A Single Amino Acid Substitution Confers Progesterone 6 ...

THEJOURNAL

OF

Vol. 268, No. 10, Issue of April 5, pp. 6939-6944,1993 Printed in V.S A .

BIOLOGICAL CHEMISTRV

0 1993 by The American Society for Biochemistry and Molecular Biology, Inc.

A Single Amino Acid Substitution Confers Progesterone 6@Hydroxylase Activity to Rabbit CytochromeP450 2C3* (Received for publication, October 20, 1992)

Mei-Hui Hsu,Keith J. Griffin, Yan Wang,Byron KemperS, andEric F. Johnson$ From the Scripps Research Institute, Divisionof BiochemistrylNX 4, Department of Molecular and Experimental Medicine, La Jolla, California 92037 and the $Department of Physiology and Biophysics, Uniuersity of Illinois at Urbana-Champaign, Urbana, Illinois61801

A cDNA encoding a naturally occurring variant of cytochrome P450 (P450) 2C3 that catalyzes the 66and l6a-hydroxylation of progesterone exhibits six differences of nucleotide sequence leading to five amino acid substitutions from that encoding 2C3, a progesterone lea-hydroxylase that does not catalyze GB-hydroxylation. Analysis of chimeric and mutant enzymes indicates that a Ser/Thr difference at position 364 underlies the difference between the two enzymes in GB-hydroxylase activity as well as sensitivity to the inhibitor, 16a-methylprogesterone. In addition, an Ile/ Met difference at position 178 influences the apparent K,,, for progesterone. The two mutations, S364T and I178M, together convert 2C3 to a form that exhibits kinetic properties which are similar to the 2C3v enzyme, and the reciprocal mutations in 2C3v convert it to an enzyme that resembles 2C3. Interestingly, position 364 of 2 C 3 maps to a substrate-contacting domain suggested by models for mammalian P450 enzymes based on the structure of P450cam. Ile”* is highly conserved among mammalian microsomalP450s with the exception of CYP4A and CYP19 enzymes which exhibit a Met at this alignment position.

residues that affect changes in the catalytic properties of P450s align at a position which maps toa substrate-contacting surface loop in the bacterialenzyme P450cam (4). Theregion containing these key amino acid residues is highly variable among closely related P450enzymes which have distinct catalytic functions. Wehave proposed a frameworkmodel for P450 enzymes in which substrate-contacting surface loops readily accommodate genetic changes that lead to changes in substrate specificity withoutalteringthe basic topological organization of the enzymes (3-5). Other regions are more highly conserved and may be partof basic topological features, such as the heme binding site that is required forthe reduction of oxygen. Based on this model, we have demonstrated that we could transfer a hypervariable domain from P450 2C5 to P450 2C1, two enzymes that share less than 75% amino acid identity, and confer a new catalytic activity, progesterone 21 hydroxylation, to2C1 (3). Thecharacterization of naturally occurring variants of P450 has been especially useful for identifying critical amino acids for substrate specificity and enzymaticactivity. We have characterized the biochemical properties of closely related rabbit liver P450 enzymes that catalyze 60- and 16a-hydroxylation of progesterone (6). Only one of these forms, desigThe individual cytochrome P450monooxygenases that pro- nated as SP’, catalyzes the 60-hydroxylationof progesterone, 6p-, does not (6). Bothforms vide detoxicative pathways for foreign compounds often ex- whereas the other, designated as catalyze 16a-hydroxylation, but the 60’ form exhibits a higher hibit a broad overlapping range of substrate selectivities. These enzymes can exhibit less than 40% sequence identity catalytic efficiency for this activity. In addition, 16a-methylprogesterone selectively inhibits both the 6p- and 16a-hyand catalyze the same reaction or can exhibit greater than 98% sequence identity and display distinct catalytic proper- droxylase activities catalyzed by the 60+ form, whereas it ties. Previous work has demonstrated that single amino acid slightly stimulates the 16a-hydroxylase activity of the 6pchanges can selectively add or delete the capacity to metabo- form. This activation of the 60- form is more apparent for catabolic lize a substrate from among the repertoire associated witha 5/3-pregnane-3@,20a-diol, a naturally occurring P450’ enzyme (1-3). Moreover in three cases,key amino acid product of progesterone (7). Preparationsof 2C3 isolated from outbred New Zealand White or inbred III/J rabbit liver appear * This work was supported byUnited States Public Health Service to be a mixture of both the 6p- and 6p’ forms (6, 8). In Grant GM31001 (to E. F. J.) and GM35897 (to B. K.). Facilities for contrast, preparationsof 2C3 isolated from inbred IIIVO/J or computer-assisted analysis and the synthesis of oligonucleotides are B/J rabbit liver do not contain the 6p+ form (6, 8). supported in part by General Clinical Research Center Grant M01 The complete nucleotide sequence of the cDNA encoding RR00833 and by the Sam and Rose Stein Charitable Trust, respectively. The costs of publication of this article were defrayed in part 2C3 has beenderived from apartial cDNA and gene sequences by the payment of page charges. This article must therefore be hereby for 2C3 (9, 10). Characterization of the cognate protein exmarked “aduertisement” in accordance with 18 U.S.C. Section 1734 pressed in COS-1 cells or in Escherichia coli indicates that it solely to indicate this fact. high degree of encodes the 60- form (11). Basedonthe To whom correspondence should be addressed: The Scripps Research Inst., Dept. of Molecular and Experimental Medicine, Division structural similarity expected for the two forms of 2C3, we of BiochemistrylNX-4, 10666 N. Torrey Pines Rd., La Jolla, CA reasoned that a PCR based approach could be utilized to isolate and identify a cDNA encoding the 6p’ form of 2C3 92037. Tel.: 619-554-8098; Fax: 619-554-6117. ’ The abbreviations and conventions used are: P450, cytochrome (2C3v) by using primers corresponding to the reported seP450; TLC, thin layer chromatography; PCR, polymerase chain re- quence of the 2C3 gene (9) and first strand cDNAs prepared action; SRS, substrate recognition site; diol, 5P-pregnane-3@,2Oa-diol. Mutations are indicated using the one-letter abbreviation for the from New Zealand White rabbit liver RNA. In this report,we amino acid residue that was replaced, its position in the sequence, describe the successful isolation of a cDNA encoding 2C3v GB-hydroxylation and identify five and the one-letter designation of the new residue in the indicated that catalyzes progesterone order. differences in its predicted amino acid sequence relative to 6939

