ABCB1 genetic polymorphism influences the pharmacology ... - Nature

The Pharmacogenomics Journal (2008) 8, 289–296 & 2008 Nature Publishing Group All rights reserved 1470-269X/08 $30.00 www.nature.com/tpj

ORIGINAL ARTICLE

ABCB1 genetic polymorphism influences the pharmacology of the new pyrrolobenzodiazepine derivative SJG-136 RE Aird1, M Thomson1, JS Macpherson1, DE Thurston2, DI Jodrell1 and SM Guichard1 1 Cancer Research UK Pharmacology and Drug Development Group, University of Edinburgh Cancer Research Centre, Edinburgh, UK and 2 Cancer Research UK Gene Targeted Drug Design Research Group, The School of Pharmacy, University of London, London, UK

Correspondence: Dr SM Guichard, Cancer Research UK Pharmacology and Drug Development Group, University of Edinburgh Cancer Research Centre, Crewe Road, Edinburgh EH4 2XR, UK. E-mail: Sylvie.guichard@ed.ac.uk

ATP-binding cassette transporter P-glycoprotein (ABCB1) is responsible for the multidrug resistance (MDR1) phenotype observed in cancer cells. SJG136, a new pyrrolobenzodiazepine dimer, is a sequence-dependent DNA crosslinking agent and substrate of ABCB1. We previously showed that colon cancer cell lines expressing high levels of ABCB1 showed a lower sensitivity to SJG-136. Here, we show that in 3T3 isogenic fibroblasts, ABCB1 genetic polymorphism differentially affects ABCB1 gene expression and transport function. However, this genotype–phenotype relationship was not observed in immortalized lymphocytes, which expressed 10- to 1000-fold less ABCB1 than colon cancer cell lines. Consistent with this, the cytotoxicity of SJG-136 in 3T3 fibroblasts was affected by ABCB1 genetic polymorphism but not in immortalized lymphocytes. ABCB1 genetic polymorphism is therefore likely to affect drug sensitivity in tissues expressing high levels of the transporter and in which significant variability is observed. The Pharmacogenomics Journal (2008) 8, 289–296; doi:10.1038/sj.tpj.6500465; published online 12 June 2007 Keywords: SJG-136; ABCB1; pyrrolobenzodiazepine; genetic polymorphism; colon cancer

Introduction P-glycoprotein (P-gp) is the product of the ATP-binding cassette transporter P-gp (ABCB1) or multidrug resistance (MDR1) gene. It has been studied extensively after it was demonstrated that its overexpression in cancer cells was responsible for resistance to a number of anticancer agents such as anthracyclines and vinca alkaloids.1 Overexpression was reported in tumours2 that originate from tissues expressing physiologically high levels of P-gp such as colon, kidney and liver3 highlighting the role of P-gp as a protective barrier to limit the exposure of the tissues to potentially harmful substances.4 The overall activity of the protein is dependent on its level of expression and also its functionality, which is linked to both substrate specificity and transport effectiveness.5 More recently, the genetic polymorphism of ABCB1 became of interest when it was shown, in some cases, to influence the level of expression of the protein.5,6 Forty-eight single-nucleotide polymorphisms (SNPs) have been reported in the ABCB1 gene.7 However, only a few have been fully characterized in relation to Pgp expression or transport function. The first SNP identified in exon 26 (C3435T) modifies the gene expression of P-gp without altering the sequence of the protein Received 18 January 2007; revised 8 May 8 2007; accepted 9 May 2007; published online (wobble mutation). However, it seems to alter the mRNA stability as well as the folding of the protein modifying its substrate specificity.9 Hoffmeyer et al.7 12 June 2007

ABCB1 gene polymorphism affects SJG-136 cytotoxicity RE Aird et al

290

The Pharmacogenomics Journal

human immortalized lymphocytes (lymphoblast) cell lines from these individuals were used to evaluate the potential correlation among genotype, gene expression and P-gp transport function. Finally, the cytotoxicity of SJG-136 was also evaluated in the lymphoblast cell lines.

Results ABCB1 genotype modifies ABCB1 gene expression in 3T3 fibroblasts ABCB1 gene expression (Figure 1a) was determined in a panel of isogenic 3T3 cell lines expressing specific allelic variants of ABCB1 for the three main SNPs at position 1236, 2677 and 3435 (Table 1). The cell line expressing wild-type ABCB1 (pHamdr-1) presented the highest expression (22 00073341). Expression of the mutant allele T at position 2677 associated with (G2677T-C3435T cell line) or not (G2677T cell line) with a mutation at position 3435 did significantly alter ABCB1 expression (771571958 and 14 96271365, respectively). Moreover, the expression

a hABCB1/mB2M

30000

20000

10000

A

T

T

77

35

26

34 C T-

77

G

T 26 G TG

26

36

77

12 C

12

36

T-

C

26 G

77

T

35

77

34

T-

C

26 G

pH

am

dr

-1

0

350

3000

300 250

2000

200 150 1000

100 50 0

Calcein fluorescence (+verapamil)

b Calcein fluorescence (- verapamil)

