Ablation of the auditory cortex results in changes in

Hearing Research 346 (2017) 71e80

Contents lists available at ScienceDirect

Hearing Research journal homepage: www.elsevier.com/locate/heares

Research Paper

Ablation of the auditory cortex results in changes in the expression of neurotransmission-related mRNAs in the cochlea*
nica Lamas a, b, *, Jose
M. Juiz c, Miguel A. Mercha
n a, b Vero
n, Pintor Fernando Gallego 1, 37007, Salamanca, Spain Institute for Neurosciences of Castilla y Leo University of Salamanca, Salamanca, Spain c
n en Discapacidades Neurolo
gicas (IDINE), Facultad de Medicina de Albacete, University of Castilla La Mancha, Albacete, Albacete, Instituto de Investigacio Spain a

b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 14 November 2016 Received in revised form 9 February 2017 Accepted 14 February 2017 Available online 16 February 2017

The auditory cortex (AC) dynamically regulates responses of the Organ of Corti to sound through descending connections to both the medial (MOC) and lateral (LOC) olivocochlear efferent systems. We have recently provided evidence that AC has a reinforcement role in the responses to sound of the auditory brainstem nuclei. In a molecular level, we have shown that descending inputs from AC are needed to regulate the expression of molecules involved in outer hair cell (OHC) electromotility control, such as prestin and the a10 nicotinic acetylcholine receptor (nAchR). In this report, we show that descending connections from AC to olivocochlear neurons are necessary to regulate the expression of molecules involved in cochlear afferent signaling. RT-qPCR was performed in rats at 1, 7 and 15 days after unilateral ablation of the AC, and analyzed the time course changes in gene transcripts involved in neurotransmission at the first auditory synapse. This included the glutamate metabolism enzyme glutamate decarboxylase 1 (glud1) and AMPA glutamate receptor subunits GluA2-4. In addition, gene transcripts involved in efferent regulation of type I spiral ganglion neuron (SGN) excitability mediated by LOC, such as the a7 nAchR, the D2 dopamine receptor, and the a1, and g2 GABAA receptor subunits, were also investigated. Unilateral AC ablation induced up-regulation of GluA3 receptor subunit transcripts, whereas both GluA2 and GluA4 mRNA receptors were down-regulated already at 1 day after the ablation. Unilateral removal of the AC also resulted in up-regulation of the transcripts for a7 nAchR subunit, D2 dopamine receptor, and a1 GABAA receptor subunit at 1 day after the ablation. Fifteen days after the injury, AC ablations induced an up-regulation of glud1 transcripts. © 2017 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Keywords: Inner ear Descending control Auditory cortex Olivocochlear efferent system Postsynaptic receptors Homeostatic plasticity

1. Introduction Previous studies have provided anatomical evidence for the presence of a descending efferent pathway originating in pyramidal neurons of layers V and VI of the auditory cortex (AC) reaching the cochlear receptor through connections with olivocochlear neurons (Mulders and Robertson, 2000b; Feliciano and Potashner, 1995).

* Note. Preliminary results of this paper were presented at the V International Conference on Cognitive Neurodynamics e Sanya-China e Proceedings in: Advances in Cognitive Neurodynamics V (2015) pp 101e110 Ed. by Rubin Wang. Springer. ISBN 978-981-10-0207-6. * Corresponding author. Present address: Eaton-Peabody Laboratory, Massachusetts Eye and Ear Infirmary, Boston, MA, United States; Department of Otolaryngology, Harvard Medical School, Boston, MA, United States. E-mail address: [email protected] (V. Lamas).

This pathway comprises downward projections with multiple feedback loops, including cortico-thalamic, cortico-collicular, cortico-(collicular)-olivocochlear and cortico-(collicular)-cochlear nucleus connections, that seem to work dynamically in combination (Bajo and Moore, 2005; Malmierca et al., 1996; Malmierca and ~ a et al., 1996; Thompson and Schofield, 2000; Ryugo, 2011; Saldan Winer et al., 2001). The physiological effect of the cortical descending projections is to regulate the auditory signal processing in subcortical auditory nuclei (Liu et al., 2010; Luo et al., 2008; Suga et al., 2002; Yan et al., 2005; Lamas et al., 2013). Recent studies have shown changes in the compound action
n et al., potentials of the auditory nerve (Dragicevic et al., 2015; Leo
n et al., 2012), cochlear microphonics (Dragicevic et al., 2015; Leo €ger and 2012; Xiao and Suga, 2002) and otoacoustic emissions (Ja €ssl, 2016; Khalfa et al., 2001; Perrot et al., 2006) after either AC Ko activation or inhibition, thus demonstrating that the AC can

http://dx.doi.org/10.1016/j.heares.2017.02.011 0378-5955/© 2017 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

72

V. Lamas et al. / Hearing Research 346 (2017) 71e80

modulate sensory transduction and neural conduction mechanisms in the initial auditory pathway levels. We have previously reported an increase in auditory thresholds, and a decrease in both wave amplitudes and latencies of auditory brainstem responses after restricted ablations of the AC (Lamas et al., 2013). Due to the excitatory nature of the corticofugal projection (Feliciano and Potashner, 1995), the effect of AC removal on the activity of the cochlea and the auditory brainstem nuclei was interpreted as a result of the loss of descending excitatory inputs, ultimately affecting olivocochlear neurons. To test this, we previously analyzed the expression of molecular markers involved in the medial olivocochlear (MOC) - outer hair cells (OHC) neurotransmission, including prestin and the a10 nAchR subunit, after restricted AC ablations in rats (Lamas et al., 2015). Our results showed that AC ablations induce an increase in the transcripts of both prestin and a10 nAchR subunit, as well as change the oligomerization of the prestin protein, thus demonstrating a central role of the descending control in the regulation of the inner ear micromechanical machinery. The loss of the descending control by ablation of the AC should also produce an imbalance in the efferent control of the type I spiral ganglion neurons (SGN), which may lead to changes in the expression of inner ear genes related to cochlear afferent signaling. In this report we test this using a similar experimental approach as in Lamas et al., 2015, to analyze the expression of molecular markers involved in the activity of the inner hair cells (IHC) - Type I SGN neurotransmission (Fig. 1). Thus, RT-qPCR was performed at 1, 7, and 15 days after unilateral ablations of AC, and the possible changes in transcripts involved in the IHC-Type I SGN neurotransmission, including the glutamate metabolism enzyme glutamate dehydrogenase (glud1) and the GluA2-4 AMPA receptor subunits (Kuriyama et al., 1994; Niedzielski and Wenthold, 1995) were analyzed. In addition, we also studied cochlear changes in transcripts involved in efferent regulation of type I SGN modulated by LOC, including a7 nAchR, D2 Dopamine receptor, and a1- and g2ionotropic GABAA receptor subunits (Morley et al., 1998; Maison et al., 2012; Drescher et al., 1993; Yamamoto et al., 2002; Ruel et al., 2000; Glowatzki and Fuchsa, 2002). Our results showed that unilateral AC ablations induced upregulation of GluA3 receptor subunit transcripts in the cochlea ipsilateral to the ablation, whereas both GluA2 and GluA4 mRNA receptors were down-regulated already at 1 day after the injury. Unilateral removal of the AC also resulted in up-regulation of the LOC post-synaptic transcripts a7 nAchR subunit, D2 dopamine receptor, and a1 GABAA receptor subunit at 1 day after the ablation. Fifteen days after the injury, AC ablations induced an up-regulation of glud1 transcripts. Similar changes for all the transcripts were observed in the cochlea contralateral to the AC ablation. 2. Methods 2.1. Animals Twenty-eight male Wistar rats weighing between 250 and 300 g were used in this study. The animals were divided into sham controls, and three experimental groups. Animals from experimental groups had surgical ablation of the left AC and were randomly assigned to the different groups of survival times of 1, 7 and 15 days (n ¼ 7 each one). Sham controls were animals undergoing the same surgery process than the experimental groups but without ablation of the AC. Sham controls were randomly assigned to the different groups of survival time. The comparison between them showed no differences in the level of the transcripts. Thus, we mixed them together and randomly selected 7 that we used as “controls” in the statistical analysis.

