Aberrant expression of multiple hormone receptors in ...

Page 1 of 29

Accepted Preprint first posted on 11 May 2010 as Manuscript EJE-10-0058

Aberrant expression of multiple hormone receptors in adrenocorticotropin-independent macronodular adrenal hyperplasia causing Cushing’s Syndrome

J.W.B. de Groot1,2, T.P. Links1, A.P.N. Themmen3, L.H. Looijenga4, R.R. de Krijger4, P.M. van Koetsveld3, J. Hofland3, G. van den Berg1, L.J. Hofland3, R.A. Feelders3

Department of Endocrinology1 and Medical Oncology2, University Medical Centre Groningen, University of Groningen, Department of Internal Medicine3, Erasmus MC-University Medical Centre, Rotterdam, Department of Pathology4, Josephine Nefkens Institute, Erasmus MC-University Medical Centre, Rotterdam, The Netherlands.

Running title: Multiple hormone receptor expression in AIMAH Key terms: AIMAH, Cushing’s Syndrome, Hormone Receptor Word count: 3014 Corresponding author: J.W.B. de Groot Department of Medical Oncology University Medical Centre Groningen, University of Groningen, PO box 30001, 9700 RB, Groningen The Netherlands telephone: 0031-50-3616161 fax: 0031-50-3618051 email: [email protected]

1

Copyright © 2010 European Society of Endocrinology.

Page 2 of 29

Abstract Objective. Aberrant adrenal expression of various hormone receptors has been identified in adrenocorticotropin-independent macronodular adrenal hyperplasia (AIMAH) causing cortisol hypersecretion regulated by hormones other than adrenocorticotropin (ACTH). We aimed to determine aberrant expression of multiple hormone receptors in vivo and in vitro in adrenal tissue of a patient with AIMAH. Design. Clinical case description, biochemical and immunohistochemical analysis to demonstrate aberrant expression of multiple hormone receptors in AIMAH. Methods. The subject of the study is a male diagnosed with Cushing’s Syndrome because of AIMAH. Directly after laparoscopic removal of the adrenals, adrenal tissue was incubated with and without test substances (ACTH, forskolin, arginine vasopressin (AVP), desmopressin, epinephrine, norepinephrine, purified human chorionic gonadotrophin (hCG), metoclopramide

and

the

combinations

of

AVP

with

ACTH,

epinephrine

and

metoclopramide). LH/hCG-R immunohistochemistry and reverse transcriptase polymerase chain reaction analysis was performed to demonstrate aberrant expression of LH/hCG-R and V1-3-AVPR. Results. AIMAH was characterized by in vivo cortisol responsiveness to AVP and in vitro cortisol responses to AVP, hCG, epinephrine and norepinephrine suggesting aberrant adrenal expression of the receptors for AVP (the V1-3-AVPRs), catecholamines (the β-AR) and luteinising hormone (the LH/hCG-R). Incubation with combinations of AVP and ACTH and of AVP with epinephrine induced a stronger cortisol response compared to incubation with the individual agents. Moreover we demonstrated adrenal V1-3-AVPR and LH/hCG-R expression.

2

Page 3 of 29

Conclusions. AIMAH tissue may simultaneously express multiple aberrant hormone receptors and individual ligands may potentiate each other regarding cell proliferation and cortisol production.

3

Page 4 of 29

Introduction Primary adrenal causes of Cushing’s Syndrome cause approximately 15% to 20% of cases of endogenous Cushing’s Syndrome in adults.(1) Of them, bilateral adrenal diseases such as primary pigmented nodular adrenocortical disease (PPNAD), bilateral adenomas or carcinomas, or adrenocorticotropin-independent macronodular adrenal hyperplasia (AIMAH) account for only 10% to 15% of cases.(2;3) Aberrant adrenal expression of various ectopic or eutopic G-protein coupled receptors (GPCRs) has been identified in several cases of AIMAH and unilateral adrenal adenomas.(2) This aberrant expression of receptors leads to a cortisol hypersecretion regulated by hormones other than adrenocorticotropin (ACTH) thus escaping the normal cortisol-mediated feedback. We report a male patient with Cushing’s Syndrome due to AIMAH. The investigation was rendered more complex because a non functional pituitary incidentaloma was also present. A plasma cortisol response was found after administration of arginin vasopressin (AVP). Unexpectedly, apart from AVP, epinephrine, norepinephrine and human chorionic gonadotrophin (hCG) also induced an aberrant in vitro cortisol response indicating expression of multiple aberrant hormone receptors.