12

C

26

pH

am d 77 G2 r-1 C 36 1 T 6 T- 23 -C 77 G 6T 34 T 26 - 3 77 G2 5T T- 67 C 7T 34 3 G 5T 26 77 pH A am C 26 G dr C 12 C 77 2 -1 36 1 T- 67 T- 23 C3 7T G 6T 4 26 - G 3 5 77 2 T T- 67 C 7T 34 G 35T 26 77 A

0

C

reported a lower P-gp expression in the intestine of patients homozygotes TT for the 3435 position in exon 26, which was associated with a higher area under the curve (AUC) and Cmax of digoxin. Subsequently, this polymorphism was shown to modify the disposition of other substrates of P-gp, although the influence seemed to be drug-specific: cyclosporine, fexofenadine or tacrolimus pharmacokinetics were diversely modified.6,10–12 Genetic studies identified a strong linkage disequilibrium between SNPs in exons 12 (C1236T), 21 (G2677T) and 26 (C3435T).6 It is therefore unclear whether the polymorphism in exon 26 is by itself responsible for the modification of the pharmacokinetics of P-gp substrates or if other SNPs linked to this polymorphism are the causal factor. Moreover, as the expression of P-gp varies across tissues, the impact of the genotype on ABCB1 expression and drug disposition may be variable.13 Despite the potential for the ABCB1 polymorphism to influence tissue distribution, metabolism and elimination, most of the studies have implicated only orally administered drugs, suggesting that the impact of the genetic polymorphism on the transporter is maximal in the intestine. Nonetheless, the polymorphism in exon 12 of ABCB1 was linked to the variation in pharmacokinetics of a topoisomerase I inhibitor, Irinotecan, administered by intravenous infusion.14 SJG-136 is a new pyrrolobenzodiazepine dimer analogue. It acts as an interstrand crosslinking agent, alkylating the DNA in a sequence specific manner within a 6 bp sequence: Pu-GATC-Py.15,16 Pre-clinical studies have highlighted the potency of this agent in a number of tumour types.17,18 We have shown that overexpression of the drug transporter P-gp modifies the sensitivity of the cancer cells to SJG-136 both in vitro and in vivo.19 Considering the major impact of P-gp expression on SJG-136 antitumour activity and in view of its clinical development, the question of the impact of ABCB1 genetic polymorphism on its disposition has to be addressed. Primary tumour cells from patients with B-cell chronic lymphocytic leukaemia were used to determine SJG136-induced apoptosis.18 Although apoptosis was observed in all patients, the dose corresponding to 90% cells undergoing apoptosis varied widely: 43726 nM, which could be due to differential P-gp expression. Peripheral mononuclear cells (PBMC) are a tissue of choice for genotyping studies, but might also be a useful surrogate tissue to study the impact of ABCB1 expression on the effect of SJG-136. Indeed, ABCB1 genetic polymorphism has been correlated with P-gp expression in lymphocytes from patients with human immunodeficiency virus20 and in blast cells in leukaemia patients21 with implications in both studies with treatment outcome. In this study, the impact of mutations at positions 1236, 2677 and 3435 on the ABCB1 gene on its mRNA expression and transport function was determined using 3T3 fibroblasts expressing different allelic variants of ABCB1. The cytotoxicity of SJG-136 was also determined in these cells to potentially confirm the correlation previously observed in colon and ovarian cancer cell lines.19 To explore the usefulness of PBMC in this context, a panel of 53 Caucasians was genotyped at the three positions of interest. Twenty

Figure 1 ABCB1 gene expression and function in 3T3 fibroblasts expressing different allelic variants. (a) ABCB1 mRNA expression was determined by quantitative RT-PCR and results normalized by mB2M expression. (b) Transport function of ABCB1 was assessed by calcein AM uptake in the presence (white bars) or absence (black bars) carried out in duplicates. mB2M, mouse b2 microglobulin; RT-PCR, reverse transcription-PCR.


291

Table 1 Genotype of the colon cancer cell lines and 3T3 isogenic cell lines on the three positions studied (1236, 2677 and 3435)

Colon cancer cell lines HT-29 COLO205 HCT-116 SW620 HCT-8 HCT-15 T3 isogenic fibroblasts pHamdr-1 G2677T G2677T-C3435T G2677A C1236T-G2677T C1236T-G2677T-C3435T

CGC CGC CGC CGC CGC TTT CGC TTT CGT TTT CGT TTT

150 SJG-136 IC50 (nM)

ABCB1 genotype

175

125 100 75 50 25 0 0

CGC CGC CTC CTC CTT CTT CAC CAC TTC TTC TTT TTT

decreased by B20-fold when a mutation at position 1236 was present, associated with mutation at position 2677 in cell line C1236T-G2677T (10717293) or double mutation at position 2677 and 3435 in cell line C1236T-G2677T-C3435T (11977299). Finally, while a G to T mutation at position 2677 induced a B2-fold decrease in ABCB1 expression, a G to A mutation (G2677A cell line) induced a B30-fold decrease (702732). We also determined the genotype in six colon cancer cell lines previously shown to express different levels of P-gp.1 Two out of six cell lines express a wild-type genotype, while two others are heterozygous for the three positions. Interestingly, HCT-8 and HCT-15, which express significant levels of P-gp, present the same genotype: CGT TTT.