Fig. 1. Schematic of the neurochemical interactions among hair cells, spiral ganglion neurons, and olivocochlear efferent fibers in the mammalian cochlea. The connections and AMPA receptor location are known from ultrastructural (Liberman, 1980), as well as immunocytochemistry studies (Kuriyama et al., 1994; Niedzielski and Wenthold, 1995). The nature of the cholinergic receptors on Type I spiral ganglion neurons is inferred from the study of Morley et al., 1998, that combines RT-qPCR and in situ hybridization techniques. The nature of the cholinergic receptors on outer hair cells is known from electrophysiological (Elgoyhen et al., 2001) and knock-out studies (Maison et al., 2007; Vetter et al., 2007). Dopamine receptors location is known from the D1 and D2 receptor immunohistochemistry study of Maison et al. (2012). The gabaergic nature of the olivocochlear efferences and the location of the GABAA receptor subunits are known from immunohistochemistry studies (Maison et al., 2006, 2003; Vetter et al., 1991; Yamamoto et al., 2002). Dopamine and GABA
nyi et al., 2005; presynaptic receptors located in LOC efferent terminals (Dolevicze Maison et al., 2012) are not schematized here. Receptors marked with a question mark indicate ambiguous localization.

This study was carried out in strict accordance with both Spanish regulations (Royal Decree 53/2013 - Law 32/2007) and European Union guidelines (Directive 2010/63/EU) on the care and use of animals in biomedical research. 2.2. Surgical procedures AC ablations were performed under anesthesia using a mixture of ketamine chlorhydrate (30 mg/kg Imalgene 1000, Rhone
reuse, Lyon, France) and xylazine chlorhydrate (5 mg/kg, RomMe pun, Bayer, Leverkusen, Germany), as previously described in Lamas et al. (2013). Briefly, animals were placed in a stereotaxic frame (#900, David Kopf Ins., Tujinga, CA, EEUU) and the left superficial area of the cranial surface was surgically exposed. A window including the primary and secondary AC areas was opened in the skull, following the stereotaxic coordinates of Paxinos and Watson, and the AC was removed by gentle aspiration. The animals were returned to their cages after the ablations, with careful monitoring of their post-surgery recovery. Once the corresponding post-surgery survival time was reached, the animals were anesthetized with 0.1 ml of sodium pentobarbital i.p., and decapitated in order to collect the brain and both cochleae. The brains were then immersed in 4% para-formaldehyde in PBS, while both ipsi- and contralateral cochleae from controls and surgically AC ablated animals were immediately frozen in liquid nitrogen.

V. Lamas et al. / Hearing Research 346 (2017) 71e80

2.3. RNA extraction Total RNA was purified from the collected and homogenized cochleae in order to analyze the expression of the target mRNAs using TRIZOL® (Gibco BRL, Gaithersburg, MD, USA) and a column from an RNeasy Mini Kit (Qiagen, Valencia, USA), performed according to the manufacturer's instructions. RNA concentrations were determined using an ND-1000 spectrophotometer (NanoDrop Technologies Inc., Wilmington, USA). Each RNA sample was assayed three times, and an average value determined. RNA quality was assessed using an RNA 6000 Nano LabChip kit (Agilent Technologies, Palo Alto, CA, USA), and an Agilent 2100 Bioanalyzer to assess the integrity of the 18S and 28S rRNA bands, as well as an RNA integrity number (RIN), with 0 corresponding to fully degraded RNA, and 10 corresponding to intact RNA. For all the qPCR analyses, only RNA samples with a RIN of at least 7.5 were used, with the vast majority of samples having a RIN of at least 8.0. These values fulfilled one of the requirements of an optimal qPCR experiment according to Fleige et al. (2006).

73

amplification. The relative gene expression value (“fold change”) for each transcript was calculated according to equation E(DCt “0condition 1”DCt “condition 2”), where “condition 1” corresponds to experimental samples (1, 7 and 15 days post-surgery), “condition 2” to the samples of control animals, and the DCt of each “condition” is Ct “experimental gene”  Ct “endogenous gene” (Livak and Schmittgen, 2001; Schmittgen and Livak, 2008). Standard deviation for each relative level of gene expression value was calculated as a measure of data variation. 2.5. Statistical analysis Real-time PCR results are shown as mean ± SD, and were analyzed using a one-way ANOVA and Scheffe and Bonferroni posthoc tests. The ipsi- versus contralateral comparison was undertaken using a student t-test. In all cases, differences were considered significant at the p  0.05 level. Statistical analysis was performed using the SPSS-IBM software, version 20 (SPSS Inc., Chicago, IL, USA).

2.4. Quantitative real-time PCR

2.6. Localization of the lesions

Total RNA (2 mg) primed with oligo-dT was reverse-transcribed into cDNA at 37  C for 2 h using the first-strand cDNA synthesis kit (Promega Corporation, Madison, WI, USA) in a 20 ml volume, and stored at 20  C until use, according to the manufacturer's instructions. In all cases, a reverse transcriptase negative control was used to test for genomic DNA contamination. Real-time quantitative PCR (qPCR) was performed using the SYBR-Green method with a 2  Master Mix (Applied Biosystems). Each reaction contained 10 ml of Master Mix, 0.4 ml of each pair of primers, 3 ml of each cDNA sample in a different serial cDNA quantity for each gene, and Milli-Q water up to 20 ml. The amplification reaction took place in an ABI Prism 7000 detection system (Applied Biosystems), with the following conditions: 10 min at 95  C, followed by 40 cycles of 15 s at 95  C and 1 min at 60  C, depending on each pair of primers. Three PCR reactions were performed for each sample per plate, and each experiment was repeated twice. The list of primers used is provided in Table 1. To choose the most stable gene as internal reference for RT-qPCR data normalization, the expression of three candidates [b-actin (b-act), ribosomal protein L19 (RPL19) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH)] were measured by RT-qPCR. The NormFinder software (Andersen et al., 2004) was used to calculate intraand inter-group expression. Our results indicated that RPL-19 is the most stable gene, whereas b-act and GADPH are less stable (data not shown). Thus, the mean of threshold cycle (Ct) value and primer efficiency value of RPL-19 was used for normalization. The comparative threshold cycle (Ct) method was used to obtain quantitative data (Schmittgen and Livak, 2008). Following the removal of outliers, raw fluorescence data were used to determine the PCR amplification efficiency (E) according to the formula E ¼ [10(1/slope)  1]*100. All amplifications had an E value of 100 ± 10%, with an E value close to 100% being an indicator of efficient