Materials and Methods Case report A 60-year-old male was referred for suspected Cushing’s Syndrome, bilateral nodular adrenal hyperplasia and a pituitary microadenoma of 6 mm. He had been treated for hypertension and diabetes mellitus for twelve years. Furthermore, he was diagnosed with osteoporosis. Two years earlier, he underwent percutaneous transluminal coronary angioplasty because of a myocardial infarction. During the last couple of years he had noticed rounding of his face, weight gain (8 kg), fatigue and easy bruisability. His medication consisted of: metformin, rosiglitazone, glimepiride, omeprazol, metoprolol, ciprofibrate, amlodipine, furosemide,

4

Page 5 of 29

irbesartan, acetylsalicylic acid and calcium/vitamin D. Physical findings revealed facial plethora, “moon-face”, trunkal obesity (weight, 115 kg; height, 188 cm; body-mass index, 33), multiple bruises and atrophic skin without striae. Blood pressure was 180/80 mmHg while recumbent. On laboratory examination, renal function and electrolytes were within the normal range. Non-fasting glucose was 15.9 mmol/L, and hemoglobin A1c 10.2%. ACTHindependent hypercortisolism was established by an increased urinary cortisol excretion (391 nmol/24h, normal 20-270 nmol/24h), insufficient cortisol suppression after administration of 1 mg dexamethasone overnight and suppressed plasma ACTH concentrations (1.3 ng/L, normal 10-100 ng/L). In addition, high-dose (7 mg) intravenous dexamethasone did not suppress plasma cortisol and ACTH and cortisol did not respond to intravenous corticotrophin-releasing hormone (CRH, 100 µg). The pituitary tumour that was diagnosed elsewhere was considered to be a non-functional microadenoma. Evaluation of anterior pituitary function revealed no abnormalities except for secondary hypogonadism, presumably due to chronic hypercortisolism. To screen for ectopic hormone receptor expression (after cessation of all medication 4 days before testing) the following tests were performed: a standard mixed meal (116 g carbohydrates, 27 g proteins, 14 g fat), a posture test, tetracosactide (250 µg intravenously), luteinising hormone releasing hormone (LHRH, 100 µg intravenously), thyroid releasing hormone (TRH, 200 µg intravenously), glucagon (1 mg intravenously), cisapride (10 mg orally), AVP (10 IU intramuscularly), and desmopressin (dDAVP, 2.5 µg subcutaneously). A positive response was defined by a 50 % increase in plasma cortisol levels as defined by Lacroix et al.(4) The patient was planned for bilateral adrenalectomy and treated with ketoconazole 2x 200 mg daily. However, he had a severe myocardial infarction for which he eventually underwent coronary artery bypass grafting and aortic valve replacement. During this period of over six

5

Page 6 of 29

months he maintained on ketoconazole and urinary cortisol levels returned to normal. Eventually, a bilateral adrenalectomy was performed. Both adrenals were diffusely enlarged with multiple nodules. A part of both adrenals was removed for in vitro studies. Microscopic examination revealed nodular hyperplasia extending throughout both glands. Ketoconazole was stopped after surgery. The postoperative course was uncomplicated. The patient was treated with steroid replacement therapy (cortisone actetate 25-12.5 mg, fludrocortisone 62.5 µg daily), metformin, omeprazol, sotalol, alendronic acid, acetylsalicylic acid and calcium. He remains in follow-up for his pituitary incidentaloma.

Control patients Hyperplastic adrenal tissue, serving as control tissue for the in vitro studies, was obtained from two patients who underwent bilateral laparoscopic adrenalectomy; one 62-year-old male with severe Cushing’s Syndrome due to ectopic ACTH production (control 1) and one 50year-old male with persistent Cushing’s Disease after pituitary surgery and radiotherapy (control 2). Normal adrenal tissue was obtained from three patients (controls 3, 4 and 5) who underwent nephrectomy due to renal cell carcinoma. Adrenals were removed because of radical tumour resection but did not contain tumour cells microscopically.