ABCB1 genotypes influence P-gp transport function in 3T3 fibroblasts Calcein AM is a substrate for P-gp. The overexpression of P-gp decreases its entry into the cells and conversion into fluorescent calcein. The level of cellular calcein is therefore a marker of the expression of P-gp. In the presence of a P-gp blocker (verapamil), calcein fluorescence is maximal. In order to determine if ABCB1 genotype could influence the transport function of P-gp, calcein fluorescence was measured in the six 3T3 isogenic cell lines (Figure 1b). In the absence of verapamil, there was an inverse correlation between the expression of P-gp and the cellular calcein: the three cells lines expressing high levels of ABCB1 showed lower calcein fluorescence (53, 37 and 84 on average for pHamdr-1, G2677T and G2677T-C3435T, respectively) as expected. In the presence of verapamil, all cell lines reached similar levels of calcein fluorescence, ranging from 1407 in average in pHamdr-1 cells to 2089 in cell line C1236TG2677T-C3435T.

5000

10000

15000

20000

25000

hABCB1/mb2M

Figure 2 Correlation between ABCB1 expression and the cytotoxicity of SJG-136 (IC50). Cells were exposed to increasing concentrations of SJG-136 for 24 h. The surviving fraction was determined 72 h after the end of drug exposure by SRB assay. Results are mean7s.e.m. of three to four independent experiments performed in triplicates.

The cytotoxicity of SJG-136 is influenced by ABCB1 gene expression and ABCB1 genotype The cytotoxicity of SJG-136 was evaluated in the six 3T3 isogenic cell lines and the parental 3T3 cell line. The cytotoxic effect induced by SJG-136 (IC50) was significantly correlated with ABCB1 expression (r2 ¼ 0.93, Po0.002) (Figure 2). As expected, the three cell lines presenting highest ABCB1 expression were less sensitive to SJG-136. In addition, the three cell lines showing similar levels of ABCB1 had similar IC50 values: 11.772.2, 6.471.8 and 9.872 nM for C1236T-G2677T, C1236T-G2677T-C3435T and G2677A, respectively.

ABCB1 genotype has no impact on ABCB1 gene expression and transport function in immortalized lymphocytes To evaluate the usefulness of PBMC as a surrogate tissue to study the impact of ABCB1 genetic polymorphism on the effect of SJG-136, we first determined the ABCB1 genotype in 53 healthy Caucasian individuals (Table 2). Twelve different genotypes were identified in the population. The haplotype frequencies confirmed the strong linkage disequilibrium between the polymorphisms at positions 1236, 2677 and 3435. ABCB1 gene expression was determined in a subset of 20 lymphoblast cell lines from the panel of 53 previously genotyped, corresponding to genotypes showing different P-gp expression in 3T3 fibroblasts. ABCB1 gene expression was 100- to 1000-fold lower than in colon cancer cell lines. When segregated according to their genotype (Figure 3a), there was no difference in expression among the three most prominent genotypes *1/*1, *1/*13 and *13/*13 (normalized ABCB1 ¼ 0.01570.007, 0.01970.017 and 0.02770.021, respectively). One sample with genotype *2/*2 (17232) expressed the highest level of P-gp (normalized mRNA expression ¼ 0.101). However, the two cell lines presenting the same genotype as HCT-8 and HCT-15 colon



292

1

0.1

The genotypes identified are presented according to the genotype denomination by Kroetz et al.8

TC

C

T C

C C

C

G

C G

TT

C

TG

A

C

C C G

G C

TT

C

T G C

G

T

C C G

C

C

T

T

T

TT T

TT

G

G

C

TT

G

T TT

C

G

T

TG

C

G

C

C TT

C

C

T TT

C A C

G C

T G C

C G

C

C

G

G

T

T

T

T TT

C

G C G C C

c

TT

0.02 0.02 0.04

200

C

CGC CAC CAC CAC TTC TTT

300

G

Other variants *1/*24 *24/*24 *15/*13

400

TT T

0.19 0.28 0.09 0.02 0.15 0.04 0.11 0.02 0.02

C

CGC CGC CGC TTT CGC CGT CGC TGC TTT TTT CTT TTT CGT TTT CTT CGT CGT CGT

500

C

*1/*1 *1/*13 *1/*2 *1/*11 *13/*13 *17A/*13 *2/*13 *17A/*2 *2/*2

T

C C G C

Caucasians (n ¼ 53)

