Acclimation to environmentally relevant Mn ...

Accepted Article

Acclimation

to

environmentally

relevant

Mn

concentrations rescues a cyanobacterium from the detrimental effects of iron limitation 1

Authors: Eitan Salomon and Nir Keren Department of Plant and Environmental Science, The Alexander Silberman Institute of Life Sciences, The Hebrew University in Jerusalem

Corresponding author: Nir Keren, Department of Plant and Environmental Science, The Alexander Silberman Institute of Life Sciences, The Hebrew University in Jerusalem. [email protected], +972-2-6585233

Running title: Low Mn rescues Fe limitation effects in a cyanobacterium

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/1462-2920.12826 1 This article is protected by copyright. All rights reserved.

Accepted Article

Summary The functions of micronutrient transition metals in photosynthetic organisms are interconnected. So are the effects of their limitation. Here we present evidence for the effects of Mn limitation on Fe limitation responses in the cyanobacterium Synechocystis sp. PCC 6803. Low Mn acclimated cells were able to detect and respond to iron insufficiency by inducing specific Fe transporters. However, they did not bleach, lose additional photosystem I activity and did not induce isiA

transcription. Induction of the isiAB operon is a hallmark of iron limitation and the isiA protein is considered to be central to the acclimation of the photosynthetic apparatus. Our results suggest that acclimation to environmentally relevant Mn concentration much lower the one used in laboratory experiments, reduces the detrimental effects of iron limitation and modifies iron stress responses.

Introduction A photosynthetic “lifestyle” generates a large demand for macro and micronutrients.

Among the micronutrients, transition metal ions group (TMI) mainly serve as cofactors in electrochemical reactions (Frausto daSilva and Williams 2001). This group includes, iron (Fe) and manganese (Mn) which participate mainly in oxidationreduction reactions (Frausto daSilva and Williams 2001; Hansch and Mendel 2009). The presence of both is required for photosynthetic water splitting (Mn) and electron transfer reactions (Fe). Fe or Mn deprivation decreases photosynthetic activity (Homann 1967; Cheniae and Martin 1969; Oquist 1971; Oquist 1974; Salomon and Keren 2011). Although Fe and Mn are abundant in the earth’s crust, their bioavailability is limited by their chemistry. In oxygenated, aqueous environments Fe is found mostly in its oxidized (Fe3+), non soluble form (Brand et al. 1983; Morel 2008; Kranzler et al. 2013). Manganese is found mostly in its soluble Mn2+ state (Salomon et al. 2011). Nevertheless, Mn2+ can be oxidized to the non-soluble Mn3+ state by biological or geochemical activities

(Rona 2003; Pittman 2005).

2 This article is protected by copyright. All rights reserved.

Accepted Article

Mn levels in oceans and lakes are in the 0.1 to 10 nM range (Klinkhammer and Bender 1980; Landing and Bruland 1987; Sunda and Huntsman 1998; Peers and Price 2004; Middag et al. 2011). Although not considered as a major limiting species, several studies demonstrated that low Mn induced growth inhibition in phytoplankton (Brand et al. 1983; Peers and Price 2004). Overall, the extent of the transcriptional response to Mn limitation is very limited, as compared to other stress conditions (Yamaguchi et al. 2002, Sharon et al. 2014). Nevertheless, a recent physiological study conducted on the cyanobacterium, Synechocystis sp. strain PCC 6803 (henceforth Synechocystis 6803) , demonstrated that changes in Mn concentration, in