6940

Characterization of a Variant Form of P450 2C3

2C3. Expression of chimeric constructs from 2C3 and 2C3v in COS-1cells and in E. coli revealed the amino acid difference at residue 364 is the determinant of the 6P-hydroxylation of progesterone. Sequence alignments (12, 13) predict that this amino acid position corresponds to a region that forms a portion of the substrate binding site within the polypeptide chain of P450cam.

proteins from their respective cDNAs in COS-1 cells (ATCC). DNA for transfection was prepared by the alkaline lysis method followed by a CsCl centrifugation (14). COS-1 cells were cultured and transiently transfected as described previously (3). The 6p- and 1601hydroxylation of progesterone was determined at 72 h after transfection by supplementation of the culture medium for 2 h with 10 PM ["C]progesterone (57.2 or 60 Ci/mol, Du Pont-New England Nuclear), followed by extraction and analysis by thin layer chromatography (TLC) on silica gel (5). Metabolites and substrate were separated by TLC as described (19), with one modification to improve MATERIALS ANDMETHODS resolution. Extractedsubstrate and products were first separated Production of P450 2C3 cDNAs by PCR-The synthesis of cDNA using benzene:ethyl acetate (3:l) prior to the use oftwo solvent from total RNA prepared from a New Zealand White rabbit liver (14) systems employed in earlier work (6). Metabolites were quantified by and its subsequent amplification by PCR using the GeneAmp PCR liquid scintillation counting. Kit followed the method described by Perkin-Elmer Cetus. Briefly, Sequence Analysis-Nucleotide sequencing utilized the dideoxyfirst strand cDNAs were prepared with MuLV reverse transcriptase nucleotide chaintermination method (20) with [ Y - ~ ~ S I ~ A T P ~ S (GIBCO/BRL) using either random 9-mers (Stratagene) oroligo(dT) (>lo00 Ci/mmol, Amersham Corp.) and T7 DNA polymerase based (Boehringer Mannheim) as primers. Double-stranded cDNAs were sequencing Kits (Pharmacia LKB Biotechnology Inc. and United then synthesized by PCR using Taq DNA polymerase and two oligo- States Biochemical Corp.). Fourteen oligonucleotide primers correnucleotide primers which correspond to the 5' and 3' ends of the sponding tothe 2C3cDNAwere utilized to verify the complete coding region of 2C3 based on the published sequence (9, 10). The sequence on both strands of all constructs. Sequencing gels consisted upstream primer, 5'-GAAGATCTGCCATGGATCTCCTCATTA- of 6% acrylamide and 7.8 M urea. The electrophoresis buffer was 1 X TCTTG-3', corresponds t o t h e n d of the coding strand of 2C3 TBE (14). In some cases, the gel was run for 1 h with 0.5 X TBE in (nucleotides -11 to +21) and contains an additional BglII site at its the upper buffer chamber and 1 X TBE in the lower buffer chamber 5' end (underlined). The downstream primer, 5"GCTCTAGATCAand then the buffer in the lower chamber was altered by addition of GACTGGAACAAAACACAGCTCA-3', corresponds t o e n d of 0.5 volume of 3 M sodium acetate, pH 5.0, to increase the number of the complementary strand (nucleotides 1478-1510) and contains an readable bases per reaction (21). additional XbaI site which is underlined. The PCR reaction utilized Heterologous Expression of 2C3 Enzymes in E. coli-ThepCW an Ericomp thermal cycler and 35 repetitions of the following cycle: expression vector was obtained from Dr. R. Dahlquist (Institute of 94 "C 1 min (denature), 55 "C 1 min (anneal), 72 "C 2 min (extend) Molecular Biology, University of Oregon, Eugene, OR) and used for followed by a single incubation for 7 min at 72 "C. The approximately the expression of 2C3 proteins in E. coli. Details for the construction 1.5-kilobase pair PCR products were isolated from 1%agarose gels of the 2C3 cDNA in pCW has been described elsewhere (11). An (SeaKem GTG grade, FMC BioProducts) and purified using the internal EcoRI site (nucleotides 431-436) and the 3'-flanking XbaI Geneclean Kit (BiolOl). Purified PCR products were digested with site were utilized for constructing the recombinant plasmids in pCW. BglII and XbaI and ligated into the expression vector, pCMV (15), The EcoRI and XbaI digested and purified fragments from the various using T4 DNA ligase (Bethesda Research Laboratories). The ligated chimeric constructs in pCMVwere transferred into the pCW2C3 DNAswereused to transform competent E. coli DH5a (Bethesda ( l l ) , previously digested with the same restriction enzymes. All Research Laboratories). Initial analysis utilized DNA purified by a constructs were verified by restriction mapping and sequence analysis. method employing hexadecyl trimethyl ammonium bromide (16). These plasmids were used to transform the E. coli strain XL-1 Blue Cloning of 2C3cDNAs from a Rabbit Liver L i b r a r y " probe, (Stratagene) which served as the expression host. CAGTGTTTGACAGAGTCACC,corresponding to nucleotides 302P450 expression was verified using the carbon monoxide difference 321 of the 2C3 cDNA, was synthesized and used to screen a rabbit spectrum ofwhole cell suspensions with the addition of 16.7 PM liver cDNA library provided by Dr. D. Russell of the University of methyl viologen to accelerate the reduction of P450 (22). The cultures Texas Southwestern Medical School (17). The oligonucleotide was were grown in Terrific broth (14) at 30 "C and harvested after 48 h. end-labeled with [ Y - ~ * P ] ~ A(>3000 TP Ci/mmol) using T4 polynucleThe P450 proteins were purified as described (11)with the following otide kinase (Stratagene). Four hybridization positive clones were modifications. The P450 proteins were eluted from the first column checked for the presence or absence of a specific SpeI restriction site. of HA-Ultrogel (IBF Biotechnics, Inc., Columbia, MD) using 0.15 M The nucleotide sequences of the longest representative SpeI+ and KPEG buffer (potassium phosphate buffer, pH. 7.4, containing 0.1 SpeI- cDNAs were determined. mM EDTA and 20% glycerol), with 0.3% Nonidet P-40, and dialyzed Construction of Chimeras and Site-directed Mutagenesis-Chimeras were constructed from the 2C3 and 2C3v cDNAs in pCMV by against 10 mM KPEG overnight. The dialyzed P450 solutions were exchanging restriction fragments, generated using the restriction concentrated, and the detergent was removed using calcium phosenzymes: BsaBI, MscI, and PpuMI. The resulting constructs were phate gel, as described earlier for preparations of2C3 from rabbit verified by complete sequence analysis. The S364T mutation in 2C3 liver (23). The proteins were eluted from calcium phosphate gel with (2C3:S364T) wasgenerated using a two-stepPCR procedure for site- 0.5 M KPEG and dialyzed against 10 mM KPEG overnight. Protein directed mutagenesis developed by Landt et al. (18).The first PCR concentrations were determined using the Pierce BCA protein assay reaction utilized as primers the aforementioned upstream primer kit (Pierce Chemical Co.) employing bovine serum albumin as the (nucleotides -11 to +21) and a specific mutagenic oligonucleotide, standard. Preparations used for kinetic characterization had specific CATGGGGCAAAGTAGTGGGG,which is complementary to nucle- contents of P450 exceeding 11 nmol/mg. P450 (10 pmol), dilauroylotides 1083-1102 2 the 2C3 cDNA. The underlined nucleotide indi- L-a-lecithin (30 gg), and 0.3 unit of purified rabbit liver P450 reduccates the mutation introduced into 2C3. The first PCR reaction tase were reconstituted and assayed for progesterone metabolism in consisted of 30 cycles of 1 min at 94 "C, 1 min a t 45 "C and 2 min a t the presence or absence of 10 PM 5P-pregnane-3P,ZOa-diol(diol) or 5 72 "C, followed by a 7-min incubation a t 72 "C. The gel-purified PCR PM 16-01-methylprogesteroneas described (6) with modifications to product and the downstream primer described above (nucleotides the TLCprocedure as described above. 1478-1510) were used as theprimers for a second PCR reaction. The RESULTS second PCR reaction consisted of 35 cycles as described above for the amplification of the 2C3 cDNAs. Both PCR reactions utilized the Isolation of cDNA Encoding the 6@* Form of 2C3"In order 2C3 cDNA as template and Vent DNA polymerase (New England to isolate and characterize the 6@' variant of 2C3, PCR Biolabs). The final PCR product was isolated from a 1%agarose gel, purified with the Geneclean Kit (BiolOl), digested with BglII and primers were designed, based on the sequence of the gene (9) XbnI, and ligated into the plasmid pCMV5 for expression in COS-1 encoding the 6/3- form of 2C3, which would yield a complete cells. The insert of the resulting construct was sequenced in its coding region and contained restrictionsites for unidirectional entirety, and the loss of the SpeI site was also verified by restriction insertion into thepCMV5 vector for the subsequent transfecmapping. tion of COS-1 cells. First strandcDNAs were generated from Expression in COS-1 Cells-The expression vector, pCMV5, obtotal liver RNA obtained from an outbred rabbit and served tained from Dr. D. Russell of the University of Texas Southwestern as templates for the polymerase chain reaction. The products Medical School and used with the permission of Dr. M. Stinski, University of Iowa, was employed for the expression of 2C3-related were expected to include both the 6p+ and 6p- forms of 2C3.