Genotype

b

Calcein fluorescence

Table 2 Frequencies of ABCB1 genotypes on a population of 53 Caucasians

T

C

0.01

C

a

TT

The cytotoxicity of SJG-136 is not affected by ABCB1 gene expression or genotype in immortalized lymphocytes The cytotoxicity of SJG-136 was also evaluated in eight lymphoblast cell lines (Table 3). The most sensitive cell line was 17232 (IC50 ¼ 0.09–0.26 nM), which expressed the *2/*2 genotype. 17203 (genotype *13/*13) displayed the highest IC50 (0.92–1.51 nM). There was no significant difference in

IC50 values between the different genotypes tested. Moreover, the cytotoxicity of doxorubicin, a known P-gp substrate, was not significantly different among *1/*1, *1/*13 and *13/*13 genotypes. Finally, there was no correlation between ABCB1 expression and the cytotoxicity of SJG136 (Figure 4).

Normalized gene expression

cancer cell lines (*2/*13) expressed similar levels of P-gp as the other genotypes (0.0226 and 0.006, respectively). The calcein uptake was determined on 13 out of the 20 lymphoblast cell lines (Figure 3b). There was no significant difference in cellular calcein according to the genotypes. In particular, the sample 17232 had similar calcein uptake to the other cell lines. To confirm that ABCB1 was indeed functional in the lymphoblast cell lines, we determined the increase in ABCB1 mRNA expression induced by 20 mM rifampicin in four lymphoblast cell lines expressing *1/*1, *1/*13, *13/*13 and *2/*2 variants compared with LS180 cells. The increase in transcript levels varied among cell lines but was similar between 17232 and LS180, suggesting that the ABCB1 gene is functional in these lymphoblast lines (Figure 3c).

4


2

1

0 18 LS

0 14

70

0 12

56

0 92 11

23

2

0 17

Figure 3 ABCB1 gene expression and function in lymphoblasts from 20 Caucasian individuals. (a) ABCB1 mRNA expression was determined by quantitative RT-PCR and results normalized by B2M and 18S expression. Results are presented according to the genotypes. (b) Transport function of ABCB1 was assessed by calcein AM uptake. Results are expressed as the mean absolute fluorescence of the cell population analysed (10 000 cells) and are mean of three independent experiments performed in duplicates. (c) Functionality of ABCB1: cells were exposed to ABCB1 inducer rifampicin (20 mM) for 24 h. Levels of ABCB1 were determined by qRT-PCR. Results are expressed as fold increase compared to untreated controls. qRT-PCR, quantitative reverse transcription-PCR.

Fold increase

3


293

Table 3 Cytotoxicity of SJG-136 and doxorubicin in lymphoblast cell lines determined by CellTiter-Glo assay

14700 17219 12560 17220 11920 17203 17232 17236

Genotype

SJG-136 (nM)

Doxorubicin (nM)

CGC CGC CGC CGC CGC TTT CGC TTT TTT TTT TTT TTT CGT CGT TTC TTT

0.30–0.57 0.28–0.48 0.34–0.52 0.57–0.92 0.35–0.55 0.92–1.51 0.09–0.26 0.18–0.35

18 22 36 15

Results are expressed as the range of IC50 (SJG-136) and are from two independent experiments performed in duplicates. Mean IC50 values with doxorubicin determined in the same conditions are presented for comparison.

SJG-136 IC50 (nM)

1.5

1.0

0.5

0.0 0.00

0.05

0.10

0.15

Normalised ABCB1 gene expression

Figure 4 Correlation between ABCB1 expression and the cytotoxicity of SJG-136 (IC50) in immortalized lymphocytes. Cells were exposed to increasing concentrations of SJG-136 for 48 h and the surviving fraction was determined by CellTiter-Glo assay. Results are mean7s.e.m. of two independent experiments performed in duplicates.

Discussion The genetic polymorphism of ABCB1 has been the subject of much controversy over the last decade.22 Several factors may explain the apparent discrepancy of the published results: ABCB1 polymorphism presents a linkage disequilibrium among the three main polymorphisms at positions 1236, 2677 and 3435. The use of haplotypes has therefore helped clarify apparent contradictions.6,23 The second factor is the variability of expression of the transporter among tissues2,3 and within tissues among different population of cells.4,24 Finally, exogenous factors (drugs, diet) are known to modify the transporter’s expression, potentially beyond the variations due to the genetic polymorphism.25 In the intestine, high expression of P-gp is associated with a large inter-