the environmentally relevant range, induce a number of photosynthetic responses (Salomon and Keren 2011). At Mn concentrations lower than 10 nM growth rates slow down, the level of phycobilisome antenna proteins is increased, and photosynthetic activity decreases considerably. Additionally, there are evidence for the accumulation of partially assembled photosystem II (PSII) complexes, the degradation of photosystem I (PSI) proteins and monomerization of PSI trimers (Salomon and Keren 2011). Nevertheless, this does not imply that Mn limitation is detrimental to cyanobacteria in natural environments; it merely enforces slow growth rates and modulates the structure and function of the photosynthetic apparatus. In fact, it was demonstrated that Synechocystis 6803 cells, acclimated to low and environmentally relevant Mn concentrations, are better protected against the consequences of nitrogen limitation (Salomon et al. 2013). In aquatic environments iron is a significant limiting factor (Morel and Price 2003; Morel 2008) with concentrations of bioavailable Fe in the sub-nanomolar (Heyden et al. 2012). The effects of Fe limitation on the growth and physiology of eukaryotic and prokaryotic phytoplankton, as well as the consequences for global primary productivity has been the subject of numerous studies (Martin et al. 1990; Katoh et al. 2000; Duhring et al. 2006; Ivanov et al. 2006; Fraser et al. 2013). The transcriptional and physiological response to iron limitation was studied extensively in Synechocystis 6803. These organisms are able to change their gene expression profile within hours following transfer to iron limited conditions (Hernandez-Prieto et al. 2012). Transcriptional changes include the induction of high affinity Fe transport systems, down regulation of photosynthesis, of metabolism and an increase in oxidative damage responses. The ensuing physiological response 3 This article is protected by copyright. All rights reserved.

Accepted Article

includes phycobilisome degradation and a decrease in PSI activity and content (Sandstrom et al. 2002; Ivanov et al. 2006; Fraser et al. 2013). In the later stages of iron limitation perturbations of thylakoid membrane architecture are visible (Sherman and Sherman 1983). One of the most pronounce changes in transcript abundance, and among the first to be observed, is the transcriptional activation of the Iron Stress

Induced operon, isiAB (Burnap et al. 1993; Bibby et al. 2001; Boekema et al. 2001; Sandstrom et al. 2002; Duhring et al. 2006; Hernandez-Prieto et al. 2012; Fraser et al. 2013). This polycystron encodes a chlorophyll binding membranal protein, isiA, and a flavodoxin isiB. Under Fe limitation IsiB can replace ferredoxin (Kutzki et al. 1998). The role of IsiA in the cellular response for Fe limitation is under debate (see (Singh and Sherman 2007 for a detailed review). Several studies have shown that IsiA subunits form rings around photosystem I trimers (Bibby et al. 2001; Boekema et al. 2001). Further examination revealed that IsiA can bind to PSI monomers as well (Yeremenko et al. 2004; Aspinwall et al. 2004; Kouril et al. 2005). These structures led to the suggestion that IsiA acts as a PSI antenna when iron is limiting, perhaps compensating for the lower PSI electron transfer rates (Melkozernov et al. 2003; Ryan-Keogh et al. 2012). An additional hypothesis is that IsiA is a chlorophyll shuttle, binding chlorophyll released from degrading PSI complexes (Burnap et al. 1993; Riethman and Sherman 1988) serving as storage for these metabolically

expensive molecules. Finally, IsiA was proposed to act as an energy quencher (Park et al. 1999; Sandstrom et al. 2002; Wilson et al. 2007; Berera et al. 2009). The latter

functions were suggested to protect the cells from possible reactive oxygen species (ROS) generated by free chlorophyll or through impaired electron transfer reactions (Keren and Krieger-Liszkay 2012). Here we present a study that probes the iron limitation response under environmentally relevant Mn concentrations, to examine the effects on the form and function of the photosynthetic apparatus in general and on isiA in particular.

Results

Synechocystis 6803 cells were acclimated to low and environmentally relevant manganese concentrations by growing for two weeks in YBG11 with no added Mn (measured [Mn] in the medium, 2.0-0.1 nM). Due to a large internal storage, Mn 4 This article is protected by copyright. All rights reserved.

Accepted Article

limitations requires this long period of time to develop (Keren et al. 2002; Salomon and Keren, 2011). After two weeks Mn limited (MnL) cultures demonstrated all of the

expected Mn limitation phenotypes (Salomon and Keren 2011, as compared to T0 measurments in figures 1-3 and Supplemtal figure S1). MnL acclimated cultures and control, MnH, cultures were washed and incubated in fresh YBG11 either with or without added iron. The four resulting experimental condition were: Low Mn acclimated iron starved (MnL/Fe-) or iron replete (MnL/Fe+), Mn sufficient iron starved (MnH/Fe-) and Mn and Fe replete (control, MnH/Fe+). After 44 hours of growth in the new media the negative effects of iron limitation on growth were noticeable in MnH/Fe- cultures (Fig. 1). MnL cultures exhibited inherently lower growth, as compared to MnH (Salomon and Keren 2011), and continued to grow slowly throughout the experiment. In MnL cells subjected to iron limitation, no additional effect on growth was observed (Fig.1) and the cultures continued growing at the same rate as MnL/Fe+ cultures.

