A recessive contiguous gene deletion causing infantile ...

letter

© 2000 Nature America Inc. • http://genetics.nature.com

A recessive contiguous gene deletion causing infantile hyperinsulinism, enteropathy and deafness identifies the Usher type 1C gene


Maria Bitner-Glindzicz1, Keith J. Lindley2, Paul Rutland1, Diana Blaydon1, Virpi V. Smith3, Peter J. Milla2, Khalid Hussain4, Judith Furth-Lavi5, Karen E. Cosgrove6, Ruth M. Shepherd6, Philippa D. Barnes6, Rachel E. O’Brien6, Peter A. Farndon7, Jane Sowden8, Xue-Zhong Liu9, Matthew J. Scanlan10, Sue Malcolm1, Mark J. Dunne6, Albert Aynsley-Green4 & Benjamin Glaser5 Usher syndrome type 1 describes the association of profound, congenital sensorineural deafness, vestibular hypofunction and childhood onset retinitis pigmentosa1. It is an autosomal recessive condition and is subdivided on the basis of linkage analysis into types 1A through 1E (refs 2–6). Usher type 1C maps to the region containing the genes ABCC8 and KCNJ11 (encoding components of ATP-sensitive K+ (KATP) channels), which may be mutated in patients with hyperinsulinism7–10. We identified three individuals from two consanguineous families with severe hyperinsulinism, profound congenital sensorineural deafness, enteropathy and renal tubular dysfunction. The molecular basis of the disorder is a homozygous 122-kb deletion of 11p14–15, which includes part of ABCC8 and overlaps with the locus for Usher syndrome type 1C and DFNB18 (ref. 11). The centromeric boundary of this deletion includes part of a gene shown to be mutated in families with type 1C Usher syndrome, and is hence assigned the name USH1C. The pattern of expression of the USH1C protein is consistent with the clinical features exhibited by individuals with the contiguous gene deletion and with isolated Usher type 1C.

the KATP channels present were insensitive to ATP, ADP and diazoxide. This loss of KATP channel number and function in β-cells from individuals with hyperinsulinism is consistent with a recessive mutation or deletion in either ABCC8 or KCNJ11. We amplified genomic DNA from these children using PCR primers specific for exons of ABCC8. Only regions 3´ of intron 22 were successfully amplified, consistent with the presence of a homozygous deletion 5´ of ABCC8 exon 23 (Fig. 2b). P1-derived artificial chromosome (PAC) pDJ239B22 contains the entire ABCC8 gene and overlaps with PAC 6-106F23, which extends approximately 170 kb 5´ to ABCC8. FISH analysis of metaphase spreads from families 1 and 2 also suggested the presence of deletion breakpoints in both PACs (data not shown). Using sequence available in GenBank, we designed STS primers centromeric to intron 22 of ABCC8 and estimated the extent of the deletion (Fig. 2b). We then designed primers to

Insulin secretion is primarily controlled by pancreatic β-cell membrane potential, which is largely determined by the activity of the Na+-K+ ATPase pump and the rate of K+ ‘leak’ through open ATP-sensitive potassium (KATP) channels, which are coupled to the metabolic status of the β-cell. KATP closure in response to hyperglycaemia, or a functional absence of KATP channels caused by mutation in ABCC8 (formerly SUR1) or KCNJ11 (formerly Kir6.2), leads to membrane depolarization and constitutive activation of voltage-dependent Ca2+ channels and insulin release9,10,12. Three children, V1 from family 1, and IV2 and IV4 from family 2, presented with severe hyperinsulinism requiring pancreatectomy, enteropathy, profound congenital sensorineural deafness and delayed motor milestones (Fig. 1). In vitro studies of isolated β-cells9,10,12 from resected pancreata of these children revealed that the number of functional KATP channels and the open state probability was reduced compared with control β-cells and that Fig. 1 Two extended families with multiple affected members. The families are not known to be related, but share the same common Arabic surname, although they are from different countries. All six affected children suffered from severe hyperinsulinism with congenital deafness. Three affected children, V1 from family 1, IV2 from family 2 and IV4 from family 2, were available for study.

