 20 1C and working aliquot at 4 1C. . Lambda DNA (0.5 mg ml1; e.g., Invitrogen, cat. no. 25250-010). Store at 20 1C. . BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, cat. no. 4337456). Store 5 BigDye buffer at 4 1C and BigDye Terminator v3.1 Ready Reaction Mix at 20 1C. Safety information on 57 components of the kit is available online at http://www.edgebio.com/ techinfo/msds.php. . DTR V3 96-Well Short Plate Kit (Performa) . Reagents specific to individual sample analysis: . Liquid nitrogen ! CAUTION Refrigerated liquified gas that may cause cold burns, frostbite or asphyxiation. Avoid contact by inhalation, eyes and skin. . Pestle and mortar . DNeasy Plant Mini Kit (Qiagen, cat. no. 69106). Safety information on kit components is available at http://www1.qiagen.com/Support/Msds.aspx. R42/43, R22-36/38, R36/38, S13-26-36-46, S23-24-26-36/37. . Nucleospin Plant II Kit (Macherey-Nagel, cat. no. 740770.50). Safety information on three kit components is available at http:// www.macherey-nagel.com/tabid/1484/default.aspx. R10-22-36/38, R42/43, S7-16, S7-16-25, S22-24.
. Reagents specific to batch sample analysis: . DNeasy 96 Plant Kit (Qiagen, cat. no. 69181). Safety information on kit components is available at http://www1.qiagen.com/Support/Msds.aspx. R42/43, R22-36/38, R36/38, S13-26-36-46, S23-24-26-36/37. EQUIPMENT . Horizontal gel electrophoresis equipment (e.g., gel tank system with power supply) . Fridge (4 1C) and freezers (80 and 20 1C) . Gel-doc system with Multi-Analyst software (Bio-Rad) for gel analysis or UV box . 96-well plates . Vortex . Thermocycler (e.g., Biometra T3) . MicroAmp optical 96-well reaction plate with barcode and seal film (Applied Biosystems) . 3730xl DN analyser (Applied Biosystems) . Micro-pipettes (single and multi-channels) and corresponding tips . Autoclave . Precision balance . Glassware (e.g., 1 l glass beaker) . Microfuge tubes (1.5 and 2 ml) . Hot magnetic stirring plate . Magnetic stirrer . Spectrophotometer and cuvettes . Equipment specific to individual sample analysis: . 2-ml screw cap microfuge tube (with a pierced cap) . Table-top microfuge (maximum 2,000g; e.g., FugeOne; Starlab) . Table-top centrifuge (maximum 16,000g; e.g., Eppendorf 5415D) . Strips of 200 ml tubes and caps (ABgene, cat. no. AB-0266) . Equipment specific to batch sample analysis: . Retsch MM300 mixer mill . Centrifuge with rotor accommodating 96-well plates REAGENT SETUP m CRITICAL All stock solutions are kept at 4 1C up to 3 months and at 20 1C up to 1 year unless stated otherwise. Preparation of 103 stock solution of BfaI adapter Prepare the BfaI adapter by annealing the ADP2 and ADP3 oligonucleotides sharing 8-bp sequence complementarity (Table 1). Add 12.5 ml of ADP2 oligonucleotide (200 mM in sterile ultrapure H2O), 12.5 ml of ADP3 oligonucleotide (200 mM in sterile ultrapure H2O), 10 ml of NEBuffer 4 (10) and 64 ml of H2O to a 1.5-ml microfuge tube. Incubate tube for 2 min in 0.5 l of water at 95 1C in a glass beaker placed on a hot plate with a magnetic stirrer. Cool to 22 1C over a period of 45 min by stirring and regularly adding ice to the water every 5 min. Store at 20 1C. Preparation of dNTP stock solution Add 22 ml of dATP (100 mM), 22 ml of dGTP (100 mM), 22 ml of dCTP (100 mM), 22 ml of dTTP (100 mM) and 1,012 ml of sterile ultrapure H2O to make 2 mM of stock solution (this stock enables the analysis of two batches of 96 samples). Store at 20 1C. Preparation of BSA stock solution Add 45 ml of BSA (10 mg ml1) to 55 ml of sterile ultrapure H2O to make a 4.5 mg ml1 of stock solution (this stock enables the analysis of six batches of 96 samples). Store at 20 1C. Preparation of 200 and 10 lM primer stock solutions Prepare 200 mM of stock solutions by diluting each primer (see Table 1) in sterile ultrapure H2O based on the yield values provided by the oligonucleotide manufacturer. Add 60 ml of 200 mM stock solution to 1,140 ml of sterile ultrapure H2O to make 10 mM of stock solution (each tube enables the analysis of six batches of 96 samples). Store at 20 1C. Preparation of 2 lM Seq1 or Seq2 oligonucleotide stock solutions Prepare 200 mM stock solution as described above. Check oligonucleotide concentration using a spectrophotometer at l¼260 nm. Dilute to 2 mM using sterile ultrapure H2O based on the spectrophotometer reading. Store at 20 1C.