The photosynthetic activity of PSII and PSI was measured by monitoring changes in P700 absorption during actinic illumination (Salomon et al. 2013). The PSI activity of MnH/Fe+ cultures exhibited a 25% increase (With an increase of ~25% in chlorophyll per cell values over the eight day period of the experiment, Supplemental fig. S2). In MnH/Fe- cultures PSI activity decreased persistently, reaching its minimum after eight days of growth (Fig 2A). MnL acclimated cells have low PSI activity, as reported previously, and iron limitation did not result in a further decrease of this activity, throughout the experiment (Fig 2A). PSII activity, measured as the contribution of PSII to the reduction of PSI (Salomon et al. 2013) remained correlated with PSI activity under all four conditions (Fig. 2B). The pigment composition was measured by visible absorption spectra (Fig. 3). Typical effects of iron limitation include a loss of phycobilisomes (observed at the phycocyanin [PC] peak at 620 nm) and a blue-shift of the chlorophyll S1 peak, due to IsiA induction (Fraser et al. 2013). PC degradation was visible 96 hours after iron limitation in MnH/Fe- cultures. Surprisingly, in MnL/Fe- samples changes in PC content were not observed (Fig. 3A-C). Similarly, a blue shift in the chlorophyll S1 peak was detected in MnH/Fe- but not in the MnL/Fe- cultures (Fig. 3D). The fact


Accepted Article

that the chlorophyll peak did not blue-shift in MnL/Fe- indicated that in MnL cells IsiA was not induced. The transcription of Fe or Mn limitation induced mRNAs was studied in MnH and MnL cultures one day after transfer to iron limitation. Transcriptional responses are faster than physiological responses and at this stage most of the specific responsive transcripts are induced to the maximum (Hernandez-Prieto et al. 2012). Transcription levels of three genes were measured: futA2, an iron limitation induced iron transporter component (Katoh et al. 2001; Hernandez-Prieto et al. 2012); mntC a Mn limitation

induced Mn transporter component (Bartsevich and Pakrasi 1996a) and isiA (Hernandez-Prieto et al. 2012; Fraser et al. 2013). In order to define the connection between the transcriptional responses and the metal status of the cells, samples from the same cultures were collected and their intracellular Mn and Fe quota was determined (Table 2). Cellular Mn quotas of MnL cells were an order of magnitude lower than those of MnH cultures. Additional changes in Mn quota were not detected after one day of Fe limitation (Table 1). Transcript levels of mntC were higher in the MnL as compared to the MnH cells and did not change with the subsequent iron limitation (Fig. 4). The overall fold-change in mntC transcripts, in response to Mn limitation is consistent

with previous findings (Bartsevich and Pakrasi 1996b). At the start of the experiment the intracellular Fe quota of both MnL and MnH cultures were similar (Table 2). After one day, due to growth dependent bio-dilution, the iron quota of MnH cells was decreased to 63.9 ± 6.6% (n=3) of its initial value while iron content of MnL cells decreased to 89.1 ±10.2% (n=3). It is important to note that both of these values are well within the replete range. Iron limited cultures exhibit cellular quotas that are one to two orders of magnitude lower (Shcolnick et al. 2009). Nevertheless, iron limitation response was observed in both cases. Following transfer to iron limitation the transcription of futA2 was increased ~25 fold in MnH conditions and ~10 fold in MnL cultures (Fig. 4). This implies that transcriptional response to iron limitation is very sensitive, and is active in both MnL and MnH treatments. The induction of isiA transcripts displayed a very different response. At the start of

the experiment, isiA mRNA was not detectable in all four treatments. After one day of 6 This article is protected by copyright. All rights reserved.