1Department of Clinical and Molecular Genetics, Institute of Child Health, and Great Ormond Street Hospital for Children NHS Trust, London, UK. Departments of 2Gastroenterology and 3Histopathology, Great Ormond Street Hospital for Children NHS Trust, London, UK. 4London Centre for Paediatric Endocrinology and Metabolism, Great Ormond Street Hospital for Children NHS Trust, and the Institute of Child Health, London, UK. 5Department of Endocrinology and Metabolism, Hebrew University-Hadassah Medical School, Jerusalem, Israel. 6Institute of Molecular Physiology and Department of Biomedical Science, Sheffield University, Western Bank, Sheffield, UK. 7Clinical Genetics Unit, Birmingham Women’s Hospital, Birmingham, UK. 8Developmental Biology Unit, Institute of Child Health, London, UK. 9Department of Human Genetics, Medical College of Virginia, Richmond, Virginia, USA. 10Ludwig Institute for Cancer Research, New York Branch at Memorial Sloan-Kettering Cancer Center, New York, New York, USA. Correspondence should be addressed to M.B.-G. (e-mail: [email protected]) or B.G. (e-mail: [email protected]).

56

nature genetics • volume 26 • september 2000


letter

Fig. 2 Schematic representation of the critical regions for Usher 1C and DFNB18. DFNB18 a, The locus for Usher syndrome type 1C, which maps close to ABCC8 and KCNJ11, lies between the markers D11S1890 and D11S902 (ref. 24), and DFNB18, a profound congenital non-syndromic deafness, maps between markers D11S2368 ABCC8 KCNJ11 11p cen Usher 1C 11p tel and D11S1307 (ref. 11). b, The genomic structure of USH1C and ABCC8. The pubD11S2368 D11S1890 D11S902 D11S1307 lished sequence of 6-106F23 is complementary to the sequence reported here. Because the original numbering scheme is used here, the PAC is numbered 3´ to 5´. pDJ239B22 is presented here in the same orientation as originally published 2.2 kb overlap and is therefore numbered 5´ to 3´. USH1C locations are given according to genomic structure derived from cDNA clones13,14. Rectangles represent exons and lines connecting them represent introns. Neither is drawn to scale. As indiPAC Clone 6-106F23 cated, 16 kb separate the last exon of USH1C from the first exon of ABCC8. Grey PAC Clone pDJ239B22 exons are located within the 122 kb deletion. Inverted triangles represent the USHIC (AIE-75/PDZ-73) ABCC8 (SURI) locations of some of the STSs tested. Filled triangles represent STSs that were amplified in affected children, whereas open triangles represent STSs that were amplified in the parents and controls, but not in the affected children. The black Exon 1 10 20 1 10 20 horizontal arrows (labelled a and b) represent the locations of the primers used a c b to generate the sequence that defined the precise break point, and confirm the 16kb presence of the deletion. The grey arrow (labelled c) represents the location of the primer used to generate the PCR product that defined the presence of a wildtype allele. DNA from affected individuals produced a 325 bp product (from primers a and b), with 5´ sequence identical to that of PAC 6-106F23 up to nt 43,682, after which the sequence obtained was identical to that beginning nt 81,354 of PAC pDJ239B22. This indicated the presence of a 122,815-bp deletion, which included the first 22 exons of ABCC8. The exact location of the break could not be determined because nt 43,681 and 43,682 of PAC 6-106F23 and nt 81,353 and 81,354 of PAC pDJ239B22 are all thymidine.