The localization of the lesions in the AC was performed as previously described in Lamas et al. (2013). Briefly, after perfusion fixation and brain removal, the lateral surface of the brain was photographed using a Nikon camera located 21 cm above the cortex surface, and the photograph was superimposed onto a purposebuilt coordinates map (Lamas et al., 2013). The extension of the lesion expressed as a percentage area of AC was calculated using the “area dimensioning tool” included in Canvas X software (Lamas et al., 2013). 3. Results 3.1. Localization of the lesions All ablations specifically encroached the major subdivisions of the AC (primary, dorsal and ventral cortices), and affected all AC layers, but not the underlying white matter. Lesions included a region ranging from 70 to 100% of the total AC area (Fig. 2). 3.2. glud1 and GluA2-4 mRNA The transcripts of AMPA glutamate receptor subunits including GluA2, 3 and 4, which are expressed in the cochleae of adult rats (Kuriyama et al., 1994; Niedzielski and Wenthold, 1995), were analyzed by RT-qPCR at 1, 7 and 15 survival days after unilateral AC ablation. In addition, glud1 transcripts were analyzed as a potential marker of glutamate neurotransmitter pool turnover. GluA2-subunit transcripts showed a significant (p < 0.001) down-regulation in both cochleae, ipsi- and contralateral to the ablation at 1 and 7 days (Fig. 3A), and returned to values similar to those of controls at 15 days. GluA3-subunit transcripts showed a significant up-regulation in

Table 1 Primers used in the RT-qPCR study. *Location of the primers for the rat sequence in Gene Bank. Gen

GenBank number

Primer forward

cDNA forward*

Primer reverse

cDNA reverse*

Product size

slope

E**

R2

GluA2 GluA3 GluA4 Glud1 Chrna7 Drd2

NM_017261 NM_032990 NM_017263.2 NM_012570 NM_012832.3 NM_012547.1

CGGCAGCTCAGCTAAAAACT ATTGCTGATGGTGCAATGAC GGCAGAGCCGTCTGTGTTCA AATTCTGGGCTTCCCCAAAG ACAGTAACCATGCGCCGTA TGATTGCAACATCCCACCAG

173e192 2834e2853 2255e2275 1131e1151 283e302 1546e1565

TTGTAGCTGGTGGCTGTTGA TTTGCATTGTCGCAAGTCTC CAGGGCTTTCGCTGCTCAAT CTGGGTGCATTGGA TTTGGT TGCAGGCAGCAAGAATACCA GCGGAACTCGATGTTGAAGG

243e262 2909e2928 2361e2380 1225e1244 364e383 1651e1632

90 95 126 114 101 87

3.11 3.07 3.13 3.23 3.20 3.01

109.4 111.5 108.2 103.7 105.2 114.7

0.997 0.994 0.997 0.997 0.994 0.981

74

V. Lamas et al. / Hearing Research 346 (2017) 71e80

Fig. 2. Extent of the AC ablations in the rat brain. A. Example of a coronal section from an animal that received lesion, and the corresponding drowing line showing the auditory cortex subdivisions affected by the ablation. AuD ¼ Dorsal Auditory Cotex. Au1 ¼ Primary Auditory Cortex. AuV ¼ Ventral Auditory Cortex (Paxinos and Watson rat brain atlas 2005). Note that ablation affect all AC layers but not the underlying white matter (WM). B. Overlapping map of the cortex on a lesioned brain, positioned into a matrix to calculate the extension and location of the ablated surface relative to the AC boundaries (according to Lamas et al., 2013). AC ¼ Auditory Cortex. RF ¼ Rhinal Fissure. C. Percentage of AC affected by lesions in the experimental groups. Data are presented by Mean ± standard deviation.

the cochleae ipsilateral to the ablation at 1 day after surgery (p < 0.05). Transcript levels increased further at 7 days, reaching 2.5- fold relative to control values, and returned to values similar to those at 1 day post lesion at 15 days (Fig. 3B, grey bars). The cochleae contralateral to the lesion showed a significant downregulation of GluA3 transcripts at 1 day after the ablation (p < 0.001), whereas at 7 days transcripts were up-regulated twofold relative to control values. Levels returned to values similar to those of controls at 15 days (Fig. 3B, white bars). GluA4-subunit transcripts showed significant down-regulation relative to controls in both cochleae, ipsi- and contralateral to the ablation at 1 day (p < 0.001). There was a return to values similar to controls at 7 days. However, 15 days after AC ablation, GluA4 mRNA levels were higher relative to control values in the cochleae ipsilateral to the cortical ablation, but decreased again in the contralateral side (Fig. 3C). Glud1 transcripts did not show significant changes relative to control values at either 1 or 7 days post lesion. However, they were up-regulated in both cochleae, ipsi- and contralateral to the ablation, at 15 days. Levels were nine fold above controls in the ipsilateral cochlea and 7 fold in the contralateral (Fig. 4).

3.3. a7 nAchR and D2 dopamine receptor mRNA The transcripts for a7 acetylcholine receptor which are expressed in the adult type I SGN of rats, and have been pointed as the main candidate to constitute the cholinergic LOC post synaptic receptor (Morley et al., 1998) were analyzed by RT-qPCR at 1, 7 and 15 survival days after unilateral AC ablation. Since LOC efferents also contain dopamine (Eybalin et al., 1993; Gil-Loyzaga, 1995), the transcripts for D2 dopamine receptors, expressed in adult spiral ganglion neurons (Maison et al., 2012), were also analyzed by RT-qPCR.

a7 nAchR tanscripts showed significant up-regulation in both ipsi- and contralateral cochleae at all times after AC ablation. An exception was the a7 subunit transcripts in the contralateral cochlea at 7 days, which were not significantly different to control values (Fig. 5A). Up-regulation of a7 nAchR subunit transcripts was between 25- and 60- fold above control values in the cochlea ipsilateral to the ablation, and between 15- and 40- fold in the cochlea contralateral to the ablation (Fig. 5A). Transcripts for D2 dopamine receptor also showed a significant up-regulation in both ipsi- and contralateral cochleae at all postsurgery times (Fig. 5B). Increases were between 2- and 3- fold for all survival times, with the exception of the ipsilateral cochlea at 15 days. At this time point, the increase in the D2 transcripts was 5fold relative to controls. 3.4. a1 and g2 subunits of the ionotropic GABAA receptor mRNA The gabaergic nature of the olivocochlear efferents and the location of the GABAA receptor subunits in the cochlea are known from previous immunohistochemistry studies (Maison et al., 2006, 2003; Vetter et al., 1991; Yamamoto et al., 2002). Thus, the transcripts for a1 and g2 subunits of the ionotropic GABAA receptor were analyzed by RT-qPCR at 1, 7, and 15 survival days after unilateral AC ablation. One day after the AC ablation, a strong up-regulation (p < 0.001) for a1-subunit transcripts (40 fold relative to control values) was found in the cochlea ipsilateral to the ablation (Fig. 6A grey bars). Increased transcript levels were still present at 7 days, with values 10 fold over controls (p < 0.001). However, at 15 days post lesion, there was no statistically significant difference to control values. The cochlea contralateral to the ablation side showed an upregulation above 10 fold relative to control values in a1-subunit