PROCEDURE Extraction of plant genomic DNA 1| Extract genomic DNA using option A or B depending on whether the samples are processed individually or by batches of 96 samples, respectively. m CRITICAL STEP Genomic DNA samples extracted individually are often five times (or more) concentrated and of better quality than those from batch extraction. NATURE PROTOCOLS | VOL.4 NO.5 | 2009 | 655
PROTOCOL
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
(A) Processing individual samples TIMING 23 h for 96 individual samples (i) Collect leaf samples from 1-month-old potted T-DNA insertion Brachypodium plants. Plants are primary (T0) transgenic plants (genotype Bd21) produced through Agrobacterium-mediated transformation as described previously9. Collect the equivalent of five-tube lengths of leaf material (100 mg of fresh weight) in a sterile 2-ml screw cap microfuge tube (with a pierced cap). m CRITICAL STEP Pierce the cap to prevent high gas pressure in the tube when subsequently frozen in liquid nitrogen. (ii) Freeze samples by immersing the tubes in liquid nitrogen. ! CAUTION Liquid nitrogen: avoid contact with skin and eyes. ’ PAUSE POINT Leaf samples can be stored for more than 1 year at 80 1C. This enables seed production from T0 plants to take place (approximately 2 months) and molecular analysis to be undertaken only on fertile plants producing seeds. (iii) Grind leaf samples to a fine powder using a pestle and mortar previously chilled with liquid nitrogen. Collect the powder in the original microfuge tube. ’ PAUSE POINT Leaf powder can be stored for more than 1 year at 80 1C. (iv) Extract genomic DNA using the Qiagen DNeasy Plant Mini Kit according to the manufacturer’s specifications with the following modification: at the last step elute the DNA twice from each column with 75 ml of buffer AE to maximize DNA recovery. Perform also the recommended centrifugation step after chilling at 4 1C to precipitate detergent, proteins and polysaccharides. m CRITICAL STEP When using the Macherey-Nagel Nucleospin Plant II Kit, cell lysis buffer PL2 is more efficient for Brachypodium genomic DNA extraction than cell lysis buffer PL1. ’ PAUSE POINT Genomic DNA can be stored for several weeks at 4 1C (to prevent damage through repeated cycles of freezing and thawing) or more than a year at 20 1C. (B) Processing batches of 96 samples TIMING 8 h for a batch of 96 samples (i) Collect leaf samples from 1-month-old Bd21 (T0) transgenic plants produced through Agrobacterium-mediated transformation9. The equivalent of 1.5-tube lengths of leaf sample (50 mg of fresh weight) is placed in a dedicated collection microtube of the Qiagen DNeasy 96 Plant Kit and stored in a 80 1C freezer. m CRITICAL STEP Include negative and positive controls (i.e., leaf sample from a wild-type and a characterized B. distachyon T-DNA line, respectively) to each 96-well plate when undertaking batch analysis. ’ PAUSE POINT Samples can be stored in a 80 1C freezer for more than 1 year. (ii) Disrupt leaf samples in microtube racks using tungsten carbide beads and a Retsch MM300 mixer mill according to the manufacturer’s specifications. ’ PAUSE POINT Leaf powder can be stored for more than 1 year at 80 1C. (iii) Extract genomic DNA using the Qiagen DNeasy 96 Plant Kit according to the manufacturer’s specifications with the following modification: at the last step elute the DNA only once from the column with 50 ml of buffer AE to increase the final DNA concentration. ’ PAUSE POINT Genomic DNA can be stored for several weeks at 4 1C or more than 1 year at 20 1C.