CharacterizationVariant of Form a

Val

of P450 2C3

694 1

The PCR products were isolated, ligated into pCMV, and nucleotide difference that is responsible for the loss of the 22 transformants of E. coli were chosen for preliminary char- SpeI site in2C3v. All six nucleotidedifferences were observed acterization by limitedrestrictionmappingusingBamHI, in three completely sequenced SpeI- cDNAs obtained from BspHI, EcoRI, NheI, PpuMI, SmaI, and SpeI. Interestingly, three independent PCR reactions, whereas the SpeI+ cDNAs a SpeI sitewas not present in four of the 22 clones, suggesting corresponded to 2C3. We sought to confirm the natural octhat they mightencode a variant of 2C3. When thefour SpeI- currence of all six of these nucleotide differences in partial clones were expressed in COS-1 cells, progesterone was hycDNAsobtainedfromanindependentrabbit livercDNA droxylated a t both the 6p- and l6a-positions (Fig. l ) , indicat- library which had been generated without PCR amplification. ingthatthesecDNAsencodedthe 6/3+ form of 2C3. In SpeIdigestionwas used to distinguish the partial cDNAs contrast, cells transfected with the SpeI+ clones exhibited correspondingtoeither 2C3v or 2C3. Of the four clones as expected for2C3 (11).If cells examined, one was found tobe SpeI-. A representative clone only 16a-hydroxylase activity transfected with the latter clones exhibited GP-/lGa-hydrox- foreachcDNAwas completelysequenced. All six of the ylase activity ratios similar to that of the SpeI- clones, 6P- nucleotide differencesobserved betweenthe PCR-derived2C3 hydroxylase activity would have beenreadily detected in these and 2C3v cDNAs were also found to exist in the corresponding experiments based on the levels of 16a-hydroxylation detected cDNAsobtainedfromtherabbit liver cDNA library. No for cultures transfected with the SpeI+ clones. Thus, theSpeI' additional differences between the SpeI- and SpeI+ cDNAs and SpeI- clonesreflect variants of 2C3 which differ in their were noted in the 3"untranslated regions. capacity tocatalyze the GB-hydroxylation of progesterone. Heterologous Expression of 2C3u"Although the expression Complete sequence analysisof three SpeI+ and three SpeI- of the 2C3v in COScells established that theenzyme catalyzes PCR derived cDNAs revealed six nucleotide differences bethe 6P-hydroxylation of progesterone, it is difficult to detertween 2C3 (SpeI+) and 2C3v (SpeI-) which resulted in five mine the concentrationsof P450 enzymes expressed in COSamino aciddifferences and one silent mutation (Table I). The 1 cells and, thus, to precisely define the turnover number of serinelthreonine difference at position 364 reflects a single the enzyme. Expression of these enzymes inE. coli, and their subsequent isolation and characterization provides a means Mock Spe I+ Spe Ifor a more complete determinationof their enzymic properties for comparison to preparations of P450 3b from rabbit liver microsomes. In addition, larger amounts of enzyme can be obtained moreeconomically to facilitate this characterization. Progesterone For this purpose, the N-terminal coding sequence of the 2C3v cDNA was modified to facilitate heterologous expression in E. coli as described earlier for 2C3 (11).The 2C3v-encoded protein expressed in E. coli was purified and reconstituted with reductase. The enzyme exhibits an apparent K,,, of 1.2 p~ and a VmaX of 5.6 pM/min/pM P450 for the 6P-hydroxylation of progesterone and a K,,, of 1.4 p M and a V,,, of 2.0 pM/min/pM P450 for the 16a-hydroxylation of progesterone. GB-OH-P Preparations of 2C3 from rabbits that contain both the 6/3+ and 6P- forms of 2C3 exhibit a K,,, estimated to be less than 1 pM, with a Vmaxin the range of 1-3 pM/min/pM P450 for 6P-hydroxylation of progesterone (6, 8). Kinetic parameters 16a-OH-P for the high-efficiency 16a-hydroxylase activity catalyzed by 6P+ preparations of P450 3b purified from rabbit liver had been estimated by subtraction of the component arisingfrom the low efficiency 6P- enzyme toyield values forK,,, of 0.3 p M and for Vmaxof 0.5 pM/min/pM P450. FIG. 1. Progesterone metabolism by COS-1cells transfected The inhibitor, 16a-methylprogesterone, was found to inwith PCR-derived P450 2C3 cDNAs. 