V. Lamas et al. / Hearing Research 346 (2017) 71e80

75

Fig. 4. Changes in mRNA levels of glud1 after unilateral AC ablations at different post-surgery days. Results are presented by the mean ± standard deviation of the fold change. The statistical significance of the comparison between fold changes of the post-surgery days and control condition is showed in the top of the bars. Bars from the survival time that present differences between ipsi- and contralateral ears are framed in a box, and their statistical significance is showed at the bottom. *p < 0.05; **p < 0.01; ***p < 0.001.

ipsilateral to the ablation (Fig. 6B grey bars). However, transcript levels returned to values similar to controls at 15 days. No statistically significant changes in g2 transcripts relative to controls were found in the cochlea contralateral to the ablation at any postsurgery time point. 4. Discussion We have found that unilateral AC ablations induce changes in the expression of genes related to IHC neurotransmission that suggest an inner ear homeostatic reorganization seeking to recover the normal activity of the auditory nerve along 15 days after AC ablation (Fig. 7B), supporting the idea of an active descending cortical regulation of the auditory activity down to the receptor. 4.1. Loss of cortical efferent activation reapportions the transcripts for AMPAR subunits

Fig. 3. Changes in mRNA levels of AMPA receptor subunits after unilateral AC ablations at different post-surgery days. A. Data for GluA2. B. Data for GluA3. C. Data for GluA4. Results are presented by the mean ± standard deviation of the fold change. The statistical significance of the comparison between fold changes of the post-surgery days and control condition is showed in the top of the bars. Bars from the survival time that present differences between ipsi- and contralateral ears are framed in a box, and their statistical significance is showed at the bottom. *p < 0.05; **p < 0.01; ***p < 0.001.

transcripts at 1 and 15 days (p < 0.001), whereas there were no significant changes at 7 days after the ablation (Fig. 6A white bars). Levels of g2 subunit transcripts showed down-regulation (p < 0.001) at both 1 and 7 days after the ablation in the cochlea

Loss of corticofugal inputs causes an up-regulation of the GluA3 subunit and a down-regulation of GluA2 and GluA4 in both cochleae ipsi and contralateral to the AC ablation. As far as glutamatergic neurotransmission at the level of the IHC is concerned, it is known that reconfigurations in the tetrameric composition of AMPA glutamate receptors in the neuronal membrane determine the dynamics of synaptic transmission, inducing plastic adaptive responses (Derkach et al., 2007; Thiagarajan et al., 2005; Turrigiano et al., 1998; Wang et al., 2012). “In vitro” studies have reported the appearance of more permeable postsynaptic GluA2 lacking AMPA receptors, as a result of synaptic scaling mechanisms after 24 h blockade of presynaptic glutamate delivery (Ju et al., 2004). Accordingly, the up-regulation in GluA3 transcripts and the downregulation in GluA2 AMPA receptor subunits, as we have observed here after AC lesion, suggest a change in the synthesis of the AMPA

76

V. Lamas et al. / Hearing Research 346 (2017) 71e80

Fig. 5. Changes in mRNA levels of a7 acetylcholine and D2 dopamine receptors after unilateral AC ablations at different post-surgery days. A. Data for a7 acetylcholine receptor. B. Data for D2 dopamine receptors. Results are presented by the mean ± standard deviation of the fold change. The statistical significance of the comparison between fold changes of the post-surgery days and control condition is showed in the top of the bars. Bars from the survival time that present differences between ipsi- and contralateral ears are framed in a box, and their statistical significance is showed at the bottom. *p < 0.05; **p < 0.01; ***p < 0.001.

receptor subunits that might be a mechanism of the Type I SGN to compensate for a drop in the glutamate released from IHC. This notion is also consistent with the results obtained in experiments of sensory deprivation induced by either ablation of the cochlea (Rubio, 2006) or auditory channel occlusion (Wang et al., 2011; Whiting et al., 2009), where GluA3 overexpression in the cochlear nucleus was interpreted as a mechanism to compensate for auditory nerve loss of excitation. Furthermore, a down-regulation in the transcripts of GluA4, as shown here at 1 day after AC ablation, could lead to AMPA receptors to deactivate more slowly (Mosbacher et al., 1994), which might facilitate ion entry, and thus increase the probability of action potential firing. In the cochlea, depolarization and subsequent release of glutamate by the IHC is an effect of their cilia deflection determined by

Fig. 6. Changes in mRNA levels of GABAA receptor subunits after unilateral AC ablations at different post-surgery days. A Data for a1-GABAA subunit. B. Data for g2-GABAA subunit. Results are presented by the mean ± standard deviation of the fold change. The statistical significance of the comparison between fold changes of the post-surgery days and control condition is showed in the top of the bars. Bars from the survival time that present differences between ipsi- and contralateral ears are framed in a box, and their statistical significance is showed at the bottom. *p < 0.05; **p < 0.01; ***p < 0.001.

the vibration state of the basilar membrane, which can be regulated by MOC efferent control of OHC electromotility (Dallos, 2008). Previous anatomical studies have shown that corticopontine projections are bilateral, although more dense in the ipsilateral (Coomes and Schofield, 2004; Doucet et al., 2002; Doucet and Ryugo, 2003; Feliciano et al., 1995; Schofield and Coomes, 2005; ~ a et al., 1996), and innervate MOC neurons in the ventral Saldan nucleus of the trapezoid body (Mulders and Robertson, 2000a). MOC neurons, in turn, send efferent axons bilaterally to OHCs (Brown et al., 2013). Due to the excitatory nature of the corticofugal projection (Feliciano and Potashner, 1995), we suggest that the changes observed here in the expression of the AMPA receptor subunits in both cochleae following AC ablation could be a compensatory mechanism of the type I SGN for a drop in the glutamate release resulting from a diminished efferent control of the micromechanical activity after the loss of descending inputs on MOC neurons. The increase in the transcripts for both prestin and a10 nAchR subunits, as well as the changes in the oligomerization

V. Lamas et al. / Hearing Research 346 (2017) 71e80

77

Fig. 7. A. Schematic of the efferent projections to the cochlea. The bilateral nature, with a weaker contralateral component, of the cortical descending projection has been shown in ~ a, 2015). Injections with retrograde tracers in the cochlea showed labeled MOC and LOC previous anatomical studies (Coomes and Schofield, 2004; Feliciano et al., 1995; Saldan neurons in the brainstem, with MOC neurons primarily contralateral, and LOC neurons primarily ipsilateral (Brown et al., 2013). The neurotransmitters containing each efferent projection are indicated according to what is known from the literature (Feliciano and Potashner, 1995; Raphael and Altschuler, 2003). B. Schematic model that summarizes the main results obtained here for the changes in the transcripts at 1, 7, and 15 survival days after unilateral AC ablation.