individual variability and ABCB1 genetic polymorphism has been associated with both ulcerative colitis26 and colon cancer.27 In oncology, ABCB1 status affects drug efficacy via its overexpression in tumours but may also affect the disposition of drug substrates for the transporter. A relationship with patient outcome has been established in some cases.21,28 The antitumour activity of SJG-136 has been shown to be influenced by ABCB1 expression in vitro and in vivo in colon cancer cell lines.19 This study first investigated the impact of the genetic polymorphism on the three main SNPs at positions 1236, 2677 and 3435 in 3T3 fibroblasts. This cell model developed by Kim et al.6 previously showed that mutation at position 2677 did not modify the expression but altered the transport function of P-gp.6 The present study confirmed these data but also showed that mutation at position 1236 alters significantly ABCB1 expression, regardless of additional mutations at positions 2677 and 3435. Moreover, the G-A mutation at position 2677 altered ABCB1 expression to a greater extent than the G-T mutation. In addition, the transport function was closely related to the gene expression. Kim et al.6 have shown similar data with digoxin uptake and suggested a change in substrate specificity. This study highlights the fact that mutations, in linkage disequilibrium with mutations at position 3435, affect ABCB1 gene expression regardless of the mutation at position 3435. Our finding that mutation at position 1236 significantly alters ABCB1 gene expression is consistent with results by Kim et al. in African-American patients (*1/*12 and *2/*12 haplotypes according to Kroetz et al.7) showing higher fexofenadine AUC values than wildtype patients.8 More recently, the evaluation of P-gp hepatic activity using the hepatic clearance of 99mTc-labeled sestamibi was shown to be significantly lower in patients with a CT and TT genotype at position 1236 compared to CC patients.29 Finally, when expressing the different haplotypes in LLC-PK1 cells, the 1236 mutants failed to exclude rhodamine 123 compared to wild-type expressing cells, suggesting impaired P-gp function/expression.30 However, in HeLa cells, a T mutation at position 3435 seemed to affect P-gp function independently of mutations at positions 1236 and 2677.9 It is therefore possible that the cell type (HeLa, 3T3, LLC-PK1), vector systems as well as levels of expression after transfection differentially affect the results of transport function. As previously suggested by Kroetz,7 the determination of the haplotype is more likely to identify genotype–phenotype relationships and was therefore carried out in the present study for all samples evaluated. In lymphoblasts, the gene expression analysis showed limited interindividual variability. This is potentially due to the fact that lymphoblasts were grown in standardized conditions, while nonimmortalized lymphocytes or PBMC from patients may have been exposed to exogenous factors modifying P-gp expression. Moreover, other polymorphisms may have been present in these samples contributing to ABCB1 expression to a greater extent than the three polymorphisms studied in 3T3 fibroblasts. ABCB1 mRNA expression was very low in all



294

lymphoblast cells, consistent with data from Albermann et al.13 Moreover, P-gp expression has been shown to decrease from bone marrow progenitors to mature lymphocytes.4,24 The absence of a genotype–phenotype relationship is therefore probably due to the low P-gp expression observed in immortalized lymphocytes. The ABCB1 gene was functional in the lymphoblasts as rifampicin induced ABCB1 gene expression. However, there was no significant difference in P-gp transport function as determined by the calcein AM assay, consistent with observations by Albermann et al.13 However, we argue that this absence of correlation is potentially due to the lack of sensitivity of the calcein AM assay due to the low expression of ABCB1 in lymphoblasts. This was confirmed by the cytotoxicity data using SJG-136: while the drug sensitivity was correlated with the gene expression of ABCB1 in isogenic 3T3 fibroblasts, there was no correlation in lymphoblast cell lines. A threshold of expression seems therefore necessary to significantly affect the sensitivity to the drug. Colon cancer is one of the cancers in which the proportion of tumours overexpressing ABCB1 is the highest2 and in which the genetic polymorphism of ABCB1 is conserved between normal and malignant tissue.31 However, the impact of ABCB1 genetic polymorphism on ABCB1 expression is still controversial in colon cancer and needs further investigation and large-scale studies.27 As a high level of ABCB1 is correlated with sensitivity to SJG-136, the potential development of this compound in colon cancer should take into account this parameter and the usefulness of ABCB1 gene expression as predictive marker of response to the drug. Materials and methods Materials SJG-136 was obtained from the National Cancer Institute (Batch Number 694501-Z/5) (Bethesda, MA, USA). Aliquots (2 mM) in dimethylsulphoxide were stored at 701C. Other chemicals were obtained from Sigma (Gillingham, UK). Primers were from Sigma Genosys (Sigma). Cell culture 3T3 isogenic cell lines (3T3 GP þ E-86, pHamdr-1, G2677T, G2677T-C1236T, G2677T-C1236T-C3435T, G2677T-C3435T and G2677A) were kindly provided by Dr E Schuetz from St Jude’s Children Research Hospital, Memphis, TN, USA and characterized previously.6 Briefly, wild-type MDR1 cDNA32 was subjected to site-directed mutagenesis to generate the different MDR1 mutants and retrovirus were produced in HEK293T cells. Supernatants were used to infect the murine NIH-3T3 ecotropic packaging cell line GP þ E86. Positive MDR1 cells were sorted by flow cytometry using monoclonal antibody against P-gp. The different variants expressed are summarized Table 1. Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) with 10% foetal calf serum (FCS) v/v. Cells were regularly checked for P-gp expression by flow cytometry as described by Kim et al.6 Lymphoblast cells were obtained from the Coriell Institute


(Camden, NJ, USA). Lymphoblast cells were maintained in RPMI 1640 supplemented with 15% FCS v/v. All cells were grown at 371C in a humidified atmosphere containing 5% CO2. Cells were tested regularly for mycoplasma contamination and were mycoplasma free by culture and PCR at all times.