2C3 cDNAs could be hibit the 6p- and 16a-hydroxylation catalyzed by reconstiseparated into two groups based on the presence or absence of a SpeI for restriction site. COS-1 Cells were transfected with the pCMV5 vector tuted 2C3v (Fig. 2). Theseresultsmirrorthosefound alone (Mock)or thevector containing the SpeI+or SpeI- 2C3 cDNAs. preparations of P450 2C3 from rabbit liver that contain the Forty eight hours after transfection, the medium was removed and 6p' form and support the conclusion that 2C3v encodes the replaced by medium containing 10 PM ['4-C]progesterone. After a 2- form of 2C3 catalyzing progesterone 60-hydroxylation. h incubation at 37 "C, the medium was removed and analyzed. An When 10 p~ 5P-pregnane-3@,20a-diol was included in the autoradiogram of the thin layer chromatogram for one example of reconstitution assay, the efficiency of the 16a-hydroxylation each is shown. The mobilities of unmetabolized progesterone and of catalyzed by 2C3v was increased reflecting a lower K , for the metabolites, 60-hydroxyprogesterone (GB-OH-P) and16a-hydroxyprogesterone (16a-OH-P),are indicated at theright. progesterone and a higher V,,,,,. A similar effect of 5P-pregnane-3@,20a-diol on the6P-hydroxylase activity of 2C3v was TABLE I also observed(Fig. 2), although this effect was relatively small Seauence comDarison between2C3 and 2C3u and had not been reported previously for preparationsof P450 2C3 2C3v 2C3 from rabbit liver that contain the6/3+ form (8). Position # T364S Is Necessary for the 66-Hydroxylation of ProgesterAmino acid Codon Amino acid Codon one by 2C3u"Chimeric cDNAs were constructed by exchang178 Ile Met ATG ATC ing restriction fragments between2C3 and 2C3v in the mam256 Ser TCG Leu TTG malian expression vector pCMV5 in order to identify which Thr ACT 364 Ser AGT 368 Ala GCA Ala GCG of the amino acid differences between 2C3 and 2C3v deter472 Glu GAA GAT ASP mine the ability of 2C3v to catalyze 6p-hydroxylation. Expres476 Leu CTC GTC sion in transfected COS-1 cells combined with an in vivo

6942

2o 1.6

’.*

0.0

Characterization of a Variant Form

7

1

1 B”

No Addition

0.4 OIOl

0.0 0.0

0.2

0.4

0.6

0.8

1 1.0

of P450 2C3

also a determinant for selective inhibition by 16a-methylprogesterone. For the single mutants, this inhibitorwas found to inhibit progesteroneSP- and 16a-hydroxylationscatalyzed by 2C3:S364T as is seenfor 2C3v, but under the same conditions, itdidnotinhibitthe16a-hydroxylation catalyzed by the 2C3v:T364S as is observed for 2C3 (not shown). 2C3:S364T was also seen to exhibit similar values of Vmaxfor the 6p- and 16a-hydroxylase activities as 2C3v. However, two results indicate the involvement of other amino acids in the kinetic differences observed between 2C3 and 2C3v. The K,,, values for progesterone observed for 2C3:S364T were about %fold higher for 16a-hydroxylation and2-fold higher for 6P-hydroxylation than the respective K,,, values obtained from 2C3v (Table 11). Moreover, the 2C3v:T364S mutant exhibited a higher catalytic activity than2C3 over the rangeof substrate concentrations examined (Fig. 4). These results suggest that one or more of the four remaining amino aciddifferences influence the relative values of apparent K,,, for progesterone exhibited by the two enzymes. Additional Amino Acid Differences Contribute to the Distinct Enzymic Properties of 2C3 and 2C3u”In order to identify which of the four remaining aminoacid differencescontribute to differences between the single mutants and the parental enzymes in their apparent K,,, for progesterone, additional chimeras were constructed and heterologously expressed in E. coli. Characterization of these chimeras indicated that the I178M difference contributes to differences in the apparent Km for progesterone between 2C3, 2C3v, and the single mutants in which residue 364 is exchanged. As shown in Fig. 4, the mutation I178M increases the catalyticefficiency of 2C3, and this single mutant (2C33178M) exhibits kinetic properties similar to that of the 2C3v:T364S mutant. Introduction of the M178I mutation into 2C3v:T364S converts the latter into an enzyme that is similar to 2C3 (Fig. 4). The reciprocal mutations in 2C3 (S364T and I178M) convert 2C3 into an enzyme which exhibits V,,, and K,,, values for both the 16aand 6P-hydroxylations of progesterone that are very similar to those exhibitedby 2C3v (Table 11).

