Dec 28, 1994 - granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes. D. Z. STAYNOV* ...
Proc. Natl. Acad. Sci. USA Vol. 92, pp. 3606-3610, April 1995 Immunology
A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes D. Z. STAYNOV*, D. J. COUSINS, AND TAK H. LEE Department of Allergy and Respiratory Medicine, United Medical and Dental Schools, Guy's Hospital, London SE1 9RT, United Kingdom
Communicated by K Frank Austen, Brigham and Women's Hospital, Boston, MA, December 28, 1994
levels (3) and most T-cell clones appear to have a ThO-like phenotype (3, 4). T-cell activation through the T-cell receptor proceeds via the inositol trisphosphate, diacylglycerol, Ca2+ influx, and protein kinase C activation pathways and can be substituted by Ca2+ ionophores and activators of protein kinase C such as the phorbol esters (5). However, the processes by which this activation causes the simultaneous or divergent expression of several cytokines in different T-cell subsets are still unclear. GM-CSF is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities (6), and it may be involved in constitutive as well as in inducible hematopoiesis. The human (h) and murine (m) GM-CSF genes are clustered with other cytokine genes (IL-3, -4, -5, and -13) on chromosomes 5 and 11, respectively (7, 8). Their promoters are highly conserved (9). Previous studies of the transcriptional regulation of GM-CSF in human and murine T lymphocytes have identified a number of regulatory elements in the first 100 bp upstream of the start of transcription (10-14). In this paper, we report a regulatory element in the promoter of the hGM-CSF gene between -194 and -153 bp from the transcription start site. It has a strong positive effect on the expression of GM-CSF by Jurkat cells upon stimulation with phorbol ester and ionomycin or on the expression of the minimal promoter of the herpes simplex virus thymidine kinase (HSV tk) gene and in band-retardation assay binds several proteins from nuclear extracts (NEs) of Jurkat cells. It contains two symmetrically nested inverted repeats (underlined) -192 C[TGGAAAGGTTCATTAATGAAAACCCCCAAG -161. This element shares a conserved motif with the promoters of several other cytokines expressed by T cells, which compete for common proteins and therefore may represent a common regulatory mechanism in the regulation of these genes.
ABSTRACT Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
The effector functions of activated T cells enable them to mount an immune response to foreign antigens. The activities of T helper (Th) lymphocytes are performed by the simultaneous expression of an array of secreted cytokines that act in a network. In mice, two subsets of Th cells have been identified based on the pattern of cytokines. that they express upon activation (1). The Thl subset mediates delayed-type hypersensitivity and produces granulocyte-macrophage colonystimulating factor (GM-CSF), interferon y, lymphotoxin, and interleukins 2 and 3 (IL-2 and IL-3). The Th2 subset, which participates in humoral immunity, produces GM-CSF, IL-3, IL-4, IL-5, and IL-13. These subsets of Th cells appear to arise from a common precursor cell termed ThO, which expresses all of the above cytokines. There is some evidence to suggest that this is caused by a terminal differentiation step (1, 2). Human Th cells have also been defined as Thl/Th2 by their cytokine expression patterns. However, there are some differences from the mouse system, since human T cells all express IL-2 at variable