2| Check genomic DNA quality and concentration by loading 3 ml of each DNA sample onto a 1–1.2% (wt/vol) agarose gel (in 0.5 TBE) containing ethidium bromide (5 ml in a 100 ml gel) and subject to electrophoresis at 80–100 V for 30 min. Examine gel under UV light and compare the fluorescent signal of plant DNA to a serial dilution of commercially titrated DNA (such as 12.5, 25, 50 and 75 ng of lambda DNA loaded on each row). ! CAUTION Ethidium bromide is mutagen and toxic. ? TROUBLESHOOTING
Digestion of genomic DNA TIMING 4.5 h 3| Transfer 10 ml of plant genomic DNA (up to 100 ng) to a fresh tube/well. Use strips of 200 ml microfuge tubes for small-scale analysis or 96-well plates for batch analysis. 4| Digest genomic DNA with BfaI by mixing 10 ml of each genomic DNA sample (from Step 3) with 10 ml of a mixture containing H2O, NEBuffer 4 and BfaI in the proportions indicated in the table below. The mixture is generally prepared as a master mix for all samples to be digested. m CRITICAL STEP Prepare a larger volume of master mix than the total volume required for all samples to accommodate pipetting errors or enabling use of multichannel micro-pipettes. m CRITICAL STEP Gently flick the tubes/plates by hand and pulse spin the samples to mix and collect liquid at the bottom of each tube/well.
656 | VOL.4 NO.5 | 2009 | NATURE PROTOCOLS
PROTOCOL Components
Amount per tube/well (ll)
Final (in 20 ll)
10 7.5 2 0.5
Up to 100 ng
DNA sample Ultrapure H2O NEBuffer 4 (10) BfaI (5 U ml1)
1 2.5 U
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
5| Incubate samples (from Step 4) at 37 1C for 3 h. m CRITICAL STEP Incubation in a thermocycler with a heated lid prevents evaporation and condensation on the top of tubes/wells. Alternatively, samples can be incubated in an oven. 6| Inactivate BfaI at 65 1C for 20 min. m CRITICAL STEP Incubation in a thermocycler with a heated lid prevents evaporation and condensation on the top of tubes/wells. ’ PAUSE POINT Samples can be stored for several weeks at 4 1C or long-term storage at 20 1C; however, digestion and ligation are generally conducted the same day.
Ligation of adapter TIMING 18 h 7| Prepare the BfaI adapter solution as detailed in REAGENT SETUP. 8| Ligate the BfaI adapter to the digested genomic DNA by mixing 20 ml of each digested DNA sample (from Step 6) with 5 ml of a mixture containing H2O, NEBuffer 4, ATP, BSA, BfaI adapter and T4 DNA ligase in the proportions indicated in the table below. The mixture is generally prepared as a master mix for all samples. m CRITICAL STEP Prepare more master mix than the total volume required. m CRITICAL STEP Gently flick the tubes/plates by hand and pulse spin the samples to mix and collect liquid at the bottom of each tube/well. Components
Amount per tube/well (ll)
Final (in 25 ll)
20 3 0.5 0.2 0.14 1 0.16
Up to 100 ng
Digested DNA Ultrapure H2O NEBuffer 4 (10) ATP (100 mM) BSA (4.5 mg ml1) BfaI adapter T4 DNA ligase (6 Weiss U ml1)a a1
1 2.5 U 25 mg ml1 1 mM 1 Weiss U
cohesive end unit (New England Biolabs) ¼ 0.015 Weiss unit.
9| Incubate samples (from Step 8) overnight at room temperature (20–25 1C). 10| Inactivate T4 DNA ligase by incubating samples at 65 1C for 10 min. m CRITICAL STEP Incubation in a thermocycler with a heated lid prevents evaporation and condensation on the top of tubes/wells. ’ PAUSE POINT Samples can be stored for several weeks at 4 1C. Long-term storage at 20 1C is possible.