7-77 21

No Addition

1.4

~

V.U

0.0

0.2

0.4

0.6

0.8

1.0

FIG. 2. Lineweaver-Burk plots for the GB-hydroxylation (A) and lea-hydroxylation ( B ) of progesterone as catalyzed by purified reconstituted P450 2C3v. The protocols for reconstitution and the progesterone assay are described under “Materials and Methods.”The activity was determined inthe presence of 10 F M 5@-pregnane-3P,ZOa-diol (A), 5 p M 16a-methylprogesterone(a), or in the absence of either effector (e).

DISCUSSION

The results reported herein demonstrate 2C3 thatand 2C3v are structurally highly related P450s that differ in their capacity to catalyze the6P-hydroxylation of progesterone. The cDNA corresponding to the 6p’ form (2C3v) differs a t only six nucleotide positions from the reported sequence of 2C3 progesterone assay was used to qualitatively assess the ability 5 amino acid of each chimeric protein to catalyze progesterone6P-hydrox- (9), andthese nucleotide changesresultin differences between 2C3v and 2C3. Analysis of hybrid enylation. These constructs and their capacity to catalyze the zymes expressed from chimeric constructs between the 2C3 6P-hydroxylation of progesterone are summarized in Fig. 3. Hybrids inwhich N- or C-terminalregions of 2C3 (containing and 2C3v cDNAinCOS-1 cells indicates that the S364T changes a t positions 178 and 256 or 472 and 476, respectively) difference is responsible for the phenotypic difference in the were replaced with those of 2C3v did not confer 6P-hydrox- expression of progesterone 6P-hydroxylase activity between ylaseactivity. In contrast, substituting alarger C-terminal 2C3 and 2C3v. However, when the kinetic properties of the fragment of 2C3vfor that of 2C3, including the S364T change,2C3v and 2C3:S364T proteins purified from E. coli were did confer the6P-hydroxylase activity. These results indicate compared, the single S364T change introduced into 2C3 did that the capacity to catalyze 66-hydroxylation is dependent not fully mimicthe enzymic characteristics of 2C3v. Although on the presenceof a threonine residue at position 364 rather 2C3v and 2C3:S364T each had a similar Vmaxfor the 6P- and than a serine. To confirm this, thereciprocal point mutations 16a-hydroxylase activities, the 2C3:S364T mutant displayed were made in 2C3 and 2C3v. The single mutation, S364T, in a higher apparent K,,, for both progesterone hydroxylase ac2C3 confers 6P-hydroxylase activity t o 2C3, whereas the re- tivities than 2C3v (Table 11). This ObSeNatiOn suggested that some or allof the other4 amino acid differences between2C3 ciprocal mutation in 2C3v deletes this activity. The two single-mutant proteins, 2C3:S364T and and 2C3v contribute to these differences. This situation is 2C3v:T364S, were expressed in E. coli with a modified N- also evident when comparing the 16a-hydroxylase activityof 2C3v:T364S with that of 2C3. 2C3v:T364S displays a higher terminalmembraneanchordomain (11) andpurifiedfor detailed kinetic characterization following reconstitution with catalytic efficiency than 2C3 but is not as efficient as 2C3v. P450 reductase. The Ser/Thr difference at position 364 not Characterization of additional chimeric constructs indicates that theI178M mutation combined with the S364T mutation only determines the enzyme’s capacity for 6P-OH, but it is

6943

Characterization of a Variant Formof P450 2C3 FIG. 3. Schematic representation of P46O2C3,2C3v, and various chimeric constructs. The presence or ab-

1

SRSs

2C3

4

n

progesterone sence of detectable 6P-h~2C3v droxylase activity following the transfecwith tion cells of COS-1 the construct is A indicated. Chimericconstructs were preB pared from 2C3 (0) and 2C3v (0)as S described under "Materials and Meth2C3:S364T ods." The eachcorresponding for name clone is indicated in the left column. The position of the substrate recognition 2C3~T364S sites (SRSs) proposed by Gotoh (26) are I indicated on the top line. The right column (6P-OH ACTj indicates the pres-

2 3

U

ence or absenceof GB-hydroxylaseactivity as determined for that construct.

