Journal of Antimicrobial Chemotherapy Advance Access published May 9, 2009
Journal of Antimicrobial Chemotherapy doi:10.1093/jac/dkp167
A T2504A mutation in the 23S rRNA gene responsible for high-level resistance to linezolid of Staphylococcus epidermidis Apostolos Liakopoulos1–3, Charalambos Neocleous1,2, Dimitra Klapsa1,2, Maria Kanellopoulou4, Iris Spiliopoulou5, Kostas D. Mathiopoulos3, Evangelos Papafrangas4 and Efi Petinaki1,2* 1
Department of Microbiology, Medical School, University of Thessalia, Larissa, Greece; 2Department of Molecular Microbiology, Institute of BioMedical Research and Technology, Larissa, Greece; 3Department of Biochemistry and Biotechnology, University of Thessalia, Larissa, Greece; 4 Department of Microbiology, ‘Sismanoglion’ General Hospital of Athens, Athens, Greece; 5Department of Microbiology, School of Medicine, University of Patras, Patras, Greece Keywords: S. epidermidis, staphylococci, oxazolidinones *Corresponding author. Department of Microbiology, Medical School, University of Thessalia, Mezourlo, Larissa, Greece. Tel: þ30-2410-682503; Fax: þ30-2410-682517; E-mail:
[email protected] Sir, Linezolid is an important antimicrobial agent for the treatment of infections caused by Gram-positive organisms, including methicillin-resistant staphylococci. The mechanism of action is thought to involve the inhibition of protein synthesis through binding to the domain V region of 23S rRNA. Until now, the G2576T and T2500A mutations in the domain V region of the 23S rRNA gene (Escherichia coli 23S rRNA gene numbering) were found to be associated with the expression of linezolid resistance among clinical staphylococcal isolates, while other mutations, such as G2444T, G2447T, A2503G and T2504C, have been described among laboratory-derived staphylococci.1–3 Recently, the presence of the cfr gene, which encodes a methyltransferase providing post-transcriptional methylation of the 23S rRNA at position 2503, was detected in linezolid-resistant Staphylococcus aureus and Staphylococcus epidermidis strains.4 In May 2008, a S. epidermidis isolate exhibiting high-level resistance to linezolid was isolated from a patient hospitalized in the intensive care unit at ‘Sismanoglion’ General Hospital of Athens, a 400 bed tertiary care unit. The isolate was recovered from three separate blood cultures of the patient (true bacteraemia) after 20 days of exposure to linezolid. The isolate, after identification and susceptibility testing according to local protocols adapted by the referring institution (Vitek 2, bioMerieux, France), was sent to the Microbiological Laboratory of the University Hospital of Larissa for further analysis. Susceptibility to various antimicrobial agents was determined by disc diffusion using CLSI criteria, while the MICs of oxacillin, vancomycin, teicoplanin and linezolid were determined by the CLSI
microdilution method and by Etest, according to manufacturer’s instructions.5 After extraction of bacterial DNA, the isolate was first tested for the presence of the most common mechanisms: (i) for the presence of the G2576T mutation by PCR followed by NheI digestion; and (ii) for the presence of the cfr gene by PCR.4 Review of S. epidermidis RP62A gene sequences in GenBank (accession no. CP000029) identified six copies (rrlA, rrlB, rrlC, rrlD, rrlE and rrlF) of the 23S rRNA gene. We designed PCR primers specific for each copy and we used them to amplify each copy individually (Table 1). Subsequently, the domain V region of each individual rrl copy was amplified by PCR, using the pair of primers L1 (50 -GCGGTCGCCTCCTAAAAG-30 , corresponding to bases 2279 – 2296 of the S. epidermidis RP62A 23S rRNA gene; GenBank accession no. CR000029) and L2 (50 -ATCCCGGTCCTCTCGTACTA-30 , complementary strand corresponding to bases 2679 – 2698 of the S. epidermidis 23S rRNA gene; GenBank accession no. CR000029), and sequenced. Sequencing data analysis was assessed by use of CHROMAS (version 1.45, Conor McCarthy, School of Health Sciences, Griffith University, Gold Coast Campus, Southport, Queensland, Australia). In addition, the possible presence of some mutations in the gene encoding ribosomal protein L4 was tested by PCR followed by sequencing analysis as described previously.6 According to disc diffusion test results, the strain was resistant to cefoxitin, ciprofloxacin, clindamycin, fusidic acid, gentamicin, linezolid, ofloxacin, oxacillin and tobramycin, intermediately resistant to dalfopristin/quinupristin and susceptible to daptomycin, erythromycin, teicoplanin, tetracycline, tigecycline and vancomycin. The MICs of linezolid, oxacillin, vancomycin and teicoplanin were 256, 32, 1 and 1 mg/L, respectively.