Cell preparation and incubation studies Directly after laparoscopic removal, adrenal cortical tissue of the major part of the adrenals was minced into small pieces and dissociated with collagenase (type I; Sigma Chemical Co., St. Louis, MO, USA) as described previously.(5;6) Cell viability was determined by trypan blue staining and was more than 80%. Subsequently, the cells were resuspended in incubation medium (Dulbecco’s Minimal Essential Medium with 0.2% bovine serum albumin) and incubated with and without test substances during 2 or 24 hours. These incubations were

6

Page 7 of 29

performed in quadruplicate using 500,000 cells/mL. After 2 hours incubation, 0.5 ml distilled water was added to each tube and the resulting suspension was stored at –20ºC until measurement of hormone concentrations, as described previously.(5) Cortisol concentrations were measured by a fluorescent immunoassay (Diagnostic Products Corp., Los Angeles, CA, USA). The 2 hour incubations were performed with the following substances: ACTH-(1-24) (Synacthen, Novartis, Basel, Switzerland; concentrations: 31, 62, 125, 250 and 500 pg/mL), forskolin in a concentration of 1 µM, AVP (Pitressin, Monarch Pharmaceuticals, Bristol, UK; 0.001, 0.01, 0.05 and 0.1 µM), dDAVP (Minrin, Ferring Pharmaceuticals, Hoofddorp, The Netherlands; 0.001 and 0.01 µM), epinephrine (0.1, 1 and 10 µM), norepinephrine (0.1, 1 and 10 µM), purified hCG (Organon, Oss, The Netherlands; 50 mIU/mL), metoclopramide (0.1, 1 and 10 µM) and the combinations of AVP 0.01 µM with ACTH (62 pg/ml), epinephrine (1 µM) and metoclopramide (1 µM).

Reverse transcriptase polymerase chain reaction (RT-PCR) of vasopressin receptors After surgery residual adrenocortical tissues were snap-frozen and stored at -80 ˚C. For purpose of mRNA analysis samples were homogenized and subsequently RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions. RNA was reverse transcribed into cDNA using previously described methods.(7) The following primers were used to detect mRNA expression of vasopressin receptors: F: CGGCTTCATCTGCTACAACATC, R: CGAGTCCTTCCACATACCCGT (V1a-AVPR, 506 bp)(8), F: GTGGCCAAGACTGTGAGGAT, R: CATAGATCCAGGGGTTGGTG (V2-AVPR,

181

bp),

CCATGTAGATCCAGGGGTTG

F:

CAGCAGCATCAACACCATCT,

(V3-AVPR,

221

bp).(9)

mRNA

expression

R: of

housekeeping gene hypoxanthine phosphoribosyltransferase 1 (HPRT1) was detected by: F: TGCTTTCCTTGGTCAGGCAGTAT,

R:

7

Page 8 of 29

TCAAATCCAACAAAGTCTGGCTTATATC. The 25 µl PCR reaction mix contained 0.1 IU/µl FastStart Taqpol (Roche Applied Science, Penzberg, Germany), PCR reaction buffer (Roche), 200 µM dNTPs, 250 nM primers, 2.0 mM MgCl2 and 25 ng cDNA. For V2-AVPR the MgCl2 concentration was 1.0 mM. Amplification was performed in a GeneAmp PCR system 9700 (Applied Biosystems, Nieuwerkerk aan den IJssel, The Netherlands), starting with 7 minutes at 95 ˚C, followed by 40 cycles of 1 minute at 95, 1 minute at 60 and 1 minute at 72 ˚C, and finally 10 minutes at 72 ˚C. Afterwards, products were stored at 4 ˚C until electrophoretic separation on a Caliper LabChip (Caliper Life Sciences, Teralfene, Belgium).

LH receptor immunohistochemistry The LH-R specific antibody (20C3) used in this study was kindly provided by Dr. A. Funaro.(10) The mouse monoclonal antibody was used for immunohistochemistry on formalin-fixed paraffin-embedded tissue. Normal adult testis was used as positive control. Tissue sections of 3 micron thickness were deparaffinized, and incubated with the antibody (dilution 1: 1000 in PBS containing 1% BSA) overnight at 4 ˚C. Secondary biotinylated antibodies Rabbit-Anti-Mouse (DAKO, Glostrup, Denmark) were used in a 1:200 dilution and incubated for 30 minutes at room temperature. Antibody complex was visualised by avidinbiotin conjugated with horseradish peroxidase using 3,3-diaminobenzidine as chromogen and H2O2 as substrate. All slides were counterstained with haematoxylin.

Statistics The effects of various test substances on in vitro cortisol production by cultured adrenal cells were tested by ANOVA followed by Newman-Keuls test.

8

Page 9 of 29

Results In vivo studies After stimulation with 250 µg tetracosactide intravenously, plasma cortisol levels increased from 715 nM to peak levels of 2330 nM after 120 min. Administration of 10 IU AVP intramuscularly was followed by an increase in plasma cortisol levels from 470 nM to 775 nM after 30 min. Plasma ACTH levels were undetectable during these stimulation tests. No significant cortisol responses were found after a posture test or administration of dDAVP or after a standard mixed meal and administration of LHRH, TRH, glucagon or cisapride (Table 1). After administration of LHRH, levels of LH (from 3 IU/L to 20 IU/L 90 minutes after LHRH) and FSH (from 8 E/l to 14 E/L 90 minutes after LHRH) increased.