PCR amplification of the regions flanking the RB or LB of the T-DNA insert(s) TIMING 9 h for each border analysis 11| Transfer 7 ml of adapter-ligated genomic DNA from Step 10 to a fresh tube/well. 12| Add to each adapter-ligated DNA sample (7 ml from Step 11), 43 ml of a mixture containing H2O, Taq DNA polymerase buffer, dNTPs, primers and Taq DNA polymerase in the proportions indicated in the table below. The mixture is generally prepared as a master mix for all samples. To PCR-amplify the regions flanking the RB of the T-DNA insert, use the AP1 and TDNA1 primers (Fig. 3b). To amplify the regions flanking the LB of the T-DNA insert, use the AP1 and TDNA3 primers (Fig. 3a). The reactions for RB and LB can be set up in parallel or in sequence, depending on the number of samples and availability of equipment. m CRITICAL STEP Prepare more master mix than the total volume required. Components Adapter-ligated DNA Ultrapure H2O Taq DNA polymerase buffer (10) dNTPs (2 mM) AP1 primer (10 mM) TDNA1 (RB) or TDNA3 (LB) primer (10 mM) Taq DNA polymerase (5 U ml1)
Amount per tube/well (ll)
Final (in 50 ll)
7 28.8 5 5 2 2 0.2
Up to 30 ng 1 250 mM 0.4 mM 0.4 mM 1U NATURE PROTOCOLS | VOL.4 NO.5 | 2009 | 657
PROTOCOL 13| PCR-amplify the T-DNA flanking regions using a thermocycler and the following cycle conditions: Cycle number 1 2–31 32 33
Denature
Anneal
Extend
Hold
94 1C, 2 min 94 1C, 30 s — —
— 60 1C, 45 s — —
— 72 1C, 2 min 30 s 72 1C, 10 min —
— — — 10 1C
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
14| Transfer 1 ml of PCR1 reaction from Step 13 to a fresh tube/well. 15| Add to each PCR1 product (1 ml from Step 14), 49 ml of a mixture containing H2O, Taq DNA polymerase buffer, dNTPs, primers and Taq DNA polymerase in the proportions indicated in the table below. The mixture is generally prepared as a master mix for all samples. To PCR-amplify the regions flanking the RB of the T-DNA insert, use the AP2 and TDNA2 nested primers (Fig. 3b). To amplify the regions flanking the LB of the T-DNA insert, use the AP2 and TDNA4 nested primers (Fig. 3a). The reactions for RB and LB can be set up in parallel or in sequence. m CRITICAL STEP Prepare more master mix than the total volume required. Component
Amount per tube/well (ll)
Final (in 50 ll)
1 34.8 5 5 2 2 0.2
1 250 mM 0.4 mM 0.4 mM 1U
PCR1 product Ultrapure H2O Taq DNA polymerase buffer (10) dNTPs (2 mM) AP2 primer (10 mM) TDNA2 (RB) or TDNA4 (LB) primer (10 mM) Taq DNA polymerase (5 U ml1)
16| PCR-amplify using a thermocycler and the following cycle conditions: Cycle number 1 2–31 32 33
Denature
Anneal
Extend
Hold
94 1C, 2 min 94 1C, 30 s — —
— 62 1C, 45 s — —
— 72 1C, 2 min 30 s 72 1C, 10 min —
— — — 10 1C
17| To check the number and concentration of PCR2 products, load 4 ml of each PCR reaction from Step 16 onto a 1–1.2% (wt/vol) agarose gel (in 0.5 TBE) containing ethidium bromide (5 ml in a 100 ml gel) and subject to electrophoresis at 80–100 V for 30 min. Load a DNA ladder in the first lane of each row. Examine the gel under UV light using Gel-doc system with Multi-Analyst software. For each sample, record the number of bands, as well as their intensity. Example of bands with low (L), medium (M) or high (H) fluorescence intensity is shown in Figure 4. ! CAUTION Ethidium bromide is toxic and a mutagen. ? TROUBLESHOOTING
Sequencing of the regions flanking the RB or LB of the T-DNA insert(s) TIMING 5 h for each border 18| To sequence the region flanking the RB or LB of the T-DNA insert, set up the following reactions using the Seq1 or Seq2 primer, respectively. The reactions for the RB and LB can be set up in parallel or in sequence. Transfer approximately 250 ng of PCR2 product from Step 16 to a fresh tube/well in a final volume of 5.3 ml. The volume of PCR2 product to be used can be estimated based on the intensity of the signals observed in Step 17 and using the following guidelines.