Accepted Article

iron limitation, the levels of the isiA transcript sharply increased in MnH cells but not

in MnL cells. The difference in the transcriptional response of futA2 and isiA, at the very least, implies that the control over their transcription is distinctly different. isiA transcripts are induced within the first day of exposure to Fe limitation but the protein accumulates much more slowly (Figure 3). Blue Native polyacrylamide gel electrophoresis (BN-PAGE), conducted at the 12 day time point showed a typical IsiA-PSI complex in the MnH/Fe- cultures, and to a much lesser extent, even in MnH/Fe+ cultures (Fig. 5). The IsiA-PSI complex was not observed in MnL cultures, even when iron was limiting. Under MnL conditions, PSI is found almost exclusively in the monomeric form which can, nevertheless, form complexes with IsiA (Aspinwall et al. 2004). However, mass spectroscopy analysis did not detect IsiA in the PSI monomer band or in any other green band in the MnL lanes.

Discussion In this work we examined the response of low Mn acclimated cells to subsequent iron starvation. This condition is not merely a laboratory aberration. Mn concentrations in the sub-nM to nM range are common in natural aquatic habitats, as environmental data suggests (Martin et al. 1990; Browning et al. 2014). These concentrations are low enough to impose changes on the activity and the organization of the photosynthetic apparatus of cyanobacteria (Salomon and Keren 2011). The physiology of cyanobacteria under Mn and Fe co-limitation is thus of wide environmental importance. MnL Synechocystis 6803 exhibited a very limited response to iron limitation. Changes in biomass accumulation (Fig. 1), photosynthetic activity (Fig. 2), pigment composition (Fig. 3) and in the organization of the photosynthetic complex (Fig. 5) were not observed. It is possible that due to their slower growth rate MnL cells are not iron limited and therefore iron limitation response is not induced. However, our findings suggest differently. Both MnL and MnH cells exhibited a small decrease in Fe content (Table 2) and the transcription of a high affinity iron transporter futA2 was 7 This article is protected by copyright. All rights reserved.

Accepted Article

induced in both to comparable extent (Fig. 4). This indicates that Mn limited cells were able to detect changes in iron concentrations in the environment and respond accordingly. We recently reported that iron sensing in Synechocystis 6803 might be mediated by an ABC type transporter (Kranzler et al. 2014). This mode of sensing can be sensitive to the flux rather than to internal or external concentrations and allow the response to initiate before intracellular iron drops to low levels. IsiA induction is considered a hallmark of iron limitation in cyanobacteria

(Laudenbach and Straus 1988; Burnap et al. 1993; Singh et al. 2003; Fraser et al. 2013). It has been reported to accumulate following non-iron related stress such as increased salinity (Vinnemeier et al. 1998), hydrogen peroxide stress (Li et al. 2004; Singh et al. 2005) and transition into stationary phase (Singh and Sherman 2006). However, as compared to iron limitation, the level of expression under these conditions is limited. Furthermore, the presence of isiA did not increase the resistance to externally applied hydrogen peroxide treatment (Shcolnick et al. 2009). Under Feconditions isiA is one of the fastest and strongest responding transcripts to Fe- and its

function is considered a major factor in the iron limitation response (Ryan-Keogh et al. 2012; Fraser et al. 2013).

The results presented here, to the best of our knowledge, identify for the first time a scenario in which IsiA transcription is not induced under iron limitation (Figs. 3 & 4)

and does not form IsiA-PSI super complexes (Fig. 5). The data demonstrates that Fe limitation, while being required for IsiA transcription, is not sufficient. In standard iron limitation protocols cells are grown in full media and then transferred, usually following a number of washing steps, into exactly the same media apart from the missing iron. Under these conditions the processes that are the first to be affected are those that demand large iron quotas for their function: nitrogen assimilation, respiration and photosynthesis. Within the photosynthetic electron transport chain, PSI and Cytochrome b6f attract the largest demands (Shcolnick and Keren 2006). While iron limitation is known to have severe effects on PSI function (Sandstrom et al. 2002; Ivanov et al. 2006; Hernandez-Prieto et al. 2012; Fraser et al. 2013), PSII (with only 3 Fe atoms) can remain photochemically active and transfer electrons into the now impaired photosynthetic and respiratory electron transfer chains (Berry et al. 2002). This causes the over-reduction of the photosynthetic 8 This article is protected by copyright. All rights reserved.

Accepted Article

apparatus and may lead to production of harmful reactive oxygen species (Keren and Krieger-Liszkay 2012). Interestingly, it was reported that externally applied hydrogen peroxide was able to interfere with the binding of the translational repressor Fur to the isiA promoter (Li et al. 2004). This reaction might constitute a mechanism by which over-reduction of the photosynthetic electron transport chain can contribute towards isiA translation.