In vitro studies Cultured adrenocortical adenoma cells, obtained from patient and control 1 and 2 produced 135 ± 2.7, 76 ± 1.9 and 169 ± 5.4 nmol cortisol/tube (mean ± SEM); respectively after 2 h. Incubation with ACTH stimulated cortisol production in a dose-dependent fashion (Figure 1). Forskolin, as stimulator of cAMP production induced cortisol production by adrenal cells from the patient (Figure 1) and controls (maximum increase 588 ± 7.0 % and 456 ± 6.1 % respectively compared to own control). AVP strongly stimulated cortisol production by cells from the patient in a dose-dependent manner to maximum values nearly reaching values after maximum ACTH stimulation (Figure 2a). In cells obtained from control patient 1, AVP induced a modest but significant increase in cortisol secretion (Figure 2b), whereas in control patient 2 AVP only slightly stimulated cortisol production (Figure 2c). In contrast, dDAVP had no significant effect on cortisol production by cells from the patient or by cells from the controls.

9

Page 10 of 29

Both epinephrine and norepinephrine had a dose-dependent effect on cortisol production by cells from the patient (Figure 3a). hCG also induced a significant increase in cortisol production (Figure 3a). Epinephrine, norepinephrine or hCG did not affect cortisol secretion by cells obtained from the control patients (data not shown). Figure 3b shows that incubation with the combinations of AVP and ACTH and of AVP with epinephrine induced a stronger cortisol response compared to incubation with the individual agents.

Vasopressin receptor mRNA expression mRNA analysis showed positive expression of all three vasopressin receptors and HPRT1 in adrenal tissue derived from the patient, as is shown in Figure 4. For V2-AVPR both the amplification of genomic DNA (286 bp) as well as cDNA (181 bp) is visible. Controls also showed positive expression of V1 and V2 receptors, but were all negative for V3 receptor mRNA. The expression of V1-AVPR in the patient’s adrenal tissue seems higher compared to control adrenal tissues, whereas the expression of housekeeping gene HPRT1 in these samples did not differ.

LH/hCG receptor expression The LH/hCG-receptor (LH/hCG-R) specific antibody was validated in HEK293 cells which were transfected with the human LH/hCG-R (data not shown) and in human testis tissue with positive staining of the Leydig cells but not the somatic component of the seminiferous tubules (Fig 5, left panel). Hyperplastic adrenal tissue of the patient showed diffuse staining indicating LH/hCG-R expression (Figure 5, right panel).

Discussion

10

Page 11 of 29

We describe a patient with Cushing’s Syndrome based on bilateral AIMAH and characterized by in vivo cortisol responsiveness to AVP and in vitro cortisol responses to AVP, hCG, epinephrine and norepinephrine. AIMAH, and to a lesser extent unilateral adrenal adenomas, are associated with aberrant expression of several eutopic and ectopic GPCRs which are functionally coupled to steroidogenesis.(2;3) This includes receptors for AVP (V1-3AVPR),(11-14) gastric inhibitory polypeptide (GIPR),(15;16) LH (LH/hCG-R),(17;18) catecholamines (β-AR),(19;20) serotonin (5HT-4R)(21;22) and angiotensin II (AT-1R).(23) AIMAH-dependent Cushing’s Syndrome can be accompanied by expression of a single GPCR, but often aberrant co-expression of several GPCRs is found, in particular V1-AVPR and 5HT-4R.(3;24) In this study, we demonstrate simultaneous aberrant responses suggestive of adrenal expression of the V1-AVPR, V3-AVPR, β-AR and LH/hCG-R, a combination which, to our knowledge, has not previously been reported. The V1-AVPR is overexpressed in combination with ectopic expression of V3-AVPR in this patient with AIMAH whereas V2AVPR seems to be expressed in normal adrenals as well. In addition, we found that coincubation of ligands for these GPCRs potentiated the cortisol response of hyperplastic adrenal tissue in vitro. Moreover, we demonstrated adrenal expression of LH/hCG-R immunohistochemically and V1-3-AVPR by RT-PCR. The V1-AVPR is physiologically expressed in the adrenal gland and activation of the V1AVPR leads to a modest increase in steroidogenesis. This is illustrated by the dose-dependent in vitro cortisol responses to AVP by adrenal cells obtained from control patient 1. V2- and V3-AVPR expression has been reported in AIMAH but the effects of the V2-preferential AVPR agonist dDAVP have not extensively been examined in vivo (2;3). The profound cortisol responses, both in vivo and in vitro, to AVP but not to dDAVP in our patient point to a V1-AVPR or V3-AVPR mediated effect. The undetectable ACTH levels after AVP administration exclude an indirect effect via the V3-AVPR expressed in the pituitary. Since

