David A. WilcoxS§, Jean Luc Wautiem Dominique Pidardll, and Peter J. Newman$§**. From the $Blood Research Institute, The Blood Center of Southeastern ...
THEJOURNAL OF B~omrcu.CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc.
Vol. 269, No. 6 , Issue of February 11, pp. 4450-4457, 1994 Printed in U S A .
A Single Amino Acid Substitution Flanking the Fourth Calcium Binding Domainof aImPrevents Maturationof the aImp, Integrin Complex* (Received for publication, August 24, 1993, and in revised form, October 21, 1993)
David A. WilcoxS§, Jean Luc Wautiem Dominique Pidardll,and Peter J. Newman$§** From the $Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, Wisconsin 53233, the §Departments of Cellular Biology and Pharmacology, The Medical College of Wisconsin, Milwaukee, Wisconsin 53226, the llLaboratoire Biologie Vasculaire et Cellulaire Hopital Lariboisiere, Paris 75010, France, and the lpnserm U. 353, H6pital Saint-Louis, Paris-75475, France
To define specific structural domains involved in theadhesive ligands, including fibrinogen, von Willebrand factor, biosynthesis and processing of integrin subunits,we ex- and fibronectin (1).Similar to integrins on other cell types, amined the biosynthesis of normal and mutated forms of isa heterodimeric complex comprised of a (GPIIb = GPIIb-IIIa the platelet-specific integrinaIIbP3. Platelet mRNA was a ~ ~and b ) p (GPIIIa = p3) subunits that associate in a noncovaisolated from a Glanzmann thrombasthenic patient who lent, calcium-dependent manner (2-5). Normal human platefailed to express significant levels of the glycoprotein lets containapproximately 40,000-50,000 GPIIb-IIIa com(GP) IIb-IIIa complexon the platelet surface. Sequence plexes on their cell surface. analysis of polymerase chain reaction-amplified platelet Pulse-chase studies of the kinetics of biosynthesis of the GPIIb mRNA revealed aGly418 “* Asp amino acid substi- GPIIb-IIIa complex in cultured human leukemic and megatution inGPIIb. Gly418 is a highly conserved residue that karyocytic cell lines haveadvanced our understandingconcernflanks the fourth calcium binding domainGPIIb. of Co- ing manyof the key steps that takeplace during the synthesis, transfection of Asp418GPIIb and GPIIIa plasmid con- assembly, and processing of GPIIb-IIIa (6-13). GPIIb is synthestructs intoCOS-7 cells resulted in the accumulation of sized as a single chain ( M , 145,000) precursor (6) thatassocia pre-GPIIb-IIIa complex that failed to reach the cell ates with GPIIIa ( M , 95,000) within theendoplasmic reticulum surface, in effect recreating the thrombasthenic phenoof the cell (10, 12, 14). The pre-GPIIb-IIIa complex is then type. Pulse-chase and endoglycosidase studies demon- transported to the Golgi apparatus, where sugar modification strated that the biosynthetic blockade occurred in aandprecleavage of GPIIb intoa heavy ( M , 125,000)and light chain Golgi compartment. Removal of the negatively charged ( M , 23,000) takes place (13). GPIIb heavy and light chains carboxyl group of Asp418 GPIIb, creating Ala418 GPIIb, remain covalently linked by a single disulfide bond. Following rescued intracellular transport and surface expression of the integrin complex. Mutagenesis of a homologous these processing events within the Golgi, the mature GPIIba subunit a, also resulted in the IIIa complex is then transported to the cell surface, where it Gly within the integrin failure to expressa,ps on the cell surface. These results exists in a resting state awaitingcellular activation. Glanzmann thrombasthenia is a rare, inherited, autosomal suggest that the presenceof a small, uncharged amino recessive bleeding disorder, the hallmarkof which is the failure acid 6-8 residues amino-terminal to the calcium coordiof platelets to bind fibrinogen and aggregate following stimunation complex is crucial for the proper folding and lation by physiologic agonists such as ADP, thrombin, epinephmaturation of integrin complexes. rine, or collagen. In 1972, Caen proposed the firstclassification of Glanzmann thrombasthenia based on platelet intracellular fibrinogen contentand theability of platelets to