If this is the case, the role of IsiA is most likely in protecting against oxidative damages rather than in enhancing energy trapping in PSI. Lower PSII activity, due to limiting Mn, restricts electron transport and minimizes downstream oxidative damages. Under these co-limiting conditions, a decrease in cellular Fe quota will not lead to oxidative stress, rendering the IsiA protective function unnecessary. It is interesting to compare the effects of Fe and Mn homeostasis on performance of other organisms. In the fresh water green algae, Chlamydomonas reinhardtii, a decrease in Mn level lead to lower cellular Fe quotas (Allen et al. 2007). This effect was not observed in the marine diatom Thalassiosira pseudonana, yet Fe limited cells

required slightly more Mn to grow (Peers and Price 2004). Plants would rarely encounter Mn limitation in the soil and the most studied situation is Mn excess. In Arabidopsis thaliana plants it was suggested that excess of Mn can be transported into the plant body by nonspecific iron foraging (Thomine and Vert 2013). Nevertheless, Arabidopsis thaliana plants provided with excess Mn can keep the required functional Mn quota in the chloroplasts by allocating its excess to the vacuole through the NRAMP3/NRAMP4 transport system, or to the mitochondria for use in MnSOD (Lanquar et al. 2010). Finally, we would like to to note that the effect of environmentally relevant levels of Mn on nutrient limitation responses is not exclusive to iron. Similar responses were observed

under

MnL/nitrogen-

co-limitation.

MnL

cells

retained

larger

phycobilisomes antenna and higher photosynthetic functionality under nitrogen limitation (Salomon et al. 2013). These co-limitation effects should be taken into account when converting from controlled laboratory conditions to environmental studies.


Accepted Article

Experimental Procedures Growth conditions Synechocystis 6803 was grown in modified BG11 medium, YBG11 (Shcolnick et al. 2007) in glass Erlenmeyer flasks. Glassware were incubated overnight in 3.7% HCl and then washed with double distilled water. Stock solutions were prepared using double distilled water and analytical grade chemicals. Synechocystis 6803 was grown in YBG11 containing 1 μM ‎Mn (MnH) or with no added Mn (MnL). The residual Mn concentration in MnL, as confirmed by ICP-MS, was 0.1-2.0 nM. Cultures were

grown in MnL and MnH until Mn limitation phenotypes were observed, as described previously (Salomon and Keren 2011). Following which, the cultures were spun down and washed twice with a pH 5.0 buffer containing 20 mM of 2-(N-morpholino) ethanesulfonic acid ‎ (MES) and 10 mM ethylenediaminetetraacetic acid (EDTA; a

broad specificity chelator)‎, in order to remove excess metal ions from the cell surface and periplasmic space (Vaara 1992). Cultures were resuspended in one of four media

types:

1) MnH/Fe+; 6 μM Fe, 1 μM ‎Mn and 16 μM EDTA. 2) MnL/Fe+; 6 μM Fe and 16 μM EDTA.

3) MnH/Fe-; 1 μM ‎Mn, 16 μM EDTA and 50 μM of the siderophore deferoxamine B (DFB; highly specific Fe[III] chelator)‎. DFB reduces the bioavailability of Fe contamination in the Fe- considerably (Shcolnick et al. 2009) .

4) MnL/Fe-; 16 μM EDTA and 50 μM DFB.

Residual Fe concentrations in Fe- media were 0.07-0.13 M. The addition of DFB reduced the bioavailability of this contamination to a minimum. Cultures were maintained under constant shaking, illuminated with 60 μmol photons m-2 s-1 at 30°C.

Spectroscopy Cell growth was monitored by hemocytometer cell counts. Visible absorption spectra were measured using a Cary300 spectrophotometer (Varian, CA, USA). Cellular metal quota was determined using an inductively coupled plasma mass spectrometer (ICP-MS; Perkin-Elmer- Elan, MA, USA), all preparations for ICP-MS were conducted in a clean room as described previously (Shcolnick and Keren). PSI activity was measured as P700 photo-oxidation using the Joliot-type spectrophotometer (Salomon et al. 2013). In order to block electron flow to PSI, 10 μM DCMU and 10 10 This article is protected by copyright. All rights reserved.