TABLEI1

-

-

n

n "

w

-

n

fi "

w n

n

-

I

6B-OH

6

Yes

I

-

n

-

No Yes

No

n

Y

-

ACT.

No

P,

1

100

5

Yes

""

..

No

n

I

I

I

I

200

300

400

500

Amino Acid

Whenthe sequence of2C3v iscomparedwiththat of P450cam for which a three-dimensional structure isavailable (24), using thesequence alignments of either Laughton et al. (13) or Nelson and Strobe1 (12), Thr3'j4corresponds to oneof the proposed substrate contact residues in P450cam, Valzg5. Atkins and Sligar(25) found that alterations of Valzg5in 68 hydroxyl16a hydroxylP450cam to anIle or Ala residue decreased the stoichiometry ation ation Enzyme between productformationand oxygen consumptionand K," V,. K, V,. altered the regiospecificity of product formation from camNM nin" PM min" phor, 1-methylnorcamphor, and norcamphor (25). In addition, 1.2 5.6 2.0 1.4 2C3u others have reported single amino acid substitutions in mam4.4 2C3:S364T 2.5 7.2 11.4 malian P450s in this region that alter catalytic activity. A 2C3:I178M.S364T 0.8 9.7 1.8 1.8 L365M substitution which aligns in close proximity to T364 of 2C3v confers the coumarin hydroxylase activity of P450 9.0 I380F substitution 2A5 toP450 2A4 (1). Inaddition,an restores the selective loss of bufuralol metabolism to a mutant 8.0 form, 2Dlv, of the rat debrisoquinehydroxylase,2D1 (2). These differences lie within SRS-5, one of six substrate rec7.0 ognition sites proposed by Gotoh (26) for mammalian P450s 6.0 based on sequence alignments with P450cam generated from comparisons of amino acid similarity, hydrophobicity, and 5.0 predicted secondary structure. Thus, our observation that an amino acid withinSRS-5underliesthe difference in 604.0 hydroxylase activity exhibited by variant forms of 2C3 and that this position occurs in close proximity to otherkey amino 3.0 acid differences determined experimentally supports the as2.0 signment of Gotoh (26). In contrast, the I178M difference between 2C3 and 2C3v 1.o that underlies differences between the two variants in their apparent K,,, for progesterone falls outside of SRS boundaries 0.0 proposed by Gotoh (26). Ile is highly conserved at this align0.0 10.0 20.0 30.0 ment position among all members of P450 families 1,2, 3, 17, and21(12). Asingle mutation (1172N) atthisalignment Progesterone 1"( position in human CYP2lA results in the loss of the steroid FIG. 4. Dependence onthe initial substrate concentrationof 21-hydroxylase activity that underliessome forms of adrenal the rate of 16a-hydroxylation of progesterone as catalyzed by purified reconstituted 2C3 (A), 2C3v:T364S (O), 2C3v: hyperplasia (27, 28). It is interesting to note that a Met is M178I,T364S (V),and 2C3:1178 M (0).As observed for prepa- found at this position in the aromatase enzyme and among family 4A P450s (12). Based on alignments with P450cam rations from B/J and IIIVO/J rabbits (6-8), 2C3 cannot be readily characterized by V,, and K,,, parameters in the absence of positive (12, 13, 26), residue 178 falls in helix E which is far from the effectors (11).The lines shown for 2C3 and 2C3v:M178I,T364S are heme-binding region and proposed substrate pocket (12, 25). linearregressionlines. The lines shown for 2C3v:T364S and a mutation inhelix E could alter its contact 2C3:1178M are predicted from a nonlinear least squares fit of the We speculate that with helix I, resulting in a shift in the positions of the helix data to the Michaelis-Menton equation. Estimated values for V,, are 31.8 and 19.8 min" and for K, are 62.8 and 45.6 PM,respectively. F-helix G loop which includesSRS-2 andSRS-3. Such a shift might contribute to the observed difference in K,. of 2C3v. These can confer a K, to 2C3 that is similar to that Gotoh (26) has noted that the SRS regions of family2 results suggest that methionine 178 improves the enzymeenzymes often exhibit higher frequencies of nonsynonymous substrate interaction, whereas 6P-hydroxylase capacity is con- substitutions when compared with other regions. In this referred by threonine 364. gard, it is worth noting thatfive of the six nucleotide substiCatalytic activities toward progesteroneof 2C3v, 2C3:S364T, and 2C3:Z178M,S364Tpurified P450 proteins Kinetic parameterswere estimated by linear regression analysisof double-reciprocal plotsof data pooled fromat least three independent assavs.