a


b

amplify across the deletion (Fig. 2b, primers ‘a’ and ‘b’). Sequencing across the deletion indicated that it is 122,815 bp. A multiplex PCR reaction was designed using primers ‘a’ and ‘b’ located on either side of the deletion breakpoint, and primer ‘c’, which is located within the region deleted in affected members of this family and which defines the presence of wild-type sequence (Fig. 2b and Fig. 3). All four parents were shown to be heterozygous for the deleted allele. BLAST searching of PACs pDJ239B22 and 6-106F23 showed that a gene, hereafter referred to as USH1C (also known as PDZ-73 and AIE-75), mapped to clone 6-106F23 (refs 13,14). Comparison of the clone sequence with the published cDNA sequences of the gene established the intron-exon structure and revealed that 19 of 21 exons were deleted in our patients. This gene was originally identified by immunoscreening of a metastatic colon cancer cDNA expression library and also by using serum from patients with an Xlinked variant of autoimmune enteropathy (AIE) to identify possible autoantigens13,14. It is highly expressed in the epithelium of the gut. Immunohistochemistry of gut biopsy tissue from the three affected children (V1 from family 1, and IV2 and IV4 from family 2) using an antibody specific for the USH1C protein confirmed the absence of its expression, in addition to an inflammatory enteropathy. Gut biopsies from patients with other types of congenital and acquired inflammatory enteropathy showed positive staining for

family 2

family 1

III3

II3

IV2

IV4

III3

controls

IV1

V1

USH1C (Fig. 4a–c). Thus, partial deletion of USH1C may be responsible for the enteropathy seen in our patients. The location of this gene within the previously defined Usher 1C region rendered it a candidate gene for this syndrome (Fig. 2a). We screened for mutations in USH1C in two unrelated families with type 1 Usher syndrome mapping to 11p14–15. We obtained immortalized cell lines from a Louisiana Acadian family from a public repository because the Usher syndrome in this population has been previously linked to this interval4. Family 3 is a previously undescribed Pakistani family. Sequencing of USH1C in the two families showed different homozygous mutations in exon 3. In family 3, insertion of a cytosine in a run of six cytosines between positions 233 and 238 of the cDNA predicts a frameshift of the encoded protein (Fig. 5) and a premature stop signal at codon 148 (cDNA numbered according to ref. 13). The mutation was observed in the three affected siblings. No heterozygotes for this sequence were detected in 80 ethnically matched controls and 96 pan-ethnic controls using DHPLC (data not shown). In the Acadian cell lines, we found a G→A change at position 216 of the cDNA (Fig. 6a). The affected individual was homozygous for the substitution and the parents were heterozygous. The sequence variant removed a DraIII site, present in 96 pan-ethnic controls (data not shown). Although this does not change an amino acid, examination of the sequence suggested that it might create a new splice site (Fig. 6b). Analysis of USH1C lymphoblastoid cDNA from the Acadian family showed that the affected individual produced a shortened RT–PCR product (Fig. 6c). Sequencing revealed a 39-bp deletion, consistent with the creation of a new splice site within exon 3 (ref. 15). We examined expression of USH1C by RT–PCR of human fetal tissues and designed RT–PCR primers to examine the expression of splice forms containing exon 3, as the gene is known to be alternatively spliced14. We detected USH1C expression in human fetal tissues between 10 and 13 weeks gestation, including the ear,

Fig. 3 Multiplex PCR assay. Affected children are indicated by the filled symbols. The PCR reaction included primers ‘a’, ‘b’ and ‘c’ as indicated in Fig. 2b. The 790-bp product was obtained only if a normal allele were present, whereas the 325-bp product was obtained only if a deletion allele were present. All four parents are thus heterozygous for the deletion and wild-type allele, whereas the three affected children indicated are homozygous for the deleted allele. III11 and III12 from family 2 were also homozygous for the deletion (data not shown), but no DNA was available from individual IV2 from family 1. Screening of 100 chromosomes from normal controls from the same ethnic group failed to detect the presence of the 325-bp band on multiplex PCR, indicating that this is unlikely to be a polymorphic variant.