PCR2 band(s) intensity
Amount PCR2 product per tube/well (ll)
Amount of ultrapure H2O per tube/well (ll)
5.3 3 2
0 2.3 3.3
Low Medium High
658 | VOL.4 NO.5 | 2009 | NATURE PROTOCOLS
PROTOCOL 19| Sequence with Applied Biosystems BigDye Terminator v3.1 Cycle Sequencing Kit according to the manufacturer’s specifications. Mix 5.3 ml of each PCR2 product (from Step 18), 1.5 ml BigDye buffer, 2.2 ml primer and 1 ml BigDye Terminator v3.1 Ready Reaction Mix as indicated in the table below. Components
Amount per tube/well (ll)
Final (in 10 ll)
5.3 1.5 2.2 1
0.75 0.44 mM
PCR2 product and H2O BigDye buffer (5) Seq1 (RB) or Seq2 (LB) primer (2 mM) BigDye Terminator v3.1 Ready Reaction Mix
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
20| Run the sequencing reactions using a thermocycler and the following conditions: Cycle number 1 2–26 27 28
Denature
Anneal
Extend
Hold
96 1C, 1 min 96 1C, 10 s — —
— 50 1C, 5 s — —
— 60 1C, 4 min — —
— — 4 1C, 10 min 10 1C
21| Purify extension products from Step 20 using Performa DTR V3 96-Well Short Plate Kit according to the manufacturer’s instructions. 22| Collect samples from Step 21 to an Applied Biosystems MicroAmp optical 96-well reaction plate with barcode and seal with film using a heat sealer. 23| Sequence the samples from Step 22 on an Applied Biosystems 3730xl DNA analyser, 96 capillary, 50 cm array using pop7 according to the manufacturer’s instructions.
Sequence analysis and identification of FSTs TIMING 35 h (96 individual analyses) or 4 h (batch analysis of 96 samples) 24| Identify sequence corresponding to T-DNA footprint (which can include part of the border repeat), flanking region and BfaI adapter (Fig. 5). m CRITICAL STEP Eliminate sequences without a T-DNA footprint as they could be artifactual PCR products. When multiple T-DNA insertions are present in the nuclear genome (at the same or different transgenic loci), the sequence of the different flanking regions will be separated by an adapter sequence and partially overlap (Fig. 6b). 25| Analyze sequence of flanking regions using a BLASTn search routine against sequences of the binary vector(s), the Bd21 genomic sequence assemblies and all other existing sequences in online databases (e.g., GenBank, EMBL). Set the BLASTn expect score cutoff at 105. m CRITICAL STEP Classify the flanking sequences as (i) not utilizable sequence (low quality, less than 30 bp long or without homology to any known sequence), (ii) vector sequence (e.g., pVec8-GFP) and (iii) B. distachyon genomic sequence. The last category (iii) represents FSTs used to characterize insertional mutations. m CRITICAL STEP BLASTn search efficiency depends on the length of the queried sequence. Increase the value of the expect score cutoff when using sequences less than 55 nt long (e.g., e ¼ 104 for 50-nt-long sequences and e ¼ 103 for 46-nt-long sequences). ? TROUBLESHOOTING
Comparison of the regions flanking the RB and LB of the T-DNA insert(s) in individual plant lines TIMING 15 h for 96 lines 26| Compare the genomic location of FSTs adjacent to the RB and LB retrieved from individual plant lines. In the case of a single and intact T-DNA insert, FSTs at the LB and RB are continuous sequences. This informs on potential modifications of the Bd21 genome due to the insertion and helps to anchor the T-DNA insert to a unique genome location (especially when one of the FSTs exhibits homology with multiple genomic locations and therefore cannot be precisely located).
TIMING The values below correspond to the analysis of 96 samples by a single operator. Steps 1 and 2, extraction of plant genomic DNA: 23 h (96 individual samples) or 8 h (batch of 96 samples) Steps 3–6, digestion of genomic DNA: 4.5 h Steps 7–10, ligation of adapter: 18 h Steps 11–17, PCR amplification of the regions flanking the RB or LB of the T-DNA insert(s): 9 h for each border Steps 18–23, sequencing of the regions flanking the RB or LB of the T-DNA insert(s): 5 h for each border Steps 24 and 25, sequence analysis and identification of FSTs: 35 h (96 individual analyses) or 4 h (batch analysis of 96 samples using dedicated bioinformatics tools) Step 26, comparison of the regions flanking the RB and LB of the T-DNA insert(s) in individual plant lines: 15 h for 96 lines NATURE PROTOCOLS | VOL.4 NO.5 | 2009 | 659
PROTOCOL ? TROUBLESHOOTING Troubleshooting advice can be found in Table 2.