retracta fibrin Integrins are a family of cell surface glycoproteins that me- clot (15). Type I patients, representing 80% of those studied, diate theadhesion of cells to each other and to the extracellular lacked platelet fibrinogen and clot retraction, whereas type I1 matrix during a variety of cellular processes, including hemo- thrombasthenic plateletscontained appreciable levels of platestasis, wound healing, metastasis, and the immune response. let fibrinogen and maintained some clot retraction capability. The glycoprotein (GP)’ IIb-IIIa complex is a platelet-specific Soon thereafter, SDS-polyacrylamide gel electrophoresis analmember of the integrin family of adhesion receptors which ysis of thrombasthenic plateletsshowed a deficiency of GPIIbmediates the interaction of activated platelets with a number of IIIa expression (16-18), and it was later shown that type I Glanzmann thrombasthenia patients lacked detectable levels * This investigation was supported in part by ‘National Institutes of of GPIIb-IIIa, whereas type I1 platelets expressed moderate Health Grant HL-44612 (to P. J. N.) and by an American Heart Asso- (15-25%) levels of this glycoprotein (19-22). So-called “variant” ciation (Wisconsin Affiliate)predodoral fellowship award (to D. A. W). The costs of publication of this article were defrayed in part by the forms of thrombasthenia havealso been described with increaspayment of page charges. Thisarticle must thereforebe hereby marked ing frequency and arecharacterized by having normal to near “aduertisenent” in accordance with 18 U.S.C.Section 1734 solely to normal levels of a dysfunctional form of GPIIb-IIIa present on indicate this fact. the cell surface (23-26) Platelets from type I, type11, and var** Established Investigator (92001390)of the American Heart Association. To whom correspondence should be addressed: Blood Research iant patients are functionally indistinguishable, in that all Institute, The Blood Center of Southeastern Wisconsin, 1701 W. Wis- have in common the complete failure to bind the adhesive liconsin Ave., Milwaukee, WI 53233. Tel.: 414-937-6237; Fax: 414-937- gand fibrinogen and self-associate (aggregate) in response to 6284. physiologic agonists such as ADP, thrombin, or epinephrine. The abbreviations used are: GP,glycoprotein;PCR,polymerase Analysis of the effects of molecular genetic defects in either chainreaction;DMEM,Dulbecco’smodifiedEagle’smedium;DPBS, Dulbecco’sphosphate-buffered saline; CAPS, 3-[cyclohexylaminol-1- GPIIb or GPIIIa (27-33) as well as examination of the expression of recombinant forms of GPIIb and GPIIIa in mammalian propanesulfonic acid; Endo H, endoglycosidase H.
4450
Amino Acid Substitution Prevents
L Y I I ~ P Complex S
Maturation
445 1
tor pGEM-'lzf(+)(Promega).The Transformer site-directed mutagenesis kit (Clontech, Palo Alto,CA) along with two single-nucleotide mismatched primers were utilized to construct each av cDNA that encoded a mutated form of av. A single-nucleotidemismatched primer (5'-ATGCTCCTCTCGACTCGAGG-3'),which abolishes a unique restriction site (XbaI) on pGEM-7zA+), was utilized to allow positive selection of mutated clones. Single-nucleotide mismatched primers (5"GCCACCAAGC'RTGACTATTCAATG-3')and (5'-GCCACCAAGC""l'GCCTATTCAATG-3') from base 1331 to 1355of av were utilized to construct two mutant forms of av.Duplicate cDNA clones encodingmutant forms of av were characterized by nucleotide sequence analysis with sense primer (5'-TGGAAGATCAACAGGCTTGAACGC-3') from base 1262 to 1285 of av cDNA to confirm the presence of the mutation and proper incorporation of the primer. The cDNA was excised from pGEM-7zf(+) with EcoRI and ligated into the mammalian expression vector EMC3. One mutant form of GPIIb was also constructed by this method; however, a cartridge containing the mutation was removed with the unique restriction enzymes BsmI and AccI and exchanged for the wild-type sequence as described above. Mammalian Cell IFansfection-COS-7 cells were obtained from the American Type Culture Collection. The cells were cultured at 37 "C in 5% C02in Dulbecco's modified Eagle's medium (DMEM) (Life Technologies, Inc.) containing 2 m~ glutamine and 10%fetal calf serum. Cells EXPERIMENTALPROCEDURES were lifted with trypsin and plated at 8.5 x lo5 celldl0.0-cm plate at 12 Antibodies-The monoclonal antibody Tab, specific for GPIIb (34), h before transfection. Each plate of COS-7 cells was washed twice with was a generous gift fromDr. Rodger McEver(University of Oklahoma). 