MATERIALS AND METHODS Cell Lines and Plasmids. The human T-cell line Jurkat was obtained from D. Cantrell (15) and was grown in RPMI 1640 medium supplemented with 10% fetal calf serum, L-glutamine (2 mM), penicillin (1 unit/ml), and streptomycin (1 ,tg/ml). When indicated, cells were activated at a density of 8 x 105 cells per ml with phorbol dibutyrate (50 ng/ml) (PDBu; Calbiochem) and ionomycin (0.5 ,ug/ml) (Calbiochem) or phorbol 12-myristate 13-acetate (10 ng/ml) (PMA; Sigma) in flasks coated with anti-CD3 antibody (1 ,tg/ml) (UCH-Tl; Sera-Lab, Crawley Down, Sussex, U.K.). The reporter gene plasmids pBLCAT2 and -3 were obtained from B. Luckow (16). The -617 to + 19 bp fragment of the hGM-CSF gene (ref. Abbreviations: GM-CSF, granulocyte-macrophage colony-stimulating factor; Th, T helper; IL, interleukin; PDBu, phorbol dibutyrate; CAT, chloramphenicol acetyltransferase; WT, wild type; CP, central palindrome; NE, nuclear extract; h, human; m, murine; HSV tk, herpes simplex virus thymidine kinase; PMA, phorbol 12-myristate 13acetate; DTT, dithiothreitol. *To whom reprint requests should be addressed.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
3606
Proc. Natl. Acad. Sci. USA 92 (1995)
Immunology: Staynov et at 17; plasmid obtained from American Type Culture Collection, catalog no. 59170) was generated by Pst I/BAL-31 digestion and inserted into the Pst I site of pBLCAT3. Deletion mutants of this insert were made with BAL-31 nuclease (-259, -194 bp) and Avr II (-152 bp) by standard protocols (18). The plasmid pBLCAT2+40 was constructed by inserting the synthetic oligonucleotide WT (wild-type sequence) (see below) between the Sal I and BamHI sites of pBLCAT2, which are 5' of the minimal promoter of HSV tk. Transfections. Transfections were carried out as described (15). Briefly, Jurkat cells were grown to a density of 8 x 105 cells per ml at >80% viability. They were harvested by centrifugation and washed once with phosphate-buffered saline (PBS) at room temperature; the cells were harvested again and resuspended at a density of 1 X 107 cells per ml in RPMI 1640 medium (no supplements). Aliquots of 0.4 ml were placed in 4-mm electroporation cuvettes (Flowgen, Sittingbourne, Kent, U.K.) with 10 of plasmid DNA. Electroporation was carried out at 300 mV, 960 ,uF, 00 fl with a Gene Pulser (Bio-Rad). Cells were then left at room temperature for 10 min and transferred to tissue culture flasks containing 5 ml of RPMI 1640 medium (plus supplements). Cells were activated as indicated and were incubated overnight at 37°C in 5% CO2 in air. Cells were harvested 20 hr after activation by centrifugation. Cell extracts were prepared and chloramphenicol acetyltransferase (CAT) assays (19) were performed using the CAT enzyme assay system (Promega). Briefly, cells were washed once with 5 ml of PBS and pelleted again by centrifugation. Cell pellets were then resuspended in 200 Al of reporter lysis buffer (Promega) and cells were lysed for 15 min at room temperature. Cell extracts were then heated to 60°C for 10 min and centrifuged to pellet debris; the supernatants were used in the CAT assay. Each CAT assay reaction mixture contained 50 Al of cell extract, 5 Al of n-butyryl coenzyme A (5 mg/ml; Promega), 6,lI of [14C]chloramphenicol (55 mCi/ mmol; 1 Ci = 37 GBq; Amersham), and 64,lp of H20. Samples were incubated at 37°C for 1 hr, mixed with 300 Al of mixed xylenes (Aldrich), and centrifuged for 10 min at 13,000 x g. The xylene phase was back-extracted twice with 100 Al of 0.25 M Tris-HCl (pH 8.0) and 200 Al was mixed with 3 ml of Ecoscint 0 (National Diagnostics) for liquid scintillation counting. Cell activation was routinely checked for expression of GMCSF by PCR of reverse-transcribed mRNA as described (20). Oligonucleotide Fragments. Long double-stranded oligonucleotide (40 bp) fragments were obtained by primer extension of overlapping synthetic oligonucleotides and 5'-end-labeled with [.y-32P]ATP using polynucleotide kinase when necessary (18). The full-length fragments are shown (upper strand only): (i) WT sequence -196 to -157, GGTTCTTGGAAAGGTTCATTAATGAAAACCCCCAAGCCTG; (ii) fragment in which the central palindrome was mutated (MUT1), GGTTCTTGGAAAGGcaggtctagctcAACCCCCAAGCCTG; (iii) fragment in which the outer palindrome was mutated (MUT2),
,tg
GGTTacgtaAAAGGTTCATTAATGAAAACCCtagctCCTG;