57

letter



Fig. 4 Immunohistochemistry using anti-USH1C monoclonal antibody. a–c, Sections of human duodenum stained with anti-USH1C antibody. Original magnification, ×100. a, Section of control non-inflamed human duodenum stained with anti-USH1C antibody. There is a diffuse pattern of staining within the surface epithelial cells of crypt and villus and a dense pattern of staining beneath the enterocyte apical membrane. b, Duodenal biopsy of individual IV4 from family 2 stained with anti-USH1C antibody. There is a partial villus atrophy and completely absent USH1C staining. c, Duodenal biopsy from an unrelated individual with partial villus atrophy and mucosal inflammation. The dense sub-apical membrane immunoreactivity is well-preserved, although villus enterocytes show some reduction in cytoplasmic staining. d, Section of human fetal eye (10.5 weeks gestation) shown for orientation. Original magnification is ×10. The section is shown in higher magnification in (f). e, Section of human fetal retina (negative control). The primary anti-USH1C antibody has been omitted. Original magnification, ×160. f, Human fetal retina stained with anti-USH1C antibody. RPE, retinal pigmented epithelium; ON, outer neuroblastic layer. In life the RPE and the ON are adherent, but have become separated in places during preparation of the sample. Positive (brown) staining is observed in the outermost aspect of the developing outer neuroblastic layer of the retina (arrow), part of which will give rise to the development of the rods and cones of the retina. Original magnification, ×160.

a

b

c

d

e

f

eye, gut, kidney, brain, adrenal, muscle and heart (data not shown). Expression in human lymphoblasts was weak. Further RT–PCR studies using sets of primers specific for different isoforms14 showed that the longest isoform of USH1C (previously called PDZ-73) was detected in all these fetal tissues including fetal ear and fetal eye. A shorter, 45-kD isoform of the protein, which also includes exon 3, was detected by RT–PCR in gut and kidney, but only a faint RT–PCR product was observed in fetal ear and eye (data not shown). Using the monoclonal antibody to USH1C, we performed immunohistochemistry on sections of human gut, human fetal ear and eye. Antibody staining was strongest in tissues expressing the 45-kD isoform of the protein14 (that is kidney, gut, brain and testis). We saw strong positive staining in sections of normal gut (Fig. 4a). In the developing eye at 10.5 weeks, we observed lower levels of expression of the USH1C protein in the outermost aspect of the developing outer neuroblastic layer of the retina, part of which gives rise to the development of the rods and cones of the retina (Fig. 4f). In the developing ear at 10.5 weeks gestation, we detected lower levels of positive staining in the apical and basal surfaces of the cells destined to form the sensory areas of the labyrinth of the inner ear (that is, organ of Corti regions, macular regions of saccule and utricle, and crista regions of the ampullae of the lateral and posterior semi-circular canals; data not shown). These results are consistent with weak expression of the 45-kD isoform in the eye and ear, confirmed by RT–PCR, even though expression of the longer 73-kD isoform is detected in these tissues by RT–PCR. Thus USH1C is expressed in the tissues affected