Identification of ABCB1 genotypes Genomic DNA was extracted using Nucleon genomic DNA extraction kit (Tepnel Life Sciences, Manchester, UK). ABCB1 SNPs in exons 12, 21 and 26 were determined by 50 nuclease allelic discrimination assay (Applied Biosystems, Warrington, UK). Exons 12 and 21 used custom-designed SNP assays and exon 26 a commercially available assay. Haplotype was determined using haploview software.33

Expression of P-gp mRNA by real-time PCR Total RNA was prepared using Tri-Reagent. The reverse transcription-PCR (RT-PCR) reaction was carried out using the QIAgen Quantitect RT-PCR kit (Qiagen, Crawley, UK). ABCB1 mRNA expression was determined using forward primer mdr1E23 F: 50 -aggccaacatacatgccttc and reverse primer mdr1E23 R: 50 -ccttctctggctttgtccag. Per reaction, 22.5 pmol of each primer was used. Mouse b2 microglobulin (mB2M) was used as reference gene to normalize the results in 3T3 fibroblasts using the following primers: mB2M F: 50 gggaagccgaacatactgaa and mB2MR: 50 -tgcttaactctgcaggcgtat. Human B2M (hB2M) and 18S rRNA were used as reference genes to normalize ABCB1 gene expression in all other cell lines. hB2M F: 50 ctcacgtcatccagcagaga, hB2M R: 50 tctttttcagtgggggtgaa, h18S F: 50 -aaacggctaccacatccaag and h18S R: 50 -cctccaatggatcctcgtta. Quantification was performed using a standard curve built from human liver RNA dilutions (BD Biosciences, Oxford, UK) for ABCB1, B2M, 18S and mouse liver RNA for mB2M. Results are the mean7s.d. of triplicate samples.

Calcein AM assay Cells in suspension (500 000 cells in 100 ml) were incubated in the presence of 50 ml of 0.5 mM (1 mM for lymphoblasts) calcein AM solution at 371C for 15 min. Fibroblasts were also pre-incubated with 10 mM of verapamil for 15 min before the addition of calcein AM. After incubation, cells were centrifuged and washed twice with cold RPMI w/o FCS. The cell pellets were re-suspended in 400 ml of cold RPMI for analysis. The cellular calcein was detected on a FACScalibur (BD Biosciences) using an excitation of 488 nm and an emission filter at 515 nm (FL-1 channel). The voltages were set up to display the population within the FSC and SSC channels. The population was gated to exclude debris and aggregates and the intensity of the histogram distribution of the FL-1 fluorescence in the population of cells analysed (10 000 cells) was recorded. The results were expressed as the mean fluorescence of three independent experiments (five for fibroblasts) performed in duplicate.


295

Cytotoxicity assay in isogenic 3T3 cell lines Drug concentrations that inhibited 50% of cell growth (IC50) in 3T3 isogenic cell lines were determined using the sulphorhodamine B (SRB) technique.34 Cells were plated at a density of 1500 cells/well for 3T3 GP þ E-86, G2677A and C1236T-G2677T-C3435T, and 1000 cells/well for pHamdr1,G2677T, C1236T-G2677T and G2677T-C3435T in 150 ml on day 1 in 96-well plates. On day 2, cells were exposed to SJG-136 for 24 h at increasing concentrations. After drug exposure, cells were washed once with phosphate-buffered saline (PBS) and placed in 200 ml of drug-free medium for 72 h after the end of drug exposure. The cells were then fixed with trichloracetic acid and stained with SRB. Optical densities were measured at 540 nm with a Biohit BP-800 (Bio-Hit, Helsinki, Finland). Growth inhibition curves were plotted as percentage of control cells and IC50s were determined by Graphpad Prism 3 Software (Graphpad Software, San Diego, CA, USA) using a sigmoidal curve fitting with variable slope. The goodness of fit determined by r2 was greater than 0.9 and the Hill coefficient o1. The results are based on three to four independent experiments performed in triplicate and are presented as mean7s.e.m. Cytotoxicity assay on lymphoblasts IC50 values in lymphoblasts were determined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega, Southampton, UK). Cells were seeded on day 1 on 96-well white-walled plates at a density of 20 000 cells/well in a volume of 50 ml. Cells were treated on day 2 with 50 ml of increasing concentrations of SJG-136 (5 pM–78 nM). Drug was left on the cells for 48 h before being treated with CellTiter-Glo reagent as per the manufacturer’s instructions. Plates were read on MicroLumat Plus LB 96V luminometer (Berthold, Redbourn, UK) with an integration time of 0.5 s per well. IC50 values were calculated as for the 3T3 fibroblasts.