5 ml of Dulbecco's phosphate-bufferedsaline (DPBS)(Life Technologies, The monoclonal antibody AP3, specific for GPIIIa, has been described Inc.) and then transfected with 1-2 pg of full-length GPIIbiEMC3 (35). The monoclonal antibody AP2, which recognizesan epitope on the andor GPIIIa/EMC (kindly provided by Dr. Gilbert C. White, UniverGPIIb-IIIa complex (36), was kindly provided by Dr. Robert R. Montsity of North Carolina at Chapel Hill) andor aViEMC3in the presence gomery (Blood Research Institute, The Blood Center of Southeastern of DEAE-dextran (39). Cells were allowed to incubate with rocking at Wisconsin, Milwaukee,WI). The monoclonal antibody 10E5, specific for 37 "C for 30 min. Next, 18 ml of DMEM containing 80 p~ chloroquine the GPIIb-IIIa complex,was kindly supplied byDr. Barry Coller (Sigma)was added to the cells, and incubation continued a t 37 "C for2.5 (SUNY-Stony Brook). h. After the medium was removed, 2 mlof 10% dimethyl sulfoxide Platelet Membrane Glycoprotein Analysis-Platelets from both nor(Fisher Scientific)was added to the cells for2 min. The transfected cells mal and thrombasthenic individuals were prepared by differential cenwere incubated in DMEM for 48 h before metabolic labeling or 72 h trifugation of acid citrate dextrose anticoagulated whole blood as de- before cell surface labeling with biotin. scribed previously (37).Twenty micrograms of total platelet protein was MetabolicLabeling of COS-7Cells-Transfected cells were incubated and electrophoresed in DMEM without methionine for 30 min and then pulsed at 37 "C for added to each well of a 7% SDS-polyacrylamide gel under nonreducing conditions. Following transfer to nitrocellulose 30 min with [35Slmethionine(600 pCi/plate) (DuPont-NEN).After the membranes and incubation with rabbit polyclonal antiserum directed pulse, the plates were washed 3 times with 7 ml of DPBS containing 1 against GPIIb or GPIIIa (1:1,000 dilution), the presence of GPIIb and mg/ml coldmethionine (Sigma).The chase was initiated by the addition GPIIIa was revealed by incubation with lZ5I-proteinA andexposure to of DMEM containing 1 mg/ml coldmethionine for 0,1 , 2 , 4 , 8 ,and 22 h x-ray film for 3.5 days. at 37 "C. Cells werewashed five times with 5 ml of DPBS containing 1 Amplification of Platelet MessengermRNA-Platelet messenger mg/ml cold methionine and solubilized in 1 ml of lysis buffer (50m~ mRNA was isolated from 50 ml of whole blood and reverse transcribed Tris-HC1, pH 7.4, 150 m~ NaCl, 1% Triton X-100, and 2 m~ phenylinto cDNA using random hexamers (Pharmacia LKBBiotechnology methylsulfonylfluoride). Lysates were then vortexed for 30s and incuInc.) and Moloney murine leukemia virus reverse transcriptase (Life bated on ice for 30 min with occasional vortexing. Samples were cenTechnologies, Inc.) using a slight modification of a method described trifuged at 16,000 x g for30 min at 4 "C. The supernatant was previously (38). The cDNA was divided into four aliquots, and four transferred to a new tube and stored at -80 "C. overlapping segments spanning the entire length of the GPIIb mRNA Immunoprecipitation Analysis-Lysates were precleared with 50 pl transcript were amplifiedby the polymerase chain reaction (PCR)using of a 50% slurry of protein A-Sepharose (Sigma) containing 10%bovine Vent polymerase (New England Biolabs, Beverly,MA). Secondary over- serum albumin and 10 pg of preimmune mouse IgG (Bio-Rad) (monolapping PCR products were synthesized and directly characterized by clonal immunoprecipitations) or 25 pg of preimmune rabbit IgG (polynucleotide sequence analysis using the Sequenase kit (U. S. Biochemi- clonal immunoprecipitations). Each sample was mixed for 30 min at cal Corp.), or in some cases cloned into pGEM&f(+) vector (Promega, room temperature. The beads were separated from the supernatant by Madison, WI) before performing nucleotidesequence analysis. centrifugation at 16,000 x g for 5 min, and the supernatant was then PCR-based Cartridge Mutagenesis of GPIIb cDNA-The full-length incubated in the presence of 10 pg of monoclonal or 25 pg of polyclonal cDNA encoding wild-typeGPIIb (generous gift of Dr. Morty Poncz, Chil- antibody for 18 h at 4 "C with mixing. Five micrograms of goat antidren's Hospital of Philadelphia) was cloned into the plasmid vector mouse IgG was added toreactions containing monoclonal antibodies of pGEM-7zf(+)(Promega).A 536-base pair PCR product derived fromthe the IgGl subclass, which was mixed for 1h at room temperature. Fifty platelet mRNA of Glanzmann thrombasthenic patient LM was microliters of a 50% slurry of protein A-Sepharose was added to each amplified byPCR from base 904 to 1440 with sense primer (5'- reaction and mixed for1 h a t room temperature. The samples were then GGATTCCTACTACCAGAGGCTGC"') from base 904 to 926, and anti- centrifuged a t 16,000 x g for 5 min, and the supernatantwas discarded. sense primer (5'-CTGTACACAGCCACCTGGTTGG-3') from base 1440 The beads were washed fivetimes in 1.0 ml of 50 m~ Tris-HC1, pH 7.4, to 1419. This PCR product, containing a nucleotide substitution, as well 150 m~ NaCI, and 1%Triton X-100 immunoprecipitation buffer. Beads as the wild-type GPIIb cDNA were treated with the unique restriction were then placed in 50 pl of 2 x reducing buffer (4%SDS, 10%p-merenzymes BsmI and AccI (New England Biolabs). The restriction-di- captoethanol, 100 m~ Tris-HC1, pH6.8,10%glycerol, and 0.001%bromgested PCR cartridge was exchanged for the wild-type sequence to phenol blue). Samples were boiled for 10 min, centrifuged, and then construct the cDNA that encodes the mutated form of GPIIb found in electrophoresedovernight a t a constant 40 volts ona 7% SDS-polyacrylpatient LM. The cDNA was excised frompGEM-7zf(+)with EcoRI and amide gel. The gel was fixed in 45% methanol, 12%acetic acid for 30 ligated into the mammalian expression vector EMC3(Gift of Dr. Glenn min, incubated in Enlightening (DuPont NEN) for 30 min, dried, and Larsen, Genetics Institute, Boston, MA). The cDNA encoding LMs ' exposed to Kodak XRP film for8-20 h at -80 "C. GPIIb was characterized by nucleotide sequence analysis to confirm the Endoglycosidase H (Endo H) IFeatment-Protein A-Sepharose beads presence of the mutation and proper insertion of the PCR cartridge into containing immune complexes of murine IgG and metabolically labeled the wild-type GPIIb cDNA. GPIIb-IIIa complexes were washed five times with 1.0 ml of immunoSite-directed Mutagenesis of av and aIIbcDNA-The full-length precipitation buffer as described above and divided into two aliquots. cDNA encoding wild-type av (generous gift of Dr.David Cheresh, The immunoprecipitates were incubated at 37"C for 18 h in 50 pl of Scripps Clinic and Research Foundation) was cloned into plasmid vec- buffer consisting of 50 m~ sodium acetate, pH 5.5, 0.1% SDS, 0.02 m~
cells (9) have shown that synthesis of both GPIIb and GPIIIa subunits is required for surface expression, and failure to synthesize either subunit results in the absence of both from the cell surface. The precise structural domains of each subunit which are responsible for subunit association, maturation, and surface expression, however, remain to be identified. One of the purposes of this investigation was to identify such regions by examining the molecular basis of naturally occurring inherited defects that result in defective surface expression of platelet integrins. In this report, we will show that a single amino acid mutation immediately preceding the fourth calcium binding region of the integrin (Y subunit, GPIIb, inhibits intracellular trafficking of this integrin complex to the cell surface. Characterization of the biosynthetic blockade induced by this naturally occurring amino acid substitution has revealed a previously unrecognized region of GPIIb which appears to play an important structural role in the maturation of integrin complexes.