in Usher syndrome as well as those affected in the contiguous gene deletion syndrome detailed here. We have confirmed the presence of an autosomal recessive contiguous gene syndrome consisting of severe hyperinsulinaemic hypoglycaemia, congenital sensorineural deafness, renal tubular dysfunction and severe enteropathy caused by a 122-kb deletion of the short-arm of chromosome 11. The hyperinsulinism can be explained by the deletion of more than half of ABCC8 (ref. 16), whereas the enteropathy may be explained by partial deletion of USH1C, given the expression pattern of this gene and its association with autoimmune enteropathy. The USH1C mutations found in two families with Usher type 1C suggest that deletion of this gene is also responsible for the ear and eye abnormalities seen in these patients. Deletion of most of USH1C causes severe enteropathy in addition to Usher syndrome in the Arab patients, but a frameshift mutation in exon 3 in family 3 appears to cause Usher syndrome alone without clinical gastrointestinal symptoms. Moreover, the splice mutation in the Acadian cell lines appears to cause a localized in-frame deletion of 39 bases without clinical effect on the gut. The resulting transcript may be unstable and the overall effect of this mutation may also be that of a null mutation. It is therefore difficult to explain why enteropathy has not been reported in association with Usher syndrome type 1C. Possibly, individuals with Usher syndrome type 1C may have a subclinical disorder of gut architecture, only evident on gut biopsy. Alternatively, tissue-specific expression of multiple isoforms of the protein may account for mutations that have very limited clinical effects. USH1C contains three PDZ domains, which are thought to be important modulators of proteinprotein interactions. PDZ domains derive their name from the first proteins recognized to have the common conserved motif of 80–90 amino acids: the post-synaptic density protein PSD95, the Drosophila melanogaster tumour suppressor

Fig. 5 Sequencing of exon 3 in family 3. There is a homozygous insertion of a cytosine in a run of six cytosines between nt 233 and nt 238. Wild-type sequence is shown on the right for comparison. Sequencing of all three affected individuals in the family showed the same insertion.

58


letter


Fig. 6 Analysis of Acadian cell lines. a, Sequencing of exon 3 in the Acadian cell lines. There is a homozygous G→A substitution at position 216 of the cDNA. A wild-type sequence is shown for comparison and both parents were shown to be heterozygous for the change. This is not predicted to alter an amino acid. b, Predicted creation of a new splice site within exon 3. The consensus splice site is shown together with the exon 3/intron 3 splice site sequence. Exons are shown in upper-case and introns in lowercase letters. Numerical values show frequencies of nucleotide usage in primates around conserved splice junctions15. Comparison of the wild-type and mutated sequence within exon 3 shows that a new splice site may be created 2 bp proximal to the site of the mutation. c, RT–PCR between exons 3 and 5 in lymphoblastoid cell lines from the Acadian family. Lane 1, 100-bp ladder; lane 2, parent; lane 3, affected individual; lane 4, heterozygous parent; lane 5, same parent as in lane 4 but separate RT–PCR reaction; lanes 6, 7, normal controls. There is a shortened RT–PCR product in the affected individual and in one sample from a heterozygous parent. Sequencing of the shortened transcript confirmed a deletion of 39 bp at the position predicted in (b). Several RT–PCR reactions showed that the heterozygous parents produced both the wild-type transcript and the shortened transcript (1/6 RT–PCR reactions), or just the wild-type transcript alone (5/6 RT–PCR reactions). The cell line from the affected individual produced either the shortened transcript (1/3 RT–PCR reactions) or no transcript at all (2/3 RT–PCR reactions), suggesting that the shortened transcript may be unstable.


a

b

gene dlg A and the tight junction protein ZO-1 (ref. 17). Proteins containing PDZ domains occur in a wide variety of species and tend to be plasma-membrane associated. It is therefore thought that the PDZ domains localize their ligands (receptors, channels, components of signal transduction pathways or other PDZdomain–containing proteins) to particular subcellular domains and organize and coordinate multiprotein complexes at the plasma membrane. Proteins containing PDZ domains are expressed in the Müller cells of the retina, where they appear to co-localize with KCNJ10, an inwardly rectifying potassium channel that contains a PDZ-domain interaction sequence18,19 and that is also expressed in the basolateral membrane of marginal cells of the stria vascularis of the inner ear20. The locus for DFNB18, a profound congenital non-syndromic deafness without vestibular symptoms, maps to the same region as Usher 1C. These two disorders may be allelic and molecular analysis of families with non-syndromic deafness mapping to the DFNB18 locus will determine this or whether there is a second deafness gene in this region. Deletion of most of USH1C in affected children of the Arab families with hyperinsulinism and deafness, characterization of different homozygous point mutations in affected individuals from two unrelated families with Usher syndrome, and demonstration of expression in the developing ear and eye provide evidence that USH1C underlies this disorder. Thus, we have identified a class of genes that appear to be important for the development and maintenance of both auditory- and phototransduction.