(iv) a short double-stranded fragment (CP), GGTTCATTAATGAAAA, containing the central palindrome, was prepared by annealing full-length synthetic oligonucleotides; (v) the WT fragment was also used in band-retardation assays after digestion with Mse I restriction enzyme, which cuts the central palindrome at TTCAT/TAATGAA (WT/Mse I); (vi) the corresponding palindromic sequence of the IL-5 promoter -481 to -452, AGAACTCGACCCTGCCAAGGCTTGGCAGTTTCCATTTCAA. The mutated sequences are shown in lowercase letters. Nuclear Protein Extraction. NEs were obtained by a modification of the method described in ref. 21. Cells were pelleted by centrifugation and washed once with PBS (room temperature); the cells were harvested again and resuspended at 2 x 108 cells per ml in 10 mM KCI/20 mM Tris HCl, pH 8/2 mM dithiothreitol (DTT)/20% (vol/vol) glycerol and lysed by
3607
freezing in liquid N2. Cell suspensions were thawed and nuclei were pelleted by centrifugation at 13,000 x g at 4°C for 2 min, resuspended in nuclear extraction buffer (NEBuffer; 400 mM KCl/20 mM Tris-HCl, pH 8/2 mM DTT/20% glycerol), rolled for 15 min at 4°C, and pelleted again as described above for 5 min. Supernatants (NE) were either dialyzed against 100 vol of NEBuffer for 1 hr or directly frozen and stored in liquid N2. Protein concentrations were determined by Bradford assay (18) and were usually between 6 and 10 mg/ml. All buffers contained 200 ,tM Na-(p-tosyl)lysine chloromethyl ketone, 40 ,uM phenylmethanesulfonyl fluoride, and 4 mM diisopropyl
fluorophosphate. Band-Retardation Assays. Two methods were used to form DNA-protein complexes: (i) Reconstitution at 80 mM Na+/K+ ions. Usually 16 jig of NE was used in 13 ,ul of binding buffer 80 [BB80; 10 mM Tris-HCl, pH 7.5/1 mM MgCl2/0.5 mM Na3EDTA/80 mM NaCl/0.5 mM DTT/4% glycerol and a specified amount of poly(dl-dC) or poly(dG-dC)] with 6.6 fmol of labeled fragment and 660 fmol of unlabeled specific competitor DNA when required and incubated for 15 min at room temperature or as specified in the figure legends. (ii) Reconstitution from high salt. Sixteen micrograms of NE was used in 3 ,lI of binding buffer 500 [BB500; 40 mM Tris HCl, pH 7.5/4 mM MgCl2/2 mM Na3EDTA/500 mM NaCl/2 mM DTT/16% glycerol and a specified amount of poly(dl-dC)] mixed with 6.6 fmol of labeled fragment and 660 fmol of unlabeled specific competitor DNA when required, incubated for 10 min at room temperature, and diluted at 3-min intervals with 1, 2, 3, 4, and 5 ,ul of H20 down to 80 mM monovalent ions (Na+/K+). All samples were loaded on a 5% polyacrylamide gel in 0.3x Tris borate/EDTA (TBE) buffer (18) or glycine buffer (200 mM glycine/15 mM NaOH/2 mM Na3 EDTA). RESULTS Transient Transfection of Jurkat Cells. We have studied the transcriptional activity of the hGM-CSF gene promoter in the human lymphoma T-cell line Jurkat stimulated with PDBu and ionomycin by transient transfection with plasmid constructs containing variable lengths of its upstream region linked to the CAT gene (Fig. 1). We have found that the region between -153 and -194 bp from the start of transcription contains a powerful 24
381
185
2700
32
504
4
100
PMA + anti-CD3
unactivated
T
1411
S-15500
:.D 0
1254
E2 PDBu + lonomycin * unactivated
894
< 10000 .5
7l
H."V
'%500 100
r
13
-
-617
-
6
7
-259
-194
100
L
4Fi'71 -152
Length of Promoter
FIG. 1. Deletion mapping of the transcriptional activity of the hGM-CSF promoter. Deletion mutants containing fragments of the hGM-CSF 5' flanking region from -617 to + 19 from the transcription start site were transfected into Jurkat cells. Solid bars, cells cultured in growth medium alone; hatched bars, cells stimulated with PDBu and ionomycin. Relative activities are compared to stimulated cells transfected with - 152-bp construct. Data shown are means of four experiments ± SE. Shown above are the corresponding data from an experiment in which the transfected cells were activated with PMA and anti-CD3 antibody.