11

Page 12 of 29

we found increased expression of V1-AVPR and ectopic expression of V3-AVPR in our patient the observed embroidered cortisol response to AVP therefore could represent an abnormal response V1-AVPR or V3-AVPR stimulation.(3) Although, mutations in the V1AVPR gene or its promoter have not been demonstrated in patients with AIMAH and AVPresponsive Cushing’s Syndrome(3) AVP expression in the adrenal cortex has been reported in AIMAH and may as such regulate cortisol production in an auto- or paracrine manner.(25) AVP also increases proliferation of different cell types, including rat adrenocortical cells, through activation of V1-AVPR(26) and V2-AVPR and V3-AVPR may also have contributed to the physiopathology of AIMAH by stimulating cell steroidogenesis and mitogenesis. On the other hand, in vivo and in vitro response to dDAVP was absent and it may be that V2- and V3-AVPRs are not involved in the vasopressinergic control of steroidogenesis and that V2and V3-AVPR mRNA present are not translated into functional proteins in AIMAH, as previously observed for the 5HT-4R.(27) Besides AVP responsiveness, our in vitro studies also demonstrated cortisol responses to epinephrine, norepinephrine and hCG although these abnormal responses were not observed in vivo. A pharmacological agent may stimulate cortisol secretion through either a direct action on adrenocortical cells or an indirect effect on other intra-adrenal cells that, in turn, may modulate the synthesis of glucocorticoids via a cell-to-cell type of communication. Nonetheless, ectopic expression of β-ARs in the adrenal cortex has been reported in vitro in several cases of adrenal Cushing’s Syndrome whereas an in vivo cortisol response to catecholamines has been demonstrated in few patients with Cushing’s Syndrome due to AIMAH.(19;20) An explanation for the absence of an in vivo cortisol response on posture in our patient could have been the use of metoprolol, irbesartan and amlodipine. Although the medication was stopped four days before testing, it might have had an effect on the posture

12

Page 13 of 29

test. In addition, the patient used this medication for more than four years while symptoms of Cushing’s Syndrome worsened. Therefore, we do not believe that aberrant expression of the β-AR contributed significantly to the clinical picture. We also found an in vitro cortisol response to hCG and LH/hCG-R protein expression in the patient’s adrenal tissue. The LH/hCG-R is thought to be constitutively expressed in the normal adrenal gland, presumably in the zona reticularis, and may regulate synthesis of dehydroepiandrosterone, at least in human fetal adrenal cells.(18;29) LH-responsive Cushing’s Syndrome could result from an increased LH/hCG-R expression and/or an abnormal coupling between LH/hCG-R and steroidogenesis.(2,18) In AIMAH, co-expression of the LH/hCG-R with other GPCRs (5HT-4R, V1-3-AVPR or GIPR) is observed in a majority of described cases.(18;21;25;27) However, this mainly involves detection of LH/hCG-R mRNA. One study demonstrated LH/hCG-R protein expression in a case of AIMAH, but in this report no data were provided on antibody validation.(30) We show, with a well-validated LH/hCG-R antibody, LH/hCG-R protein expression in hyperplastic adrenal tissue. LH has been postulated to play a role in the pathogenesis of AIMAH. Transgenic mice with constitutional LH overproduction develop both polycystic ovaries and bilateral adrenal hyperplasia with an increased corticosterone production.(31) Furthermore, LH/hCG dependent Cushing’s Syndrome caused by AIMAH has primarily been reported in female patients. The initial pathophysiological concept was that LH/hCG levels should reach a certain threshold to exert stimulatory effects on cortisol synthesis as occurs during pregnancy or the postmenopausal state. However, LH/hCG dependent Cushing’s Syndrome has also been described in premenopausal women with AIMAH, indicating that LH levels in the lower range may also regulate cortisol production.(18) In addition, Mazzuco and co-workers recently demonstrated that transplantation of normal adrenal cells with retrovirus-mediated LH/hCG-R expression into adrenalectomized mice is followed by the development of a