Methods Patients. Three children with severe hyperinsulinism and sensorineural deafness from two unrelated families were initially identified. Genealogical study identified three additional, similarly affected relatives. Individual V1 from family 1 (6 months of age) had normal electroretinograms nature genetics • volume 26 • september 2000

c

(ERGs), but IV2 (aged 2.5 years) and IV4 from family 2 (aged 4 months) had attenuated ERGs, which may be observed before the onset of clinical symptoms of failing vision in individuals with Usher syndrome. These three affected children, V1 from family 1, IV2 from family 2 and IV4 from family 2, had severe gastrointestinal symptoms including diarrhoea with failure to thrive, intractable vomiting and a feeding disorder, all with foregut dysmotility. Small bowel biopsies from V1 from family 1, and IV2 and IV4 from family 2, demonstrated crypt hyperplastic villus atrophy, an inflammatory infiltrate within the lamina propria and disorganization of the surface epithelium. Appearances were indistinguishable from autoimmune enteropathy. (Affected individuals IV2 from family 1, and III11 and III12 from family 2 did not undergo gastroenterological investigation.) All three patients had generalized aminoaciduria and in one, urinary excretion of retinol binding protein and N-acetylglucosamine were found to be elevated, suggesting a proximal renal tubulopathy. Family 3, a consanguineous Pakistani family, has not been described previously. All three affected individuals suffer from profound congenital sensorineural deafness. The eldest offspring was diagnosed as having retinitis pigmentosa on fundoscopy, confirmed by electroretinogram, at the age of 24 y. He reports impairment of balance and also suffers from epilepsy. His brother has retinitis pigmentosa and reduced responses on ERG consistent with retinal dystrophy and problems with balance. Their sister has confirmed retinitis pigmentosa. DNA samples from their parents were not available for analysis. Cell lines (GM09458, GM09459 and GM09456) from an Acadian family with type 1 Usher syndrome were obtained from Coriell Cell Repositiories21,22. Updated information on neonatal hyperinsulinism is available on the European Network for Research into Hyperinsulinism (ENRHI) web site (http://www.phhi.u-net.com). Deletion mapping. Three affected children (V1 from family 1, and IV2 and IV4 from family 2) had normal karyotypes on high-resolution G-banding. We amplified the exons of ABCC8 as described23. STS primers are available on request. Absence of amplification following multiple attempts, in the presence of good amplification of controls, was taken as evidence that at least one of the primers was within the deleted region.

59

letter


Sequences of primers used in the multiplex PCR reaction are primer ‘a’ (located in intron 2 of USH1C), 5´–GCATCAGATGTCTCCGATCA–3´; primer ‘b’ (located in intron 22 of ABCC8), 5´–TACGAGACAAGGCTCT GTCG–3´; and primer ‘c’ (located in intron 21 of ABCC8), 5´–CCTACC CTCTACTCTCTTCC–3´. DNA sequencing. Primer sequences for exons of USH1C are available on request. PCR products were purified using microspin columns (Pharmacia) and sequenced on an ABI377 using the fluorescent dideoxy terminator method.