4452
Amino Acid Substitution Prevents
phenylmethylsulfonyl fluoride, and15 milliunits of Endo H (Roehringer Mannheiml or buffer without enz-yme as a negative control. Fifty microliters of 2 x reducing buffer was added to stop the reaction, and samples were boiled for 10 min before electrophoretic separation and autoradiography. Biotin Imhrling and Drtrrtion of Crll Surfnrr Protrins-'hansfected COS-7 cells were washed twice with 5 ml of DPBS and incubated with 2 ml of 5 mu NHS-LC biotin/PBS (Pierce) for 30 m i n a t room temperature. Plates were then washed with DPRS, solubilized in lysis buffer, and immunoprecipitatedas above. Samples were then loaded ontoa 7% SDS-polyacrylamide gel and electrophoresed a t 40 V for an average of 18 h. Proteins were transferred onto Immohilon (Millipore. Redford, MA) in the presence of CAPS buffer containing lor> methanol for 90 min. Blots werr blocked for 1 h at room temperature in 20 mu "is, 3% bovine serum albumin. 0.05? Tween 20, washed in 20 mM "is, 150 mu NaCI. 0.05% Tween 20. and incubated in a 1:4.000dilution of streptavidin-horseradish peroxidase (Amersham Corp.) for 1 h a t room tern1 perature. After washing, blots were incubated in detection reagents a n d 2 (ECG kit, Amrrshnm) for 5 min and exposed to H.yperfilm (Ame r s h a m ) for up to 5 min. Indirrct Irnrnunofluorrscrnt IAhrling nnd Drtrrtion of Crllulnr Protrins-Twenty-four hours after transfected COS-7 cells wrre lifted using trypsin and allowed to readherr to dual-well tissue culture slides (Nunc. Napenrille. 11,). Forty-eight hours later, cells were washed twice with 5 ml of 0.3%bovine serum albumin, DPRS, fixed for 30 min with 2.0% paraformaldehyde,pH7.4, a t 4.0 " C . One-half of a duplicate sample was permeahilized with 0.5% Nonidet P-40 detergent (Sigma) 5 pg of a for 1 min. The samples washed twice and incubated with monoclonal antibody directed against either GPllh. GPIlla, or (;PllhIlIa complex for 1 h a t room trmprrature. The samples were washed twice and incubated withdichlorotriazinylaminofluorescein-conjugated affinitypure F(ah'), fragment goat anti-mouse I&, (H+I,)(Jackson Immune Research. West Grove. PA) for 1 h at room temperature. The samples were washrd three times, 10 p1 of Vectashield mounting medium (Vector 1,aboratories. Rurlingame, CA) was added to each slide, and a coverslip was placed on top. Positive staining crlls were detected and photographed usinga Zeiss Axinscope fluorescence microscope a t x 400 magnification.
CYII~P Complex , ? Maturation
A)
Anti-GPllb Polyclonal
E)
Anti-GPllla Polyclonal
-200-
GPllb+
-1
16-
CGPllla
FIG.1. Immunoblot analysis of platelet CPlrb.IIIa. Detergent lysates of whole platelets wrrr prcpnrvd from a normnl control. the patient's parents Cl)MM) a n d CNM). a n d t h r p a t i r n t tI,.Mr. Twrntv migroF a m s of each lysatc- wasloadedonto a 7'; pol.vacrylnmidr arl and electrophoresed under nonreducing conditions. Fnllowing trnnsfrr to nitrocellulose. the blot was incuhatrd with rahhit polyrlonal antinrmm directed against Cl'llb Ipnnrl A or GPIlla I p n n d N I. Immunorrartivr hands were detected by incubation with ""I-protrin A fnllowed by autoradiography for 3.5 days.