3608
hGM-CSF
(-192
to
-161)
Al"', "'W
-I
3-
1
2
3
4
6
5
8
7
9
FIG. 5. Gel-retardation assay of the short (16 bp) fragment containing the CP. Each reaction mixture contains 2.7 pmol of radiolabeled CP. Lanes 2-9, 8 jig of NE from unstimulated Jurkat cells. Ratios of poly(dI-dC) and CP to probe (wt/wt) are indicated in the figure.
Complex DNA-protein structures such as nucleosomes require carefully selected conditions for their reconstitution in order to minimize the strong electrostatic interactions during complex formation. Usually this is achieved by dialysis from high to physiological ionic concentrations. In a similar fashion, we mixed the probe with the NE at 500 mM Na+ (or K+) and subsequently slowly diluted the mixture to 80 mM salt with H20 in small aliquots before loading it on a gel (Fig. 6A). We observed a strong specific band that is attenuated by WT, reconstitution
poly(dldC)
high-low
low
specific
I-
competitor
04
=3 :
%
..
I--
3:
3:
B. 2 2
_,
3, ?,
_,ww
_fo
I-
3:., -f
B
A
1 _ 1
high-low
1000 5000 20000 1000 5000 20000
5000
* w
--
2
2
-O
3
-
W
`i
-A .,:
3-
4 5 6 7
1 2 3 4
-
0,w.
W
-
-
1 2 3 4 5 6 7 8 9 101112
FIG. 6. Gel-retardation assay of the double palindromic fragment (WT) under different reconstitution conditions. In all samples, 6.6 fmol of probe and 16 ,ug of NE (Jurkat, unstimulated) were used. Specific and nonspecific competitors (wt/wt) are indicated in the figure. (A) Reconstitution of the DNA-protein complex in 500 mM NaCl and subsequent dilution with H20 to 80 mM salt in the presence of 5000x excess (wt/wt) of nonspecific competitor and 10OX excess of unlabeled WT fragment (lane 2), MUT1 (lane 3), and MUT2 (lane 4). (B) Lanes 1-6, reconstitution in 80 mM salt; lanes 7-12, reconstitution from 500 mM down to 80 mM salt. (A) Gel in glycine buffer. (B) Gel in 0.3x TBE buffer.
*
FIG. 7. Gel-retardation assay of the double palindromic fragment (WT) in competition with itself and with the palindromic element from IL-5. In all samples, 6.6 fmol of probe, 16 ,ug of NE, and 1.7 jig of poly(dG-dC) were used. Specific competitors WT and IL-5 ratios (mol/mol) are indicated.
MUT1, and MUT2 (band 1). A nonspecific band is also seen (band 2) that is not attenuated by a 100-fold excess of any of the four fragments. There is also a weak band (band 3) that probably corresponds to band 6 in Fig. 4. The other bands seen in Fig. 4 are observed only upon overexposure of this gel. Thus, a unique structure can be reconstituted that involves both palindromes. Fig. 6B shows reconstitution experiments carried out at low (lanes 1-6) and high (lanes 7-12) ionic concentrations using increasing nonspecific competitor/probe ratios. The unique band seen in Fig. 6A is observed even at low salt reconstitution when the ratio of nonspecific competitor to probe is decreased from 20,000-fold to 1000-fold excess (Fig. 6B, lane 1). Increasing this ratio causes a decrease of the unique band and appearance of the bands previously seen in Fig. 4 (Fig. 6B, lanes 3 and 5). When the reconstitution is carried out at high salt, the increase of nonspecific competitor abolishes the unique band but does not produce the other bands (Fig. 6B, lanes 7-12). Under these conditions, the nonspecific competitor probably removes the participating proteins as one complex. Using a different nonspecific competitor [poly(d&dC)], which has lower affinity to proteins that bind to A+T-rich sequences, we have obtained a pattern similar to that in Fig. 6B (lane 7) in a wide range of excess of nonspecific competitor (from 1000-fold to 20,000-fold; results not shown). This suggests that at high concentrations poly(dIldC) is sequestering one of the proteins and preventing formation of the complex. Fig. 7 shows that the corresponding palindromic fragment of IL-5 competes with the GM-CSF WT fragment for the same proteins, although less efficiently.