Accepted Article

μM 2,5-dibromo-3-methyl-6-isopropylbenzoquinone (DBMIB) were added. 77K chlorophyll fluorescence spectra were measured by Flouromax3 spectrofluorometer (Jobin Ivon, Longjumaeu, France). Excitation wavelength was set at 430 nm. Excitation and emission slit width was set to 5 nm with an integration time of 0.25 s.

Three independent cultures were measured with two technical repeats.

RNA isolation and analysis

Cultures used for quantitative RT-PCR analysis were centrifuged at 9,000 g at 4°C, resuspended in a trizol extraction buffer and spun down. The aqueous phase was collected and RNA was precipitated with isopropanol, cleaned with 75% ethanol and resuspended in nuclease free water. Samples were brought to the same RNA levels (Measured by Nanodrop ND-100, Thermo Scientific, Wilmington, DE, USA). DNAse treatment (Turbo-DNA-free, Life Technologies, Grand Island, NY, USA) was followed by reverse transcription (GoScript, Promega, Madison, WI, USA) and the resulting cDNA were diluted to a final concentration of 2 ng l-1. A calibration curve was created for all samples, with values of 2, 0.2, 0.02 and 0.002 ng cDNA l-1. Initial cDNA samples were diluted once more to a final concentration of 1 ng l-1. 10 l of template were used for Q-RT-PCR (20 l final volume). Q-RT-PCR was carried out with the Absolute Blue qPCR SYBR Green ROX mix (Thermo Scientific) with a Rotor Gene 6000 (Qiagen, Valencia, CA). Primer sequences for each gene are presented in table 1.

Three independent cultures were measured with a least two technical repeats, and were confirmed to be aligned to a linear calibration curve. Each data set was internally normalized to rnpB levels, an established “housekeeping” gene in Synechocystis 6803 (Pinto et al. 2012).

Protein analysis Blue native PAGE was conducted for the 14 day samples as described before (Salomon and Keren 2011) with 5 g chlorophyll per lane. Protein content of selected bands was determined by LC-MS/MS. Samples were digested by trypsin and analyzed by LC-MS/MS on LTQ-Orbitrap (Thermo, USA). Identification was done by


Accepted Article

Discoverer software version 1.3 against the cyano-bacteria part of the nr database using the "sequest" search engine (Salomon and Keren, 2011).

Acknowledgements We would like to thank Chana Kranzler and Hagit Zer for their assistance. This work was supported by an Israeli Science Foundation grants (806/11) awarded to NK. The authors declare that no conflict of interest is attached to this work.

References Allen, M.D., Kropat, J., Tottey, S., Del Campo, J.A., and Merchant, S.S. (2007) Manganese deficiency in Chlamydomonas results in loss of photosystem II and MnSOD function, sensitivity to peroxides, and secondary phosphorus and iron deficiency. Plant Physiol 142: 263-277. Aspinwall, C.L., Duncan, J., Bibby, T., Mullineaux, C.W., and Barber J (2004) The trimeric organisation of photosystem I is not necessary for the iron-stress induced CP43' protein to functionally associate with this reaction centre. FEBS Letters 574: 126–130. Bartsevich, V.V., and Pakrasi, H.B. (1996a) Manganese transport in the cyanobacterium Synechocystis sp. PCC 6803. J Biol Chem 271: 26057–26061. Bartsevich, V.V., and Pakrasi, H.B. (1996b) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803. J Biol Chem 271:26057–26061. Berera, R., Stokkum, I.H.M., van de Haene, S., Kennis, J.T.M., van Grondelle, R., and Dekker, J.P. (2009) A mechanism of energy dissipation in cyanobacteria. Biophys J 96: 2261–2267. Berry, S., Schneider, D., Vermaas, W.F.J., and Rogner, M. (2002) Electron transport routes in whole cells of Synechocystis sp. strain PCC 6803: The role of the cytochromebd-type oxidase. Biochemistry 41: 3422–3429. Bibby, T.S., Nield, J., and Barber, J. (2001) Iron deficiency induces the formation of an antenna ring around trimeric photosystem I in cyanobacteria. Nature 412: 743–745. Boekema, E.J., Hifney, A., Yakushevska, A.E., Piotrowski, M., Keegstra, W., Berry, S., Michel, K.P., Pistorius, E.K., and Kruip, J. (2001) A giant chlorophyllprotein complex induced by iron defciency in cyanobacteria. Nature 412: 745–748. 12 This article is protected by copyright. All rights reserved.