of the prestin protein previously reported by us after AC ablations (Lamas et al., 2015) suggest a central role of the descending control in the regulation of the inner ear micromechanical machinery that could in turn affect the IHC depolarization. 4.2. Loss of cortical efferent activation increases the transcripts for LOC post synaptic receptors Unilateral AC ablations produce a bilateral up-regulation (up to a 60 fold change) in the transcripts of a7 nAchR 1 after the injury. It is known that Acetylcholine is the main neurotransmitter in LOC efferent neurons (Eybalin and Pujol, 1987; Vetter et al., 1991; Warr, 1975). Its potential excitatory effect was suggested by microiontophoretic delivery in the region of the IHCs, which leads to increased spontaneous and glutamate-evoked activity in type I SGN (Felix and Ehrenberger, 1992). Due to the excitatory nature of the corticofugal projection (Feliciano and Potashner, 1995), the loss of AC descending connections after cortical ablation should, at least in part, decrease the activity of LOC neurons. Accordingly, the up-regulation in the transcripts for a7 nAchR shown by us, could be interpreted as a homeostatic compensation of type I SGNs after diminished Acetylcholine release from LOC synapses. In parallel to the up-regulation of the a7 subunit nAChR transcripts, one day after the injury we also observed a bilateral upregulation in the transcripts for both the a1 subunit of the GABAA receptor and D2 dopamine receptors. Previous immunocytochemical studies have shown that LOC efferents contain several other

neurotransmitters besides Ach, including GABA, dopamine and different neuropeptides (Vetter et al., 1991; Eybalin et al., 1993; GilLoyzaga, 1995; Safieddine et al., 1997). Due to complex interactions of these neurotransmitters in regulating the responses of the auditory nerve, their final individual effects on inner ear function are not clearly understood. Nevertheless, the inhibitory nature of both GABA and dopaminergic neurotransmission in the inner ear has previously been reported (Felix and Ehrenberger, 1992; Ruel
borj
et al., 2001; d'Aldin et al., 1995b; Ga an et al., 1999; Garrett et al., 2011; Le Prell et al., 2005). The combined up-regulation of the transcripts for receptors of both excitatory (such Acetylcholine) and inhibitory neurotransmitters (such GABA and Dopamine) shown in this paper after AC ablation, suggest a homeostatic response of the receptors turnover that might be induced to rebalance the inner ear excitatory-inhibitory neurotransmission after changes in efferent system activation. Fifteen days after AC ablation, the up-regulation of both a7 nAchR and a1 subunit of the GABAA receptor was bilaterally diminished relative to their levels at 1 day. The down-regulation of these receptors may reflect the adaptations of type I SGN to the ongoing compensatory mechanisms leading the system back to the pre-lesion condition. The recovery in threshold and ABR waves amplitude previously reported at 15 days after AC ablations (Lamas et al., 2013) supports the effectiveness of this potential molecular reorganization of receptors in recovering the normal auditory nerve function. However, further experiments studying protein expression and/or electrophysiology should be done to confirm this plastic regulation.

78

V. Lamas et al. / Hearing Research 346 (2017) 71e80

4.3. Loss of cortical efferent activation increases the transcripts for glud1 Fifteen days after AC ablations, we observed an up-regulation in the transcripts for glud1in both cochleae that it was not seen at 1 and 7 days after the injury. Glud1 is an enzyme responsible for regulating the synaptic turnover of glutamate (see a review in Cooper, 2012; Nedergaard et al., 2002). Experiments carried out in guinea pigs have shown that the perfusion of this enzyme into the cochlea decreases the intensity function of the auditory nerve compound action potential (Rebillard and Bryant, 1989). Although glud1 is expressed in glutamatergic pathways, its function as a regulator of glutamate neurotransmitter levels in the inner ear is still not fully established. An indirect relationship between Glud1 synthesis and glutamatergic neurotransmission has been shown by the increased consumption of ATP under conditions of intense glutamatergic neurotransmission (Plaitakis and Zaganas, 2001), and after analyzing Cns-Glud1/ Glud1 null mice (Karaca and Maechler, 2014; Michaelis et al., 2011). After cortical ablations significant changes in this enzyme were only shown at 15 days (Fig. 4). By the time line coincidence of this result with the recovery of amplitudes and latencies shown in a previous paper by us (Lamas et al., 2013), the up-regulation of glud1 could be related with an effect of rebalance the auditory nerve activation after AC ablation. The up-regulation of glud1 at 15 days coincides with an upregulation of the D2 dopamine receptors in the cochlea ipsilateral to the AC ablation. This phenomena also suggests a potential close association between glutamate delivery and dopamine receptor synthesis. A role in preserving inner ear from excitotoxicity has been widely attributed to Dopamine (d'Aldin et al., 1995a; c; GilLoyzaga, 1995; d’Aldin et al., 1995b; Ruel et al., 2001; Lendvai et al., 2011; Inoue et al., 2006; Garrett et al., 2011; Maison et al., 2012). Accordingly the parallel up-regulation of glu1 and dopamine D2 receptors shown by us may also suggest a cellular response of type I SGN to compensate for changes in IHC glutamate neurotransmission. However, the nature of these changes is unknown and need to be investigated in the future.

4.4. Contralateral SGN respond to the loss of cortical efferent activation by increasing LOC post synaptic receptors Our data show lower but significant changes in the LOC postsynaptic transcripts of the cochlea contralateral to the AC lesion. Previous anatomical studies have shown that the cortical descending projection to the auditory brainstem nuclei ends bilaterally, albeit with a weaker contralateral component (Coomes ~ a, 2015; here and Schofield, 2004; Feliciano et al., 1995; Saldan Fig. 7A). In addition, the 90e94% of LOC neurons send efferents to the ipsilateral ear (Brown et al., 2013; here Fig. 7A). Based on this anatomical distribution, we should expect greater effects of the corticofugal deprivation in the ipsilateral ear. Nevertheless, our data also show significant changes in the LOC post synaptic transcripts in the cochlea contralateral to the AC lesion. The bilateral nature of the corticofugal projection could explain the changes observed by us in the cochlea contralateral to the ablation. Alternatively, plastic changes occurring in the auditory brainstem nuclei, that receive an imbalanced excitation from the auditory nerve from the side of the AC ablation, may also contribute to the changes observed in the transcripts at the contralateral afferent synapse. More studies are needed to determine the significance and the source of the changes observed at the cochlear afferent synapse in response to contralateral deprivation of the descending AC inputs.