DHPLC analysis. We analysed DNA from controls using the Transgenomic WAVE DNA analysis system (DHPLC). PCR fragments were generated using touchdown PCR, heteroduplexed with wild-type DNA and analysed according to the manufacturer’s instructions. RT–PCR. Human fetal material was obtained from the MRC Human Embryo Resource at the Institute of Child Health, approved by the local Ethical Committee. RNA was extracted using TRIZOL (Gibco). We carried out reverse transcription with Superscript reverse transcriptase using oligo dT and random primers. Expression of isoforms of USH1C containing exon 3 was examined using primers in exon 3 (3F, 5´–AGCTGGTCATCAA TGAACC–3´) and exon 5 (5R, 5´–AGATGGAATATCCATTGATCCG–3´). For lymphoblastoid cell lines, nested RT–PCR reactions used primers in exon 1 and exon 11 (1F, 5´–CGGTCGCGGTCGCGGTCTTTC–3´, and 11R, 5´–GATCCAGGTTAGAGAAGTCGAC–3´) and then primers 3F and 5R. Immunohistochemistry. We carried out immunostaining of paraffinembedded sections with antibody in a titre of 1:100 in PBS (pH 7.4) for 1 h at RT. Biotinylated anti-mouse antibody (Dako) at 1:50 in PBS for 1 h at RT followed by peroxidase labelled streptavidin (Sigma) at 1:50 in PBS for 1 h at RT was used for detection. Visualization with diaminobenzidine peroxidase and counterstaining with haematoxylin was employed.

1. 2. 3. 4. 5. 6. 7. 8.

9.

10.

11.

12.

13.

60

Smith, R.J. et al. Clinical diagnosis of the Usher syndromes. Usher Syndrome Consortium. Am. J. Med. Genet. 50, 32–38 (1994). Kaplan, J. et al. A gene for Usher syndrome type 1 (USH1A) maps to chromosome 14q. Genomics 14, 979–987 (1992). Weil, D. et al. Defective myosin VIIA gene responsible for Usher syndrome type 1B. Nature 374, 60–61 (1995). Smith, R.J.H. et al. Localization of two genes for Usher syndrome type 1 to chromosome 11. Genomics 14, 995–1002 (1992). Wayne, S. et al. Localization of the Usher syndrome type 1D gene (USH1D) to chromosome 10. Hum. Mol. Genet. 5, 1689–1692 (1996). Chaib, H. et al. A newly identified locus for Usher syndrome type I, USH1E, maps to chromosome 21q21. Hum. Mol. Genet. 6, 27–31 (1997). Thomas, P.M. et al. Mutations in the sulfonylurea receptor gene in familial hyperinsulinemic hypoglycemia of Infancy. Science 268, 426–429 (1995). Thomas, P., Ye, Y. & Lightner, E. Mutation of the pancreatic islet inward rectifier Kir6.2 also leads to familial persistent hyperinsulinemic hypoglycemia of infancy. Hum. Mol. Genet. 5, 1809–1812 (1996). Dunne, M.J., Cosgrove, K.E., Shepherd, R.M. & Ammala, C. Potassium channels, sulphonylurea receptors and control of insulin release. Trends Endocrinol. Metabol. 10, 146–152 (1999) Kane, C. et al. Therapy for persistent hyperinsulinemic hypoglycemia of infancy. Understanding the responsiveness of β cells to diazoxide and somatostatin. J. Clin. Invest. 100, 1888–1893 (1997). Jain, P.K. et al. A gene for recessive nonsyndromic sensorineural deafness (DFNB18) maps to the chromosomal region 11p14–p15.1 containing the Usher syndrome type 1C gene. Genomics 50, 290–292 (1998). Kane, C. et al. Loss of functional KATP channels in pancreatic β-cells causes persistent hyperinsulinemic hypoglycemia of infancy. Nature Med. 2, 1344–1347 (1996). Kobayashi, I. et al. Identification of an autoimmune enteropathy-related 75kilodalton antigen. Gastroenterology 117, 823–830 (1999).