DISCUSSION In this study, we have investigated the activity of the hGM-CSF promoter. We have identified a region from -194 to -153 bp from the start of transcription that contains a strong positive regulatory element. This element increases the rate of transcription by an order of magnitude over an already considerable rate caused by the other regulatory elements in the first 150 bp of the
3610
Immunology: Staynov et at
promoter, which have been characterized previously (10-14). It also exerts a positive effect on the HSV tk minimal promoter. This region of the promoter contains two symmetrically nested inverted repeats (double underlined). -194 TTCTTGGAAAGGTTCATTAATGAAAACCCCCAAGCCTGACCA -153 AAGAACCTTTCCAAGTAATTACTTTTGGGGGTT CGGACTGGT
In band-retardation assays, this fragment appears to produce seven bands with different mobilities. Six of these bands represent specific interactions since they are abolished by competition with unlabeled fragment. Bands 1 and 7 represent interactions with the outer palindromic sequences since they are abolished only by competition with fragments containing the outer palindrome (MUT1 and WT/Mse I). The outer palindrome does not interact with the proteins in bands 2, 3, 5, and 6 since they are not abolished by the fragment in which only the inner palindrome is mutated or cut (MUT1, WT/Mse I). When used as competitors, the 40-bp fragment with mutated outer palindrome (MUT2) and the short 16-bp CP compete for bands 5 and 6. Moreover, the intensity of bands 5 and 6 increases when only bands 1 and 7 are blocked by competition (compare Fig. 4 A and B, lanes 2 and 4). Therefore, these bands are caused by interactions with the inner palindrome. The intervening sequences do not appear to bind to specific proteins. The single band produced by the CP alone cannot be identified as either band 5 or 6 since the DNA fragment used is of a different size. The symmetrical position of the two palindromes suggested that they may participate in a single nucleoprotein complex involving more than one protein. Gradual reconstitution of the DNA-protein complex from high to low salt would favor the formation of such a structure. Indeed, such reconstitution produced one strong band that apparently involves both palindromes since it is abolished by competition with any one of the three fragments. It would appear that band 1 (Fig. 6A) of the reconstituted material represents a complex structure involving several proteins. No differences were observed between NEs derived from unactivated or activated cells. This suggests that these proteins are constitutively expressed in T cells. Experiments with HSV tk-driven expression of the CAT gene appear to show that the enhancement is activation independent. The outer palindrome contains a core sequence CTTGG...CCAAG present in the promoters of several T-cellexpressed cytokines (Fig. 2). A shorter core sequence is present in the human IL-2 promoter (TTGG...CCAA). Some of these elements (hGM-CSF, mGM-CSF, and human IL-2) also contain an A+T-rich central palindrome. The corresponding element in the IL-S gene also binds nuclear proteins (data not shown) and cross-competes with the GM-CSF sequence for the binding proteins (Fig. 7). The conserved motif is present in these genes as part of different larger palindromes, which suggests that some of the interacting proteins may be gene specific. It is interesting that these cytokines have closely related functions (GM-CSF and IL-S show eosinophil differentiating activity, and IL-4 and IL-13 cause B-cell isotype switching) and related expression patterns in human Th cells. Therefore, it is possible that this element is involved in the simultaneous expression of these genes. It is also interesting that while the palindromic element is present in hGM-CSF and mGM-CSF it is absent in mouse IL-4 and IL-S. This may have implications in the differences between the expression of IL-4 and IL-S in human and mouse T cells (3) and in the slightly different functions of human and mouse IL-S (26). The presence of a related element in the promoter of human but not mouse IL-2 may be a reflection of the fact that all human T-cell clones