Table 1. Primer pairs for individual copies of the 23S rRNA gene (50 -copy Staphylococcus epidermidis isolates) RP62A rRNA gene
Sequence (50 ! 30 )
Corresponding bases on RP62A genome
rrlA
AAACCAATTGGGATTAAAGT TTCGAGGGATCTTATAACCG
104843–104863 110391–110371
rrlB
CCTCCAACTGGTGGTCTAGG TCCTTGCCATTGTCACCAGA
148832–148852 155203–155183
rrlC
GAGTCCACTTAGGCCCACCA CTACTCTTTTTATAGCAATG
157231–157251 163230–163210
rrlD
GCCTGGCAACGTCCTACTCT AACATTTATTCTCGATGAAA
1457163–1457183 1464525–1464505
rrlE
TGTTGATGGAGCTTCAGTAG TAACCATTTGGAGCTAGCCG
1713054–1713074 1717412–1717392
rrlF
TCTTGTATCTCTTCCTACTA TAACCATTTGGAGCTAGCCG
1800674–1800694 1806732–1806712
.....................................................................................................................................................................................................................................................................................................................................................................................................................................
Page 1 of 2 # The Author 2009. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail:
[email protected]
Research letter The isolate did not carry the G2576T mutation, the cfr gene or any mutations in the gene encoding ribosomal protein L4. Analysis of 23S rRNA DNA sequences showed that, compared with the S. epidermidis RP62A reference sequence (GenBank accession no. CR000029), our isolate had five out of six copies of the 23S rRNA gene (rrlA, rrlB, rrlD, rrlE and rrlF) that carried the mutation T2504A (according to E. coli numbering; 2530 according to S. epidermidis RP62A numbering). After 38 serial passages on linezolid-free tryptic soya agar, the MIC of linezolid fell to 8 mg/L and only one of the six 23S rRNA gene copies contained the mutation; this newly derived strain showed an identical PFGE pattern to the original. This finding strongly suggests that the T2504A mutation is associated with linezolid resistance. In addition, among 40 S. epidermidis genetically unrelated and linezolid-susceptible isolates tested for the presence of the T2504A mutation, none was found to contain one or more mutated alleles. Although the T2504C mutation was detected in a laboratoryderived linezolid-resistant S. aureus, the T2504A mutation is described for the first time in a clinical staphylococcal strain. The observation of the first linezolid-resistant clinical S. epidermidis with a mutation other than G2576T and T2500A is significant, because it demonstrates that there are multiple potential sites in the 23S rRNA at which mutations could confer resistance in clinical isolates. To detect the T2504A mutation, sequencing of the PCR product of region V is recommended, since there is not an enzyme to recognize the cutting site generated by this mutation. In conclusion, a new mutation was described in a clinical linezolid-resistant S. epidermidis, isolated in an intensive care unit where linezolid is widely used for the treatment of multidrug-resistant Gram-positive cocci. This finding emphasizes that Gram-positive cocci under the pressure of linezolid
has the potential to develop various ribosomal mutations, other than G2576T.
Funding A part of this work was supported by a grant from the Institute of Research and Technology of Thessalia.
Transparency declarations None to declare.
References 1. Tsiodras S, Gold HS, Sakoulas G et al. Linezolid resistance in a clinical isolate of Staphylococcus aureus. Lancet 2001; 358: 207–8. 2. Meka VG, Pillai SK, Sakoulas G et al. Linezolid resistance in sequential Staphylococcus aureus isolates associated with a T2500A mutation in the 23S rRNA gene and loss of a single copy of rRNA. J Infect Dis 2004; 190: 311 –17. 3. Livermore DM, Warner M, Mushtaq S et al. In vitro activity of the oxazolidinone RWJ-416457 against linezolid-resistant and -susceptible staphylococci and enterococci. Antimicrob Agents Chemother 2007; 51: 1112–14. 4. Mendes RE, Deshpande LM, Castanheira M et al. First report of cfr-mediated resistance to linezolid in human staphylococcal clinical isolates recovered in the United States. Antimicrob Agents Chemother 2008; 52: 2244–6. 5. Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically— Seventh Edition: Approved Standard M7-A7. CLSI, Wayne, PA, USA, 2006. 6. Prunier AL, Trong HN, Tande D et al. Mutation of L4 ribosomal protein conferring unusual macrolide resistance in two independent clinical isolates of Staphylococcus aureus. Microb Drug Resist 2005; 11: 18–20.
Page 2 of 2