6

7

8

9

10

11

12

13

14

15

16

Acknowledgments 17

We thank Spirogen Ltd and Ipsen Ltd for their permission to use SJG–136 in these studies. The authors have no conflict of interest with Spirogen Ltd and Ipsen Ltd. MT was supported by a Programme Grant from CORE ( www.corecharity.org.uk).

18

References 1 Ueda K, Cardarelli C, Gottesman MM, Pastan I. Expression of a fulllength cDNA for the human ‘MDR1’ gene confers resistance to colchicine, doxorubicin, and vinblastine. Proc Natl Acad Sci USA 1987; 84: 3004–3008. 2 Fojo AT, Ueda K, Slamon DJ, Poplack DG, Gottesman MM, Pastan I. Expression of a multidrug-resistance gene in human tumors and tissues. Proc Natl Acad Sci USA 1987; 84: 265–269. 3 Thiebaut F, Tsuruo T, Hamada H, Gottesman MM, Pastan I, Willingham MC. Cellular localization of the multidrug-resistance gene product P-glycoprotein in normal human tissues. Proc Natl Acad Sci USA 1987; 84: 7735–7738. 4 Klimecki WT, Futscher BW, Grogan TM, Dalton WS. P-glycoprotein expression and function in circulating blood cells from normal volunteers. Blood 1994; 83: 2451–2458. 5 Hoffmeyer S, Burk O, von Richter O, Arnold HP, Brockmoller J, Johne A et al. Functional polymorphisms of the human multidrug-resistance

19

20

21

22

gene: multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc Natl Acad Sci USA 2000; 97: 3473–3478. Kim RB, Leake BF, Choo EF, Dresser GK, Kubba SV, Schwarz UI et al. Identification of functionally variant MDR1 alleles among European Americans and African Americans. Clin Pharmacol Ther 2001; 70: 189–199. Kroetz DL, Pauli-Magnus C, Hodges LM, Huang CC, Kawamoto M, Johns SJ et al. Sequence diversity and haplotype structure in the human ABCB1 (MDR1, multidrug resistance transporter) gene. Pharmacogenetics 2003; 13: 481–494. Wang D, Johnson AD, Papp AC, Kroetz DL, Sadee W. Multidrug resistance polypeptide 1 (MDR1, ABCB1) variant 3435C4T affects mRNA stability. Pharmacogenet Genomics. 2005; 15: 693–704. Kimchi-Sarfaty C, Oh JM, Kim IW, Sauna ZE, Calcagno AM, Ambudkar SV et al. A ‘silent’ polymorphism in the MDR1 gene changes substrate specificity. Science 2007; 315: 525–528. Drescher S, Schaeffeler E, Hitzl M, Hofmann U, Schwab M, Brinkmann U et al. MDR1 gene polymorphisms and disposition of the P-glycoprotein substrate fexofenadine. Br J Clin Pharmacol 2002; 53: 526–534. Yates CR, Zhang W, Song P, Li S, Gaber AO, Kotb M et al. The effect of CYP3A5 and MDR1 polymorphic expression on cyclosporine oral disposition in renal transplant patients. J Clin Pharmacol 2003; 43: 555–564. Anglicheau D, Verstuyft C, Laurent-Puig P, Becquemont L, Schlageter MH, Cassinat B et al. Association of the multidrug resistance-1 gene single-nucleotide polymorphisms with the tacrolimus dose requirements in renal transplant recipients. J Am Soc Nephrol 2003; 14: 1889–1896. Albermann N, Schmitz-Winnenthal FH, Z’Graggen K, Volk C, Hoffmann MM, Haefeli WE et al. Expression of the drug transporters MDR1/ ABCB1, MRP1/ABCC1, MRP2/ABCC2, BCRP/ABCG2, and PXR in peripheral blood mononuclear cells and their relationship with the expression in intestine and liver. Biochem Pharmacol 2005; 70: 949–958. Mathijssen RH, Marsh S, Karlsson MO, Xie R, Baker SD, Verweij J et al. Irinotecan pathway genotype analysis to predict pharmacokinetics. Clin Cancer Res 2003; 9: 3246–3253. Gregson SJ, Howard PW, Hartley JA, Brooks NA, Adams LJ, Jenkins TC et al. Design, synthesis, and evaluation of a novel pyrrolobenzodiazepine DNA-interactive agent with highly efficient cross-linking ability and potent cytotoxicity. J Med Chem 2001; 44: 737–748. Hartley JA, Spanswick VJ, Brooks N, Clingen PH, McHugh PJ, Hochhauser D et al. SJG-136 (NSC 694501), a novel rationally designed DNA minor groove interstrand cross-linking agent with potent and broad spectrum antitumor activity: part 1: cellular pharmacology, in vitro and initial in vivo antitumor activity. Cancer Res 2004; 64: 6693–6699. Alley MC, Hollingshead MG, Pacula-Cox CM, Waud WR, Hartley JA, Howard PW et al. SJG-136 (NSC 694501), a novel rationally designed DNA minor groove interstrand cross-linking agent with potent and broad spectrum antitumor activity: part 2: efficacy evaluations. Cancer Res 2004; 64: 6700–6706. Pepper CJ, Hambly RM, Fegan CD, Delavault P, Thurston DE. The novel sequence-specific DNA cross-linking agent SJG-136 (NSC 694501) has potent and selective in vitro cytotoxicity in human B-cell chronic lymphocytic leukemia cells with evidence of a p53-independent mechanism of cell kill. Cancer Res 2004; 64: 6750–6755. Guichard SM, Macpherson JS, Thurston DE, Jodrell DI. Influence of P-glycoprotein expression on in vitro cytotoxicity and in vivo antitumour activity of the novel pyrrolobenzodiazepine dimer SJG-136. Eur J Cancer 2005; 41: 1811–1818. Fellay J, Marzolini C, Meaden ER, Back DJ, Buclin T, Chave JP et al. Response to antiretroviral treatment in HIV-1-infected individuals with allelic variants of the multidrug resistance transporter 1: a pharmacogenetics study. Lancet 2002; 359: 30–36. Illmer T, Schuler US, Thiede C, Schwarz UI, Kim RB, Gotthard S et al. MDR1 gene polymorphisms affect therapy outcome in acute myeloid leukemia patients. Cancer Res 2002; 62: 4955–4962. Marzolini C, Paus E, Buclin T, Kim RB. Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance. Clin Pharmacol Ther 2004; 75: 13–33.