13

Page 14 of 29

hyperplastic adrenal mass with concomitant ACTH-independent hypercortisolism, responsive to hCG.(32) Thus, supraphysiological LH/hCG levels are not a prerequisite for the development of LH/hCG dependent AIMAH in the presence of an enhanced adrenal LH/hCG-R expression. Aberrant cortisol responses to LH/hCG in male patients with AIMAH, however, have only been reported in two patients with an overt and subclinical Cushing’s Syndrome respectively.(21;33) The absence of a cortisol response to LHRH in vivo in our patient may be explained by the concentration and time of exposure to LH/hCG. In one patient with LH/hCG responsive Cushing’s Syndrome the in vitro cortisol response was attenuated with high concentrations of hCG suggesting the occurrence of a desensitization phenomenon of the receptor, as previously shown in Leydig cells.(25;31) The aberrant expression of multiple GPCRs makes it difficult to draw any conclusions on the relative importance of each receptor or the possible cooperation between aberrant GPCRs. Nevertheless, we show for the first time that aberrant stimuli synergize in the stimulation of cortisol production in AIMAH, at least in vitro. AVP-stimulated cortisol production was potentiated by co-incubation with epinephrine or with ACTH. However, the exact mechanism is presently unknown. In this respect it remains intriguing that the hyperplastic adrenal tissue retains its sensitivity to ACTH, both in vivo and in vitro. Indeed, to date, no (loss-of-function) mutations of the ACTH receptor gene have been found in patients with AIMAH.(18;34) In conclusion, the present study additionally demonstrates that AIMAH tissue may simultaneously express multiple aberrant GPCRs. We describe for the first time AIMAH responding to both AVP, (nor)epinephrine and gonadotrophins. The synergizing effects of aberrant stimuli on cortisol production observed in vitro, may translate into the pathophysiological mechanism in vivo, with potentiating interactions of these ligands on cell proliferation and cortisol production.

14

Page 15 of 29

Declaration of interest All authors state that they have nothing to declare. This research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.

Acknowledgement We thank Dr. A, Funaro, Department of Genetics, Biology and Biochemistry, University of Torino, Italy for providing the LH/hCG-R specific antibody.

15

Page 16 of 29

Reference List

1. Newell-Price J, Trainer P, Besser M, Grossman A. The diagnosis and differential diagnosis of Cushing's syndrome and pseudo-Cushing's states. Endocrine Reviews 1998 19 647-672. 2. Lacroix A, Ndiaye N, Tremblay J, Hamet P. Ectopic and abnormal hormone receptors in adrenal Cushing's syndrome. Endocrine Reviews 2001 22 75-110. 3. Lacroix A, Baldacchino V, Bourdeau I, Hamet P, Tremblay J. Cushing's syndrome variants secondary to aberrant hormone receptors. Trends in Endocrinology and Metabolism 2004 15 375-382. 4. Lacroix A, Mircescu H, Hamet P. Clinical evaluation of the presence of abnormal hormone receptors in adrenal Cushing's syndrome. The Endocrinologist 1999 9 9-15. 5. Marzouk HF, Zuyderwijk J, Uitterlinden P, de Jong FH, Lamberts SW. Suramin prevents ACTH-stimulated corticosterone release by dispersed adrenocortical cells. Endocrinology 1990 126 666-668. 6. Richardson MC, Schulster D. Corticosteroidogenesis in isolated adrenal cells: effect of adrenocorticotrophic

hormone,

adrenocorticotrophic

hormone

adenosine diazotized

3',5'-monophosphate to

polyacrylamide.

and

1-24

Journal

of

Endocrinology 1972 55 127-139.

7. Hofland J, Timmerman MA, de Herder WW, van Schaik RH, de Krijger RR, de Jong FH. Expression of activin and inhibin subunits, receptors and binding proteins in human adrenocortical neoplasms. Clinical Endocrinology (Oxford) 2006 65 792-799

16

Page 17 of 29

8.

Perraudin V, Delarue C, Lefebvre H, Do Rego JL, Vaudry H, Kuhn JM. Evidence for a role of vasopressin in the control of aldosterone secretion in primary aldosteronism: in vitro and in vivo studies. Journal of Clinical Endocrinology and Metabolism 2006 91 1566-1572.