GenBank accession numbers. PAC pDJ239B22, AC003969; PAC 6-106F23, AC005137; AIE-75, AB006955 and AB018687; PDZ-73 and PDZ-45, AF039700 and AF039699, respectively. Note added in proof: While this manuscript was in press, the paper by Verpy et al.25 was brought to our attention, which details identification of USH1C by an independent approach. Acknowledgements

We thank the patients and their families for participation; their treating physicians, especially K. Rajput and W. van’t Hoff, for assistance; S. Bundey for help establishing the Usher clinic; R. James and S. Swift for providing the β-cell preparations for in vitro study; D. Rampling for help with immunostaining; R. Mueller for providing DNA from Pakistani controls; A. Kriss for electroretinograms; J. Liang and L. Michaels for help with interpretation of immunostaining; G. Evans and M. Athanasiou for PAC clones for FISH studies; and Defeating Deafness for pump priming this research. M.B.-G. is funded by an M.R.C. Clinician Scientist Fellowship. This work was undertaken in part by Great Ormond Street Hospital for Children NHS Trust, which received a proportion of its funding from the NHS Executive. We acknowledge the Medical Research Council (UK) and ‘Jeans for Genes’ for funding the Transgenomic WAVE Fragment Analysis System (DHPLC), and the Wellcome Trust for the ABI sequencer. B.G. was supported in part by grant 4201 from the Israel Ministry of Health and a grant from the Israel Science Foundation founded by the Academy of Sciences and Humanities. M.J.D. was supported by the British Diabetic Association and the Medical Research Council (UK). Grant BMH4-CT98-3284, awarded as part of the European Commission Biomed 2 program, provided support for international collaborations. X.L. was supported by the Deafness Research Foundation and Grant DC04530. Received 29 March; accepted 23 June 2000.

14. Scanlan, M.J. et al. Isoforms of the human PDZ-73 protein exhibit differential tissue expression. Biochim. Biophys. Acta 1445, 39–52 (1999). 15. Shapiro, M.B. & Senepathy, P. RNA splice junctions of different classes of eukaryotes sequence statistics and functional implications in gene expression. Nucleic Acids Res. 15, 7155–7175 (1987). 16. Glaser, B., Landau, H. & Permutt, M.A. Neonatal hyperinsulinism. Trends Endocrinol. Metabol. 10, 55–61 (1999). 17. Fanning, A.S. & Anderson, J.M. PDZ domains: fundamental building blocks in the organization of protein complexes at the plasma membrane. J. Clin. Invest. 103, 767–772 (1999). 18. Ishii, M. et al. Expression and clustered distribution of an inwardly rectifying potassium channel, KAB-2/Kir4.1, on mammalian retinal Mueller cell membrane: their regulation by insulin and laminin signals. J. Neurosci. 17, 7725–7735 (1997). 19. Horio, Y. et al. Clustering and enhanced activity of an inwardly rectifying potassium channel, Kir4.1, by an anchoring protein, PSD-95/SAP90. J. Biol. Chem. 272, 12885–12888 (1997). 20. Hibino, H. et al. An ATP-dependent inwardly rectifying potassium channel, KAB-2 (Kir4.1), in cochlear stria vascularis of inner ear: its specific subcellular localization and correlation with the formation of endocochlear potential. J. Neurosci 17, 4711–4721 (1997). 21. Pelias, M.Z. et al. Linkage studies of Usher syndrome: analysis of an Acadian kindred in Louisiana. Cytogenet. Cell Genet. 47, 111–112 (1998). 22. Kloepfer, H.W. & Laguaite, J.K. The hereditary syndrome of congenital deafness and retinitis pigmentosa. (Usher’s syndrome). Laryngoscope 76, 850–862 (1966) 23. Nestorowicz, A. et al. Genetic heterogeneity in familial hyperinsulinism. Hum. Mol. Genet. 7, 1119–1128 (1998). 24. Higgins, M.J. et al. Contig maps and genomic sequencing identify candidate genes in the Usher 1C locus. Genome Res. 8, 57–68 (1998). 25. Verpy, E. et al. A defect in harmonin, a PDZ-domain–containing protein expressed in the inner ear sensory hair cells, underlies Usher syndrome type 1C. Nature Genet. 26, 51–55 (2000).