Characterization Variant of Form a

6944

of P450 2C3

5. Kronbach T. Larabee T. M., and Johnson, E. F. (1989) Proc. Natl. Acad. tutions were nonsynonymous for 2C3/2C3v and that threeof Sci. U. 8. A. 86,8262-8265 6. Dieter, H. H., and Johnson, E.F. (1982) J. Biol. Chem. 257,9315-9323 the five fall in SRS regions. This suggests that selective 7. Johnson, E. F., Schwab, G. E., and Dieter, H. H. (1983) J. Bid. Chem. pressure may have contributed to the occurrence of distinct 3. " ,,K S 97Q5"?7%2 -." 8. Schwab, G. E., and Johnson, E. F. (1985) Biochemistry 2 4 , 7222-7226 enzymic forms of 2C3. 9. Cban, G., and Kemper, B. (1990) Biochemistry 2 9 , 3743-3750 Heterologous expression of P450 enzymes at high levels 10. Leighton, J. K., DeBrunner-Vossbrinck, B. A., and Kemper, B. (1984) Biochemistry 23,204-210 and their subsequent purification, as demonstrated herein, 11. Richardson, T. H., Hsu, M.-H., Kronbach, T., Barnes, H. J., Chan, G., Waterman. M. R., Kemper, B.. and Johnson,E. F. (1993) Arch. Biochern. could eventually leadto a crystal structurefor the mammalian Biophys. 300,510-516- . . P450s. This will elucidate the mechanisms governing subIson, D. R., and Strobel, H. W. (1989) Biochemistry 28,656-660 strate binding as well as the inhibition and activation of P450 catalysis by negative and positive effectors.The interpretation . . of structural information obtained from crystallography must, Harbor, NY 15. Andersson, S., Davis, D. L., Dahlback, H., Jornvall, H., and Russell, D. W. necessarily, accommodate functional information. Mutagen(1989) J. Biol. Chem. 264,8222-8229 esis studies, such as this one, should compliment crystallo16. Del Sal, G., Manfioletti, G., and Schneider, C. (1989) BioTechniques 7 , 514-519 graphic studies by providing clues to deciphering the struc17. Yamamoto, T., Bishop, R. W., Brown, M. S., Goldstein, J. L., and Russell, tural characteristics which determine function. D. W. (1986) Science 232,1230-1237

Acknowledgments-We acknowledge Drs. H. J. Barnes, M. R. Waterman, and T. H. Richardson for their helpful suggestions concerning heterologous protein expression in E. coli. We also thank the Sam and Rose Stein trust for supporting the DNA Core Laboratory, Department of Molecular and Experimental Medicine, The Scripps Research Institute. REFERENCES 1. Lindberg, R. L. P., and Negisbi, M. (1989) Nature 339,632-634

2. Matsunaga, E., Zeugin, T., Zanger, U. M., Aoyama, T., Meyer, U. A., and Gonzalez, F. J. (1990) J. BioL Chem. 265,17197-17201 3. Kronbach, T., Kemper, B., and Johnson, E. F. (1991) Biochemistry 3 0 , 6097-6102 4. Johnson, E. F.(1992) Trends Phrmacol. Sci. 13,122-126

18. Landt O., Grunert H.-P. and Hahn, U. (1990) Gene (Amst.) 9 6 , 125-128 19. Diete;, H. H., Mull&-Ebe;hard, U., and Johnson,E. F. (1982) Science 2 1 7 ,

."

741-742 I "

20. Sal-,", neer. F.. Coulson, A. R., Barrell, B. G., Smith, A. J. H., and Roe, B. A. (1980) J. Mol. Biol. 1 4 3 , 161-178 21. Brummet, S. R. (1991) United States Biochemical Editorial Comments, Vol. 17 p. 22, United States Biochemical Co Cleveland, OH 22. Petekon, J. A., White, R. E., Yasukochi, !?:Coomes, M. L., OKeeffe, D. H., Ebel, R. E., Masters, B. S. S., Ballou, D. P., and Coon, M. J. (1977) J. Bid. Chem. 252,4431-4434 23. Johnson, E. F.(1980) J. Biol. Chem. 255,304-309 24. Poulos, T.L., Finzel, B. C., and Howard, A. J. (1987) J. Mol. Biol. 1 9 5 , ~ ".~ 7 - 7 n n 25. Atkins, W. M., and Sli ar, S. G (1989) J. Am. Chem. SOC. 111,2715-2717 26. Gotoh 0.(1992) J. Biof Chem. 267,83-90 27. Amor 'M. Parker K.L. Globerman, H., New,M. I., and White, P. C. ( 1 9 b ) h o e . Noh. A c d Sci. U. S. A. 8 5 , 1600-1604 28. Tusie-Luna, M.-T., Traktman, P., and White, P. C. (1990) J. Biol. Chem. 265,20916-20922

n