9. Vezzosi D, Cartier D, Régnier C, Otal P, Bennet A, Parmentier F, Plantavid M, Lacroix A, Lefebvre H, Caron P. Familial adrenocorticotropin-independent macronodular adrenal hyperplasia with aberrant serotonin and vasopressin adrenal receptors. European Journal of Endocrinology 2007 156 21-31. 10. Funaro A, Sapino A, Ferranti B, Horenstein AL, Castellano I, Bagni B, Garotta G, Malavasi F. Functional, structural, and distribution analysis of the chorionic gonadotropin receptor using murine monoclonal antibodies. Journal of Clinical Endocrinology and Metabolism 2003 88 5537-5546. 11. Perraudin V, Delarue C, De Keyzer Y, Bertagna X, Kuhn JM, Contesse V, Clauser E, Vaudry H. Vasopressin-responsive adrenocortical tumor in a mild Cushing's syndrome: in vivo and in vitro studies. Journal of Clinical Endocrinology and Metabolism 1995 80 2661-2667. 12. Horiba N, Suda T, Aiba M, Naruse M, Nomura K, Imamura M, Demura H. Lysine vasopressin stimulation of cortisol secretion in patients with adrenocorticotropinindependent macronodular adrenal hyperplasia. Journal of Clinical Endocrinology and Metabolism 1995 80 2336-2341. 13. Daidoh H, Morita H, Hanafusa J, Mune T, Murase H, Sato M, Shibata T, Suwa T, Ishizuka T, Yasuda K. In vivo and in vitro effects of AVP and V1a receptor antagonist on Cushing's syndrome due to

ACTH-independent bilateral

macronodular

adrenocortical hyperplasia. Clinical Endocrinology (Oxford) 1998 49 403-409.

17

Page 18 of 29

14. Arnaldi G, Gasc JM, De Keyzer Y, Raffin-Sanson ML, Perraudin V, Kuhn JM, RauxDemay MC, Luton JP, Clauser E, Bertagna X. Variable expression of the V1 vasopressin receptor modulates the phenotypic response of steroid-secreting adrenocortical tumors. Journal of Clinical Endocrinology and Metabolism 1998 83 2029-2035. 15. Lacroix A, Bolte E, Tremblay J, Dupré J, Poitras P, Fournier H, Garon J, Garrel D, Bayard F, Taillefer R, Flanagan RJ, Hamet P. Gastric inhibitory polypeptidedependent cortisol hypersecretion--a new cause of Cushing's syndrome. New England Journal of Medicine 1992 327 974-980. 16. Reznik Y, Allali-Zerah V, Chayvialle JA, Leroyer R, Leymarie P, Travert G, Lebrethon MC, Budi I, Balliere AM, Mahoudeau J. Food-dependent Cushing's syndrome mediated by aberrant adrenal sensitivity to gastric inhibitory polypeptide. New England Journal of Medicine 1992 327 981-986. 17. Lacroix A, Hamet P, Boutin JM. Leuprolide acetate therapy in luteinizing hormone-dependent Cushing's syndrome. New England Journal of Medicine 1999 341 15771581. 18. Feelders RA, Lamberts SW, Hofland LJ, van Koetsveld PM, Verhoef-Post M, Themmen AP, de Jong FH, Bonjer HJ, Clark AJ, van der Lely AJ, de Herder WW. Luteinizing hormone (LH)-responsive Cushing's syndrome: the demonstration of LH receptor messenger ribonucleic acid in hyperplastic adrenal cells, which respond to chorionic gonadotropin and serotonin agonists in vitro. Journal of Clinical Endocrinology and Metabolism 2003 88 230-237.

18

Page 19 of 29

19. Lacroix A, Tremblay J, Rousseau G, Bouvier M, Hamet P. Propranolol therapy for ectopic beta-adrenergic receptors in adrenal Cushing's syndrome. New England Journal of Medicine 1997 337 1429-1434. 20. Miyamura N, Tsutsumi A, Senokuchi H, Nakamaru K, Kawashima J, Sakai K, Taguchi T, Tokunaga H, Nishida K, Uehara M, Sakakida M, Araki E. A case of ACTH-independent macronodular adrenal hyperplasia: simultaneous expression of several aberrant hormone receptors in the adrenal gland. Endocrine Journal 2003 50 333-340. 21. Cartier D, Lihrmann I, Parmentier F, Bastard C, Bertherat J, Caron P, Kuhn JM, Lacroix A, Tabarin A, Young J, Vaudry H, Lefebvre H. Overexpression of serotonin4 receptors

in

cisapride-responsive

adrenocorticotropin-independent

bilateral

macronodular adrenal hyperplasia causing Cushing's syndrome. Journal of Clinical Endocrinology and Metabolism 2003 88 248-254. 22. Mannelli M, Ferruzzi P, Luciani P, Crescioli C, Buci L, Corona G, Serio M, Peri A. Cushing's syndrome in a patient with bilateral macronodular adrenal hyperplasia responding to cisapride: an in vivo and in vitro study. Journal of Clinical Endocrinology and Metabolism 2003 88 4616-4622. 23. Nakamura Y, Son Y, Kohno Y, Shimono D, Kuwamura N, Koshiyama H, Sasano H, Matsuda T. Case of adrenocorticotropic hormone-independent macronodular adrenal hyperplasia with possible adrenal hypersensitivity to angiotensin II. Endocrine 2001 15 57-61. 24. Reznik Y, Lefebvre H, Rohmer V, Charbonnel B, Tabarin A, Rodien P, Lecomte P, Bardet S, Coffin C, Mahoudeau J; REHOS study group. Aberrant adrenal sensitivity

19

Page 20 of 29

to multiple ligands in unilateral incidentaloma with subclinical autonomous cortisol hypersecretion: a prospective clinical study. Clinical Endocrinology (Oxford) 2004 61 311-319. 25.