Proc. Natl. Acad Sci. USA 92
(1995)
express IL-2, although at different levels (3), and therefore do not belong to the Thl or Th2 subtypes. While several transcription factors bind DNA as homodimers and their binding elements are palindromes, there is only one known element in which the two halves of the palindrome are separated by such a large distance and they bind the yeast homeodomain protein a2 (27). The a2 homodimer recognizes and binds the palindrome independent of the distance between the two halves or their orientations. However, it is active only when a second factor (MCM1) binds the intervening sequence and sets the spacing and orientation of the homeodomains of the a2 dimer. It is also striking to note that the distances between the two halves of the conserved motif in these genes are variable but that they differ by an integer number of turns of the double helix. One can speculate that if the DNA bends in the middle these sequences can always come together on the same side and interact with a homodimer protein. We thank D. Cantrell for providing us with Jurkat J6 cells and for advice on transfections and B. Luckow for plasmids pBLCAT2 and pBLCAT3. This work was supported by the National Asthma Campaign and Guy's Hospital Special Trustees. 1. Mosmann, T. R. & Moore, K. W. (1991) Immunol. Today 12, A49-A53. 2. Kamogawa, Y., Minasi, L-a. E., Carding, S. R., Bottomly, K. & Flavell, R. A. (1993) Cell 75, 985-995. 3. Romagnani, S. (1991) Immunol. Today 12, 256-257. 4. Maggi, E., Del Prete, G., Macchia, D., Parronchi, P., Tiri, A., Chretien, I., Ricci, M. & Romagnani, S. (1988) Eur. J. Immunol. 18, 1045-1050. Weiss, A. & Imboden, J. B. (1987) Adv. Immunol. 41, 1-38. 5. 6. Baldwin, G. C. (1992) Dev. Biol. 151, 352-367. 7. Warrington, J. A., Bailey, S. K., Armstrong, E., Aprelikova, O., Alitalo, K., Dolganov, G. M., Wilcox, A. S., Sikela, J. M., Wolfe, S. F., Lovett, M. & Wasmuth, J. J. (1992) Genomics 13, 803-808. 8. Lee, J. S., Campbell, H. D., Kozak, C. A. & Young, I. G. (1989) Somat. Cell. Mol. Genet. 15, 143-152. 9. Miyatake, S., Otsuka, T., Yokota, T., Lee, F. & Arai, K. (1985) EMBO J. 4, 2561-2568. 10. Miyatake, S., Seiki, M., Yoshida, M. & Arai, K.-I. (1988) Mol. Cell. Biol. 8, 5581-5587. Nimer, S. D., Morita, E. A., Martis, M. J., Wachsman, W. & 11. Gasson, J. C. (1988) Mol. Cell. Biol. 8, 1979-1984. 12. Shannon, M. F., Gamble, J. R. & Vadas, M. A. (1988) Proc. Natl. Acad. Sci. USA 85, 674-678. 13. Sugimoto, K., Tsuboi, A., Miyatake, S., Arai, K. & Arai, N. (1990) Int. Immunol. 2, 787-794. 14. Miyatake, S., Shlomai, J., Arai, K.-I. & Arai, N. (1991) Mol. Cell. Biol. 11, 5894-5901. 15. Woodrow, M., Clipstone, N. A. & Cantrell, D. (1993)J. Exp. Med. 178, 1517-1522. 16. Luckow, B. & Schutz, G. (1987) Nucleic Acids Res. 15, 5490. 17. Huebner, K., Isobe, M., Croce, C. M., Golde, D. W. & Kaufman, S. E. (1985) Science 230, 1282-1285. 18. Ausubel, F., Kingston, R., Moore, D., Seidman, J., Smith, J. & Struhl, K., eds. (1991) Current Protocols in Molecular Biology (Greene, New York). 19. Seed, B. & Sheen, J. Y. (1988) Gene 67, 271-277. 20. Staynov, D. Z. & Lee, T. H. (1992) Immunology 75, 196-201. 21. Kumar, V. & Chambon, P. (1988) Cell 55, 145-156. 22. Arai, N., Nomura, D., Virraret, D., DeWaal Malefijt, R., Seiki, M., Yoshida, M., Minoshima, S., Fukuyama, R., Maekawa, M., Kudoh, J., Shimizu, N., Yokota, K., Abe, E., Yokota, T., Takebe, Y. & Arai, K. (1989) J. Immunol. 142, 274-282. 23. Tanabe, T., Konishi, M., Mizuta, T., Noma, T. & Honjo, T. (1987) J. Biol. Chem. 262, 16580-16584. 24. McKenzie, A. N. J., Largaespada, D. A., Sato, A., Kaneda, A., Zurawski, S. M., Doyle, E. L., Milatovich, A., Franke, U., Copeland, N. G., Jenkins, N. A. & Zurawski, G. (1993) J. Immunol. 150, 5436-5444. 25. Fujita, T., Takaoka, C., Matsui, H. & Taniguchi, T. (1983) Proc. Natl. Acad. Sci. USA 80, 7437-7441. 26. Sanderson, C. J., Campbell, H. D. & Young, I. G. (1988) Immunol. Rev. 102, 29-50. 27. Smith, D. L. & Johnson, A. D. (1992) Cell 68, 133-142.