5. Conclusions Unilateral ablations of the AC induce changes in the expression of transcripts related to glutamatergic neurotransmission in the cochlea that may be involved in the dynamic rebalance of type I SGN response after a loss in IHC glutamatergic activation. AC ablations also cause an up-regulation of transcripts involved in the efferent regulation of type I SGN mediated by LOC, suggesting adaptations of the auditory nerve to compensate for a loss in LOC activation. Taken together, our results suggest a complex regulation of the excitatory and inhibitory receptors that operates along time to dynamically rebalance type I SGN neurotransmission in the inner ear after AC unilateral ablation. Conflict of interest statement The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Authors contributions MAM and VL designed the experiments. VL performed the experiments and analyzed data. VL, JMJ and MAM participated in the discussion of the results. VL, MAM and JMJ, wrote the paper. Acknowledgements
n and The authors would like to thank Javier Herrero Turrio Ignacio Plaza for their excellent technical assistance. This research was supported by a grant from the Ministry of Economy and Competitiveness (MINECO) of the Government of Spain, SAF201678898-C2-2-R. References Andersen, C.L., Jensen, J.L., Ørntoft, T.F., 2004. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, 5245e5250. http://dx.doi.org/10.1158/ 0008-5472.CAN-04-0496. Bajo, V.M., Moore, D.R., 2005. Descending projections from the auditory cortex to the inferior colliculus in the gerbil, Meriones unguiculatus. J. Comp. Neurol. 486, 101e116. http://dx.doi.org/10.1002/cne.20542. Brown, M.C., Mukerji, S., Drottar, M., Windsor, A.M., Lee, D.J., 2013. Identification of inputs to olivocochlear neurons using transneuronal labeling with pseudorabies virus (PRV). J. Assoc. Res. Otolaryngol. 14, 703e717. http://dx.doi.org/10.1007/ s10162-013-0400-5. Coomes, D.L., Schofield, B.R., 2004. Projections from the auditory cortex to the superior olivary complex in guinea pigs. Eur. J. Neurosci. 19, 2188e2200. http:// dx.doi.org/10.1111/j.0953-816X.2004.03317.x. Cooper, A.J.L., 2012. The role of glutamine synthetase and glutamate dehydrogenase in cerebral ammonia homeostasis. Neurochem. Res. 37, 2439e2455. http:// dx.doi.org/10.1007/s11064-012-0803-4. d'Aldin, C., Eybalin, M., Puel, J.L., Charachon, G., Ladrech, S., Renard, N., Pujol, R., 1995a. Synaptic connections and putative functions of the dopaminergic innervation of the guinea pig cochlea. Eur. Arch. Otorhinolaryngol. 252, 270e274. d'Aldin, C., Puel, J.L., Leducq, R., Crambes, O., Eybalin, M., Pujol, R., 1995b. Effects of a dopaminergic agonist in the guinea pig cochlea. Hear. Res. 90, 202e211. Dallos, P., 2008. Cochlear amplification, outer hair cells and prestin. Curr. Opin. Neurobiol. 18, 370e376. http://dx.doi.org/10.1016/j.conb.2008.08.016. Derkach, V.A., Oh, M.C., Guire, E.S., Soderling, T.R., 2007. Regulatory mechanisms of AMPA receptors in synaptic plasticity. Nat. Rev. Neurosci. 8, 101e113. http:// dx.doi.org/10.1038/nrn2055.
nyi, Z., Halmos, G., Re
pa
ssy, G., Vizi, E.S., Zelles, T., Lendvai, B., 2005. Dolevicze Cochlear dopamine release is modulated by group II metabotropic glutamate receptors via GABAergic neurotransmission. Neurosci. Lett. http://dx.doi.org/ 10.1016/j.neulet.2005.05.017. Doucet, J.R., Rose, L., Ryugo, D.K., 2002. The cellular origin of corticofugal projections to the superior olivary complex in the rat. Brain Res. 925, 28e41. Doucet, J.R., Ryugo, D.K., 2003. Axonal pathways to the lateral superior olive labeled

V. Lamas et al. / Hearing Research 346 (2017) 71e80 with biotinylated dextran amine injections in the dorsal cochlear nucleus of rats. J. Comp. Neurol. 461, 452e465. http://dx.doi.org/10.1002/cne.10722.
n, A., Bowen, M., Jara, N., Terreros, G., Robles, L., Dragicevic, C.D., Aedo, C., Leo Delano, P.H., 2015. The olivocochlear reflex strength and cochlear sensitivity are independently modulated by auditory cortex microstimulation. JARO - J. Assoc. Res. Otolaryngol. 16, 223e240. http://dx.doi.org/10.1007/s10162-015-0509-9. Drescher, D.G., Green, G.E., Khan, K.M., Hajela, K., Beisel, K.W., Morley, B.J., Gupta, a K., 1993. Analysis of gamma-aminobutyric acidA receptor subunits in the mouse cochlea by means of the polymerase chain reaction. J. Neurochem. 61, 1167e1170. Elgoyhen, a B., Vetter, D.E., Katz, E., Rothlin, C.V., Heinemann, S.F., Boulter, J., 2001. Alpha10: a determinant of nicotinic cholinergic receptor function in mammalian vestibular and cochlear mechanosensory hair cells. Proc. Natl. Acad. Sci. U. S. A. 98, 3501e3506. http://dx.doi.org/10.1073/pnas.051622798. Eybalin, M., Charachon, G., Renard, N., 1993. Dopaminergic lateral efferent innervation of the guinea-pig chochlea: immunoelectron microscopy of catecholamine-synthesizing enzymes and effect of 6-hydroxydopamine. Neuroscience 54, 133e142. http://dx.doi.org/10.1016/0306-4522(93)90389-W. Eybalin, M., Pujol, R., 1987. Choline acetyltransferase (ChAT) immunoelectron microscopy distinguishes at least three types of efferent synapses in the organ of Corti. Exp. Brain Res. 65, 261e270. http://dx.doi.org/10.1007/BF00236298. Feliciano, M., Potashner, S.J., 1995. Evidence for a glutamatergic pathway from the Guinea pig auditory cortex to the inferior colliculus. J. Neurochem. 65, 1348e1357. http://dx.doi.org/10.1046/j.1471-4159.1995.65031348.x. Feliciano, M., Saldana, E., Mugnaini, E., 1995. Direct projections from the rat primary auditory neocortex to nucleus sagulum, paralemniscal regions. Super. Olivary Complex Cochlear Nucl. 1, 287e308. Felix, D., Ehrenberger, K., 1992. The efferent modulation of mammalian inner hair cell afferents. Hear. Res. 64, 1e5. Fleige, S., Walf, V., Huch, S., Prgomet, C., Sehm, J., Pfaffl, M.W., 2006. Comparison of relative mRNA quantification models and the impact of RNA integrity in quantitative real-time RT-PCR. Biotechnol. Lett. 28, 1601e1613. http:// dx.doi.org/10.1007/s10529-006-9127-2. G
aborj
an, A., Lendvai, B., Vizi, E.S., 1999. Neurochemical evidence of dopamine release by lateral olivocochlear efferents and its presynaptic modulation in guinea-pig cochlea. Neuroscience 90, 131e138. http://dx.doi.org/10.1016/ S0306-4522(98)00461-8. Garrett, A.R., Robertson, D., Sellick, P.M., Mulders, W.H. a M., 2011. The actions of dopamine receptors in the guinea pig cochlea. Audiol. Neurootol. 16, 145e157. http://dx.doi.org/10.1159/000316674. Gil-Loyzaga, P.E., 1995. Neurotransmitters of the olivocochlear lateral efferent system: with an emphasis on dopamine. Acta Otolaryngol. 115, 222e226. Glowatzki, E., Fuchs, P. a, 2002. Transmitter release at the hair cell ribbon synapse. Nat. Neurosci. 5, 147e154. http://dx.doi.org/10.1038/nn796. Inoue, T., Matsubara, A., Maruya, S., Yamamoto, Y., Namba, A., Sasaki, A., Shinkawa, H., 2006. Localization of dopamine receptor subtypes in the rat spiral ganglion. Neurosci. Lett. 399, 226e229. http://dx.doi.org/10.1016/ j.neulet.2006.01.063. €ger, K., Ko € ssl, M., 2016. Corticofugal modulation of DPOAEs in gerbils. Hear. Res. Ja 332, 61e72. http://dx.doi.org/10.1016/j.heares.2015.11.008. Ju, W., Morishita, W., Tsui, J., Gaietta, G., Deerinck, T.J., Adams, S.R., Garner, C.C., Tsien, R.Y., Ellisman, M.H., Malenka, R.C., 2004. Activity-dependent regulation of dendritic synthesis and trafficking of AMPA receptors. Nat. Neurosci. 7, 244e253. http://dx.doi.org/10.1038/nn1189. Karaca, M., Maechler, P., 2014. Development of mice with brain-specific deletion of floxed glud1 (glutamate dehydrogenase 1) using cre recombinase driven by the nestin promoter. Neurochem. Res. 39, 456e459. http://dx.doi.org/10.1007/ s11064-013-1041-0. Khalfa, S., Bougeard, R., Morand, N., Veuillet, E., Isnard, J., Guenot, M., Ryvlin, P., Fischer, C., Collet, L., 2001. Evidence of peripheral auditory activity modulation by the auditory cortex in humans. Neuroscience 104, 347e358. http:// dx.doi.org/10.1016/S0306-4522(01)00072-0. Kuriyama, H., Jenkins, O., Altschuler, R. a, 1994. Immunocytochemical localization of AMPA selective glutamate receptor subunits in the rat cochlea. Hear. Res. 80, 233e240.
n, M. a, 2013. Long-term evolution of Lamas, V., Alvarado, J.C., Carro, J., Mercha brainstem electrical evoked responses to sound after restricted ablation of the auditory cortex. PLoS One 8, e73585. http://dx.doi.org/10.1371/ journal.pone.0073585. Lamas, V., Arevalo, J.C., Juiz, J.M., Merchan, M.A., 2015. Acoustic input and efferent activity regulate the expression of molecules involved in cochlear micromechanics. Front. Syst. Neurosci. 8, 1e8. http://dx.doi.org/10.3389/ fnsys.2014.00253.
th, T., Aller, M., Sylvester Lendvai, B., Halmos, G.B., Polony, G., Kapocsi, J., Horva Vizi, E., Zelles, T., 2011. Chemical neuroprotection in the cochlea: the modulation of dopamine release from lateral olivocochlear efferents. Neurochem. Int. 59, 150e158. http://dx.doi.org/10.1016/j.neuint.2011.05.015.
n, A., Elgueda, D., Silva, M. a, Hamame
, C.M., Delano, P.H., 2012. Auditory cortex Leo basal activity modulates cochlear responses in chinchillas. PLoS One 7, e36203. http://dx.doi.org/10.1371/journal.pone.0036203. Le Prell, C.G., Halsey, K., Hughes, L.F., Dolan, D.F., Bledsoe, S.C., 2005. Disruption of lateral olivocochlear neurons via a dopaminergic neurotoxin depresses sound [HYPHEN]evoked auditory nerve activity. J. Assoc. Res. Otolaryngol. 6, 48e62. http://dx.doi.org/10.1007/s10162-004-5009-2. Liberman, M.C., 1980. Efferent synapses in the inner hair cell area of the cat cochlea:

79

an electron microscopic study of serial sections. Hear. Res. 3, 189e204. http:// dx.doi.org/10.1016/0378-5955(80)90046-5. Liu, X., Yan, Y., Wang, Y., Yan, J., 2010. Corticofugal modulation of initial neural processing of sound information from the ipsilateral ear in the mouse. PLoS One 5, e14038. http://dx.doi.org/10.1371/journal.pone.0014038. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402e408. http://dx.doi.org/10.1006/meth.2001.1262. Luo, F., Wang, Q., Kashani, A., Yan, J., 2008. Corticofugal modulation of initial sound processing in the brain. J. Neurosci. 28, 11615e11621. http://dx.doi.org/10.1523/ JNEUROSCI.3972-08.2008. Maison, S.F., Adams, J.C., Liberman, M.C., 2003. Olivocochlear innervation in the mouse: immunocytochemical maps, crossed versus uncrossed contributions, and transmitter colocalization. J. Comp. Neurol. 455, 406e416. http:// dx.doi.org/10.1002/cne.10490. Maison, S.F., Liu, X.-P., Eatock, R.A., Sibley, D.R., Grandy, D.K., Liberman, M.C., 2012. Dopaminergic signaling in the cochlea: receptor expression patterns and deletion phenotypes. J. Neurosci. 32, 344e355. http://dx.doi.org/10.1523/ JNEUROSCI.4720-11.2012. Maison, S.F., Rosahl, T.W., Homanics, G.E., Liberman, M.C., 2006. Functional role of GABAergic innervation of the cochlea: phenotypic analysis of mice lacking GABA(A) receptor subunits alpha 1, alpha 2, alpha 5, alpha 6, beta 2, beta 3, or delta. J. Neurosci. 26, 10315e10326. http://dx.doi.org/10.1523/JNEUROSCI.239506.2006. Maison, S.F., Vetter, D.E., Liberman, M.C., 2007. A novel effect of cochlear efferents: in vivo response enhancement does not require alpha9 cholinergic receptors. J. Neurophysiol. 97, 3269e3278. http://dx.doi.org/10.1152/jn.00067.2007. Malmierca, M.S., Le Beau, F.E., Rees, a, 1996. The topographical organization of descending projections from the central nucleus of the inferior colliculus in guinea pig. Hear. Res. 93, 167e180. Malmierca, M.S., Ryugo, D.K., 2011. Descending connections of auditory cortex to the midbrain and brain stem. In: The Auditory Cortex, pp. 189e208. http:// dx.doi.org/10.1007/978-1-4419-0074-6. Michaelis, E.K., Wang, X., Pal, R., Bao, X., Hascup, K.N., Wang, Y., Wang, W.-T., Hui, D., Agbas, A., Choi, I., Belousov, A., Gerhardt, G.A., 2011. Neuronal Glud1 (glutamate dehydrogenase 1) over-expressing mice: increased glutamate formation and synaptic release, loss of synaptic activity, and adaptive changes in genomic expression. Neurochem. Int. 59, 473e481. http://dx.doi.org/10.1016/ j.neuint.2011.03.003. Morley, B.J., Li, H.S., Hiel, H., Drescher, D.G., Elgoyhen, a B., 1998. Identification of the subunits of the nicotinic cholinergic receptors in the rat cochlea using RT-PCR and in situ hybridization. Brain Res. Mol. Brain Res. 53, 78e87. Mosbacher, J., Schoepfer, R., Monyer, H., Burnashev, N., Seeburg, P.H., Ruppersberg, J.P., 1994. A molecular determinant for submillisecond desensitization in glutamate receptors. Science 266, 1059e1062. Mulders, W.H.A.M., Robertson, D., 2000a. E ¡ ects on Cochlear Responses of Activation of Descending Pathways from the Inferior Colliculus, vol. 149, pp. 11e23. Mulders, W.H., Robertson, D., 2000b. Evidence for direct cortical innervation of medial olivocochlear neurones in rats. Hear. Res. 144, 65e72. Nedergaard, M., Takano, T., Hansen, A.J., 2002. Beyond the role of glutamate as a neurotransmitter. Nat. Rev. Neurosci. 3, 748e755. http://dx.doi.org/10.1038/ nrn916. Niedzielski, a S., Wenthold, R.J., 1995. Expression of AMPA, kainate, and NMDA receptor subunits in cochlear and vestibular ganglia. J. Neurosci. 15, 2338e2353.
not, M., Catenoix, H., Fischer, C., Mauguie re, F., Perrot, X., Ryvlin, P., Isnard, J., Gue Collet, L., 2006. Evidence for corticofugal modulation of peripheral auditory activity in humans. Cereb. Cortex 16, 941e948. http://dx.doi.org/10.1093/cercor/ bhj035. Plaitakis, a, Zaganas, I., 2001. Regulation of human glutamate dehydrogenases: implications for glutamate, ammonia and energy metabolism in brain. J. Neurosci. Res. 66, 899e908. Raphael, Y., Altschuler, R. a, 2003. Structure and innervation of the cochlea. Brain Res. Bull. 60, 397e422. http://dx.doi.org/10.1016/S0361-9230(03)00047-9. Rebillard, G., Bryant, G.M., 1989. Effects of in vivo perfusion of glutamate dehydrogenase in the guinea pig cochlea on the VIIIth nerve compound action potential. Brain Res. 494, 379e382. Rubio, M.E., 2006. Redistribution of synaptic AMPA receptors at glutamatergic synapses in the dorsal cochlear nucleus as an early response to cochlear ablation in rats. Hear. Res. 216e217, 154e167. http://dx.doi.org/10.1016/ j.heares.2006.03.007. Ruel, J., Bobbin, R.P., Vidal, D., Pujol, R., Puel, J.L., 2000. The selective AMPA receptor antagonist GYKI 53784 blocks action potential generation and excitotoxicity in the guinea pig cochlea. Neuropharmacology 39, 1959e1973. Ruel, J., Nouvian, R., Gervais d'Aldin, C., Pujol, R., Eybalin, M., Puel, J.L., 2001. Dopamine inhibition of auditory nerve activity in the adult mammalian cochlea. Eur. J. Neurosci. 14, 977e986. Safieddine, S., Prior, A.M., Eybalin, M., 1997. Choline acetyltransferase, glutamate decarboxylase, tyrosine hydroxylase, calcitonin gene-related peptide and opioid peptides coexist in lateral efferent neurons of rat and guinea-pig. Eur. J. Neurosci. 9, 356e367. ~ a, E., 2015. All the way from the cortex: a review of auditory corticoSaldan subcollicular pathways. Cerebellum 14, 584e596. http://dx.doi.org/10.1007/ s12311-015-0694-4. ~ a, E., Feliciano, M., Mugnaini, E., 1996. Distribution of descending projections Saldan from primary auditory neocortex to inferior colliculus mimics the topography