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
TABLE 2 Troubleshooting. Step Step 2
Problem DNA concentrations are much lower than 10 ng ml1 when using batch DNA extraction kits
Possible reason Insufficient disruption of plant leaf tissue prior to DNA extraction when using kit(s). Presence of impurities in the DNA sample
Solution The protocol can work with DNA concentrations as low as 1–2 ng ml1 (i.e., 10–20 ng total DNA). However, this reduces the probability of a successful ligation between the T-DNA flanking regions and the adapter. Eluting DNA from the kit columns using less buffer volume (as suggested on Step 1B(iii)) will help to increase DNA concentration. Use leaf material from young plants. In other cereals, such as rice, plants can be placed for a few days in the dark before leaf sampling to limit the presence of polysaccharides and/or polyphenols in the DNA extraction mixture
Step 17
No PCR2 product was obtained
Problem with DNA preparation, ligation of adaptor or PCR reactions
Expect a PCR2 product for approximately 87 and 96% of the lines following analysis of one and two T-DNA border regions, respectively. If less than 75% of the plant lines produce a PCR2 product, test the reagents on a previously analysed set of 48 lines (using the protocol for individual samples). If no PCR2 product is obtained at all (including for the positive control), renew and test the stock solutions of BfaI adapter and/or oligonucleotides. Stocks of BfaI enzyme must also be kept at 80 1C
Step 25
No FST homologous to Bd21 sequence is available for a T-DNA line
Junction sequence between the border repeats and Bd21 genome are either not present (rearrangement and/or backbone transfer) or cannot be detected (incomplete analysis)
In some cases, only flanking regions homologous to vector sequence or not homologous to any known sequence will be identified for a transgenic plant. If it is economically feasible, further analyses can be undertaken to identify T-DNA flanking regions using other restriction enzymes (NdeI and AseI) with different cutting frequencies but with compatible cohesive ends to the BfaI adapter. Other enzyme/adapter combinations previously tested in B. distachyon can also be used9
ANTICIPATED RESULTS In the context of the BrachyTAG program (http://www.BrachyTAG.org), this protocol has been used to analyze an initial population of 1,000 individual insertion mutants of the community standard line Bd21 transformed with the vector pVec8-GFP9. Initially, the ‘single-border’ versus a ‘two-border’ analysis has been compared using a batch of 286 independent plant lines (see Table 3). This demonstrated that analyzing the regions flanking both borders of the T-DNA significantly improves the proportion of T-DNA TABLE 3 Comparison of ‘single-border’ and ‘two-border’ analysis in a population of 286 independent plant lines. Analysis of flanking regions Number (%) of lines with Bd21 FST Total number of Bd21 FSTs Left border (LB), right border (RB).
660 | VOL.4 NO.5 | 2009 | NATURE PROTOCOLS
LB only 165 (58%) 196
RB only 151 (53%) 179
LB+RB 214 (75%) 375
PROTOCOL
© 2009 Nature Publishing Group http://www.nature.com/natureprotocols
lines for which a genome hit (i.e., Bd21 FST) can be recovered (from 53–58 to 75% of the lines). Two-border analysis also nearly doubles (from 179–196 to 375) the number of Bd21 FSTs available to describe the different T-DNA inserts present in the population of 286 plant lines. Approximately 70% of these new FSTs describe a unique insertion into the genome that was not detected through the first border analysis, thereby significantly increasing the chances of characterizing independent transgenic loci. A total of 894 flanking sequences were identified from the 286 lines studied (on average 3.1 sequences per line). In total, 11% (106) corresponded to non-usable sequence (poor quality, less than 30 bp, no T-DNA footprint), 19% (166) to unknown sequences, 28% (247) to vector sequence (pVec8-GFP), and 42% (375) to Bd21 sequence (on average 1.3 FST per line). It is anticipated that FST identification will improve further when the fully annotated genome sequence of Bd21 is available (i.e., some flanking sequences currently unknown will be identified as Bd21 sequences).