-
GT Patlent (LM) Normal GPllb
RESULTS
Synthesisand Exprmsion of GPIIh and GPIIIa i n Glanzmann Thrornhasthenic Patient LM-To investigate structural A I , CI 1 /I a role in their processregions of GPIIb and GPIIIa which play FIG.2. Nucleotidesequence analynis of LM O C ~ U I normal ing, assembly, and cell surface expression, platelets were ob- CPIlh. Platelet RNA PCH was used to nmplify ovrrlapplng srgmrntsof tained from a Glanzmann patient (LM) and examined for botht h e (;PIlb mRNA transcript. and the resulting cl)NA fr;lpnrntn wrrr intracellular and extracellular GPIIh-IIIa content. Immunoblotsubjected to DNA sequence analysis. Nuclrot~drs 134:3-1354 of Gl'llh. which encode amino acids 417420.are shown and illustrate* the slnplr analysis demonstrated that control, father (DM), and mother G A point mutation that results substitutionof an Asp forG l v " " . f3'. (NM) platelet lysates contained significant levels of glycopro- Glanzmann thrombasthrnia. tein IIb, whereas platelets from the patient contained no detectable GPIIb (Fig. l , panel A ) . In contrast the patient did the absence of GPIIb-IIIa from the platelet surface in patient express a small amount of GPIIIa (panel R ), presumably as LM, a GPIIb expression vector encoding the Asp""" form of part of the vitronectin receptor (n,fI3) complex. These findings GPIIb was constructed (see "Experimental Procedures") and were corroborated by flow cytometric analysis of the platelet cotransfected with wild-type GPIIIa cDNA into COS-7 cells. surface (not shown). Based upon these data, we examined the This system permits high level transient expression of normal GPIIb-IIIareceptor on the cell surface (9. 39). Transfected nucleotide sequence of the GPIIb mRNA transcript from this COS-7 cells were surface labeled with biotin 72 h after transpatient for a molecular genetic defect. Analysis of (LM) GPIIh mRNA-Platelet messenger RNA fection and then subjected to immunoprecipitation analysis uswas isolated and reverse transcribed intocDNA using random ing a variety of monoclonal antibodies directed against glycoproteins IIb, IIIa, or the GPIIb-IIIa complex.As shown in Fig. hexamer nucleotide sequences (see "Experimental Proce3, when transfected alone, GPIIb and GPIIIa were not detected dures"). Four overlapping fragments that spanned the entire length of GPIIb cDNA were amplified by PCR. Secondary PCR onthe cell surface by immunoprecipitationanalysis. as exGly"' form of products were synthesized using nested primers, producing a pected. When cotransfected with the wild-type total of 10 fragments of GPIIb cDNA. Examination of the GPIIb, the complex was expressedon the cell surface and thus nucleotide sequences of these GPIIb PCR products revealed a accessible to a number of antibodies for immunoprecipitation. single nucleotide A substitution in LM's GPIIb cDNA In contrast, the mutant Asp""' form of GPIIh was never de(Fig. 2). This results in the transformationof Gly"' to Asp in tected on the cell surface in association with GPIIIa. demonon GPIIh was the GPIIb polypeptide chain. The mutation was confirmed by strating that this single amino acid substitution sufficient to disrupt surface expression. Identical results wcrc nucleotide sequence analysis of PCRproductsderivedfrom obtained using polyclonal anti-GPllb or GPIIIn antihodiw (not genomic DNA samples a s well (not shown). * Asp Suhstitution on Cell Surface Expres- shown). Effpct of Gly'"' sion-To determinewhetherthe Gly"" b Aspmutation of Indirect immunofluorescence analysis of similarly cotransGPIIb represents a neutral polymorphism or is responsible for fected cells demonstrated that whereas the GIy""