80

V. Lamas et al. / Hearing Research 346 (2017) 71e80

of intracollicular projections. J. Comp. Neurol. 371, 15e40. http://dx.doi.org/ 10.1002/(SICI)1096-9861(19960715)371:13.0.CO;2-O. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 1101e1108. Schofield, B.R., Coomes, D.L., 2005. Auditory cortical projections to the cochlear nucleus in guinea pigs. Hear. Res. 199, 89e102. http://dx.doi.org/10.1016/ j.heares.2004.08.003. Suga, N., Xiao, Z., Ma, X., Ji, W., 2002. Plasticity and corticofugal modulation for hearing in adult animals. Neuron 36, 9e18. Thiagarajan, T.C., Lindskog, M., Tsien, R.W., 2005. Adaptation to synaptic inactivity in hippocampal neurons. Neuron 47, 725e737. http://dx.doi.org/10.1016/ j.neuron.2005.06.037. Thompson, a M., Schofield, B.R., 2000. Afferent projections of the superior olivary complex. Microsc. Res. Tech. 51, 330e354. http://dx.doi.org/10.1002/10970029(20001115)51:43.0.CO;2-X. Turrigiano, G.G., Leslie, K.R., Desai, N.S., Rutherford, L.C., Nelson, S.B., 1998. Activitydependent scaling of quantal amplitude in neocortical neurons. Nature 391, 892e896. http://dx.doi.org/10.1038/36103. Vetter, D.E., Adams, J.C., Mugnaini, E., 1991. Chemically distinct rat olivocochlear neurons. Synapse 7, 21e43. http://dx.doi.org/10.1002/syn.890070104. Vetter, D.E., Katz, E., Maison, S.F., Taranda, J., Turcan, S., Ballestero, J., Liberman, M.C., Elgoyhen, a B., Boulter, J., 2007. The alpha10 nicotinic acetylcholine receptor subunit is required for normal synaptic function and integrity of the olivocochlear system. Proc. Natl. Acad. Sci. U. S. A. 104, 20594e20599. http://dx.doi.org/ 10.1073/pnas.0708545105. Wang, G., Gilbert, J., Man, H.Y., 2012. AMPA receptor trafficking in homeostatic

synaptic plasticity: functional molecules and signaling cascades. Neural Plast. http://dx.doi.org/10.1155/2012/825364. Wang, H., Yin, G., Rogers, K., Miralles, C., De Blas, a L., Rubio, M.E., 2011. Monaural conductive hearing loss alters the expression of the GluA3 AMPA and glycine receptor a1 subunits in bushy and fusiform cells of the cochlear nucleus. Neuroscience 199, 438e451. http://dx.doi.org/10.1016/j.neuroscience.2011. 10.021. Warr, W.B., 1975. Olivocochlear and vestibular efferent neurons of the feline brain stem: their location, morphology and number determined by retrograde axonal transport and acetylcholinesterase histochemistry. J. Comp. Neurol. 161, 159e181. http://dx.doi.org/10.1002/cne.901610203. Whiting, B., Moiseff, a, Rubio, M.E., 2009. Cochlear nucleus neurons redistribute synaptic AMPA and glycine receptors in response to monaural conductive hearing loss. Neuroscience 163, 1264e1276. http://dx.doi.org/10.1016/ j.neuroscience.2009.07.049. Winer, J. a, Diehl, J.J., Larue, D.T., 2001. Projections of auditory cortex to the medial geniculate body of the cat. J. Comp. Neurol. 430, 27e55. Xiao, Z., Suga, N., 2002. Modulation of cochlear hair cells by the auditory cortex in the mustached bat. Nat. Neurosci. 5, 57e63. http://dx.doi.org/10.1038/nn786. Yamamoto, Y., Matsubara, A., Ishii, K., Makinae, K., Sasaki, A., Shinkawa, H., 2002. Localization of gamma-aminobutyric acid A receptor subunits in the rat spiral ganglion and organ of Corti. Acta Otolaryngol. 122, 709e714. Yan, J., Zhang, Y., Ehret, G., 2005. Corticofugal shaping of frequency tuning curves in the central nucleus of the inferior colliculus of mice. J. Neurophysiol. 93, 71e83. http://dx.doi.org/10.1152/jn.00348.2004.