ACKNOWLEDGMENTS This study was supported by the UK Biotechnology and Biological Sciences Research Council (BBSRC) and through a Short-Term Marie Curie EST fellowship. Published online at http://www.natureprotocols.com/ Reprints and permissions information is available online at http://npg.nature.com/ reprintsandpermissions/ 1. Hirochika, H. et al. Rice mutant resources for gene discovery. Plant Mol. Biol. 54, 325–334 (2004). 2. Meinke, D., Muralla, R., Sweeney, C. & Dickerman, A. Identifying essential genes in Arabidopsis thaliana. Trends Plant Sci. 13, 483–491 (2008). 3. Garvin, D.F. et al. Development of genetic and genomic research resources for Brachypodium distachyon, a new model system for grass crop research. Crop Sci. 48, S69–S84 (2008). 4. Opanowicz, M., Vain, P., Draper, J., Parker, D. & Doonan, J.H. Brachypodium distachyon: making hay with a wild grass. Trends Plant Sci. 13, 172–177 (2008). 5. Draper, J. et al. Brachypodium distachyon. A new model system for functional genomics in grasses. Plant Physiol. 127, 1539–1555 (2001). 6. Griffiths, S. et al. Molecular characterization of Ph1 as a major chromosome pairing locus in polyploid wheat. Nature 439, 749–752 (2006). 7. Springer, P.S. Gene traps: tools for plant development and genomics. Plant Cell 12, 1007–1020 (2000). 8. Jung, K.H., An, G.H. & Ronald, P.C. Towards a better bowl of rice: assigning function to tens of thousands of rice genes. Nat. Rev. Genet. 9, 91–101 (2008). 9. Vain, P. et al. Agrobacterium-mediated transformation of the temperate grass Brachypodium distachyon (genotype Bd21) for T-DNA insertional mutagenesis. Plant Biotechnol. J. 6, 236–245 (2008). 10. Gelvin, S.B. Agobacterium-mediated plant transformation: the biology behind the ‘gene-Jockeying’ tool. Microbiol. Mol. Biol. Rev. 67, 16–37 (2003). 11. Martineau, B., Voelker, T.A. & Sanders, R.A. On defining T-DNA. Plant Cell 6, 1032–1033 (1994).
12. Ulker, B. et al. T-DNA-mediated transfer of Agrobacterium tumefaciens chromosomal DNA into plants. Nat. Biotechnol. 26, 1015–1017 (2008). 13. Afolabi, A.S., Worland, B., Snape, J.W. & Vain, P. A large-scale study of rice plants transformed with different T-DNAs provides new insights into locus composition and T-DNA linkage configurations. Theor. Appl. Genet. 109, 815–826 (2004). 14. Vain, P., Afolabi, A.S., Worland, B. & Snape, J.W. Transgene behaviour in populations of rice plants transformed using a new dual binary vector system: pGreen/pSoup. Theor. Appl. Genet. 107, 210–217 (2003). 15. Thole, V., Worland, B., Snape, J.W. & Vain, P. The pCLEAN dual binary vector system for Agrobacterium-mediated plant transformation. Plant Physiol. 145, 1211–1219 (2007). 16. Murray, F., Brettell, R., Matthews, P., Bishop, D. & Jacobsen, J. Comparison of Agrobacterium-mediated transformation of four barley cultivars using the GFP and GUS reporter genes. Plant Cell Rep. 22, 397–402 (2004). 17. Spertini, D., Beliveau, C. & Bellemare, G. Screening of transgenic plants by amplification of unknown genomic DNA flanking T-DNA. Biotechniques 27, 308–314 (1999). 18. Strizhov, N. et al. High-throughput generation of sequence indexes from T-DNA mutagenized Arabidopsis thaliana lines. Biotechniques 35, 1164–1168 (2003). 19. Alonso, J.M. et al. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301, 653–657 (2003). 20. Jeon, J.S. et al. T-DNA insertional mutagenesis for functional genomics in rice. Plant J. 22, 561–570 (2000). 21. Sallaud, C. et al. Highly efficient production and characterization of T-DNA plants for rice (Oryza sativa L.) functional genomics. Theor. Appl. Genet. 106, 1396–1408 (2003). 22. Jeong, D.H. et al. Generation of a flanking sequence-tag database for activationtagging lines in japonica rice. Plant J. 45, 123–132 (2006). 23. O’Malley, R.C., Alonso, J.M., Kim, C.J., Leisse, T.J. & Ecker, J.R. An adapter ligation-mediated PCR method for high-throughput mapping of T-DNA inserts in the Arabidopsis genome. Nat. Protoc. 2, 2910–2917 (2007).
NATURE PROTOCOLS | VOL.4 NO.5 | 2009 | 661