Bertherat J, Contesse V, Louiset E, Barrande G, Duparc C, Groussin L, Emy P, Bertagna X, Kuhn JM, Vaudry H, Lefebvre H. In vivo and in vitro screening for illegitimate receptors in adrenocorticotropin-independent macronodular adrenal hyperplasia

causing

Cushing's

syndrome:

identification

of

two

cases

of

gonadotropin/gastric inhibitory polypeptide-dependent hypercortisolism. Journal of Clinical Endocrinology and Metabolism 2005 90 1302-1310. 26. Trejter M, Carraro G, Rucinski M, Hochol A, Rebuffat P, Nussdorfer GG, Malendowicz LK. Arginin-vasopressin regulates proliferative activity of the regenerating rat adrenal cortex. International Journal of Molecular Medicine 2005 15 993–997. 27. Louiset E, Contesse V, Groussin L, Cartier D, Duparc C, Barrande G, Bertherat J, Vaudry H, Lefebvre H. Expression of serotonin7 receptor and coupling of ectopic receptors to protein kinase A and ionic currents in adrenocorticotropin-independent macronodular adrenal hyperplasia causing Cushing's syndrome. Journal of Clinical Endocrinology and Metabolism 2006 91 4578–4586. 28. Bourdeau I, D'Amour P, Hamet P, Boutin JM, Lacroix A. Aberrant membrane hormone receptors in incidentally discovered bilateral macronodular adrenal hyperplasia with subclinical Cushing's syndrome. Journal of Clinical Endocrinology and Metabolism 2001 86 5534-5540.

20

Page 21 of 29

29. Pabon JE, Li X, Lei ZM, Sanfilippo JS, Yussman MA, Rao CV. Novel presence of luteinizing hormone/chorionic gonadotropin receptors in human adrenal glands. Journal of Clinical Endocrinology and Metabolism 1996 81 2397-2400.

30. Albiger NM, Occhi G, Mariniello B, Iacobone M, Favia G, Fassina A, Faggian D, Mantero F, Scaroni C. Food-dependent Cushing's syndrome: from molecular characterization to therapeutical results. European Journal of Endocrinology 2007 157 771-778

31. Kero J, Poutanen M, Zhang FP, Rahman N, McNicol AM, Nilson JH, Keri RA, Huhtaniemi IT. Elevated luteinizing hormone induces expression of its receptor and promotes steroidogenesis in the adrenal cortex. Journal of Clinical Investigation 2000 105 633-641. 32. Mazzuco TL, Chabre O, Feige JJ, Thomas M. Aberrant expression of human luteinizing hormone receptor by adrenocortical cells is sufficient to provoke both hyperplasia and Cushing's syndrome features. Journal of Clinical Endocrinology and Metabolism 2006 91 196-203. 33. Klimek M, Pabian W, Tomaszewska B, Kolodziejczyk J. Levels of plasma ACTH in men from infertile couples. Neuroendocrinology Letters 2005 26 347-50. 34. Latronico AC, Reincke M, Mendonca BB, Arai K, Mora P, Allolio B, Wajchenberg BL, Chrousos GP, Tsigos C. No evidence for oncogenic mutations in the adrenocorticotropin receptor gene in human adrenocortical neoplasms. Journal of Clinical Endocrinology and Metabolism 1995 80 875-877.

21

Page 22 of 29

Legends

Figure 1. In vitro cortisol response of cultured adrenocorticotropin-independent macronodular adrenal hyperplasia (AIMAH) cells to ACTH and forskolin (2 hour stimulated cortisol values as percentage of patient’s own control values). AIMAH cells were prepared from hyperplastic adrenal glands of a patient with an AVP-responsive Cushing’s syndrome (A) and adrenal adenoma cells of two patients with ectopic ACTH production by a neuroendocrine tumor and pituitary-dependent Cushing’s syndrome respectively served as controls (B). Data are expressed as mean (n=4) ± SEM. *p