296

23

24

25

26

27

28

Johne A, Kopke K, Gerloff T, Mai I, Rietbrock S, Meisel C et al. Modulation of steady-state kinetics of digoxin by haplotypes of the P-glycoprotein MDR1 gene. Clin Pharmacol Ther 2002; 72: 584–594. Chaudhary PM, Mechetner EB, Roninson IB. Expression and activity of the multidrug resistance P-glycoprotein in human peripheral blood lymphocytes. Blood. 1992; 80: 2735–2739. Chaudhary PM, Roninson IB. Induction of multidrug resistance in human cells by transient exposure to different chemotherapeutic drugs. J Natl Cancer Inst 1993; 85: 632–639. Ho GT, Soranzo N, Nimmo ER, Tenesa A, Goldstein DB, Satsangi J. ABCB1/MDR1 gene determines susceptibility and phenotype in ulcerative colitis: discrimination of critical variants using a gene-wide haplotype tagging approach. Hum Mol Genet. 2006; 15: 797–805. Kurzawski M, Drozdzik M, Suchy J, Kurzawski G, Bialecka M, Gornik W et al. Polymorphism in the P-glycoprotein drug transporter MDR1 gene in colon cancer patients. Eur J Clin Pharmacol. 2005; 61: 389–394. Kafka A, Sauer G, Jaeger C, Grundmann R, Kreienberg R, Zeillinger R et al. Polymorphism C3435T of the MDR-1 gene predicts response to preoperative chemotherapy in locally advanced breast cancer. Int J Oncol 2003; 22: 1117–1121.


29

30

31

32

33 34

Wong M, Evans S, Rivory LP, Hoskins JM, Mann GJ, Farlow D et al. Hepatic technetium Tc 99m-labeled sestamibi elimination rate and ABCB1 (MDR1) genotype as indicators of ABCB1 (P-glycoprotein) activity in patients with cancer. Clin Pharmacol Ther 2005; 77: 33–42. Salama NN, Yang Z, Bui T, Ho RJ. MDR1 haplotypes significantly minimize intracellular uptake and transcellular P-gp substrate transport in recombinant LLC-PK1 cells. J Pharm Sci 2006; 95: 2293–2308. Marsh S, Mallon MA, Goodfellow P, McLeod HL. Concordance of pharmacogenetic markers in germline and colorectal tumor DNA. Pharmacogenomics 2005; 6: 873–877. Galipeau J, Benaim E, Spencer HT, Blakley RL, Sorrentino BP. A bicistronic retroviral vector for protecting hematopoietic cells against antifolates and P-glycoprotein effluxed drugs. Hum Gene Ther 1997; 8: 1773–1783. Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 2005; 21: 263–265. Skehan P, Storeng R, Scudiero D, Monks A, McMahon J, Vistica D et al. New colorimetric cytotoxicity assay for anticancer-drug screening. J Natl Cancer Inst 1990; 82: 1107–1112.