Accepted Article

Brand, L.E., Sunda, W.G., and Guillard, R.R.L. (1983) Limitation of marine phytoplankton reproductive rates by zinc, manganese, and iron. Limnol Oceanogr 28: 1182–1198.

Browning,. T.J., Bouman, H.A., Henderson, G.M., Mather, T.A., Pyle, D.M., Schlosser, C., Woodward, E.M.S., and Moore, C.M. (2014) Strong responses of Southern Ocean phytoplankton communities to volcanic ash. Geophys Res Let 2014GL059364– Burnap, R.L., Troyan, T., and Sherman, L.A. (1993) The highly abundant chlorophyll-protein complex of iron-deficient Synechococcus Sp. PCC 7942 (Cp43) is encoded by the isiA gene. Plant Physiol 103: 893–902.

Cheniae, G.M., and Martin, I.F. (1969) Photoreactivation of manganese catalyst in photosynthetic oxygen evolution. Plant Physiol 44: 351–360. Duhring, U., Axmann, I.M., Hess, W.R., and Wilde, A. (2006) An internal antisense RNA regulates expression of the photosynthesis gene isiA. PNAS 103: 7054– 7058. Fraser, J.M., Tulk, S.E., Jeans, J.A., Campbell, D.A., Bibby, T.S., and Cockshutt, A.M. (2013) Photophysiological and photosynthetic complex changes during iron starvation in Synechocystis sp. PCC 6803 and Synechococcus elongatus PCC 7942. PLoS One 8: e59861. Hansch, R., and Mendel, R.R. (2009) Physiological functions of mineral micronutrients (Cu, Zn, Mn, Fe, Ni, Mo, B, Cl). Curr Opin Plant Biol 12: 259–266.

Hernandez-Prieto, M.A., Schon, V., Georg, J., Barreira, L., Varela, J., Hess, W.R., and Futschik, M.E. (2012) Iron deprivation in Synechocystis: Inference of pathways, non-coding RNAs, and regulatory elements from comprehensive expression profiling. G3-Genes Genomes Genetics 2: 1475–1495. Homann, P.H. (1967) Studies On Manganese of Chloroplast. Plant Physiol 42: 997– 1007.

Ivanov, A.G., Krol, M., Sveshnikov, D., Selstam, E., Sandstrom, S., Koochek, M., Park, Y.I, Vasil’ev, S., Bruce, D., Oquist, G., and Huner, N.P.A. (2006) Iron deficiency in cyanobacteria causes monomerization of photosystem I trimers and reduces the capacity for state transitions and the effective absorption cross section of photosystem I in vivo. Plant Physiol 141: 1436–1445. Katoh, H., Grossman, A.R., Hagino, N., and Ogawa, T. (2000) A gene of Synechocystis sp. strain PCC 6803 encoding a novel iron transporter. J Bacteriol 182: 6523–6524.

Katoh, H., Hagino, N., Grossman, A.R., and Ogawa, T. (2001) Genes essential to iron transport in the cyanobacterium Synechocystis sp. strain PCC 6803. J Bacteriol 183: 2779–2784.


Accepted Article

Keren, N., Kid, M.J., Penner-Hahn, J.E., and Pakrasi, H.M. (2002) A light-dependent mechanism for massive accumulation of manganese in the photosynthetic bacterium Synechocystis sp. PCC 6803. Biochemistry 41: 15085–15092. Keren, N., and Krieger-Liszkay, A. (2012) Photoinhibition: molecular mechanisms and physiological significance. Physiologia Plantarum 142: 1–5. Klinkhammer, G.P., and Bender, M.L. (1980) The distribution of manganese in the Pacific Ocean. Earth Planetary Sci Let 46: 361–384. Kouril, R., Yeremenko, N., D’Haene, S., Oostergetel, G.T., Matthijs, H.C.P., Dekker, J.P., and Boekema, E.J. (2005) Supercomplexes of IsiA and photosystem I in a mutant lacking subunit PsaL. BBA-Bioenergetics 1706: 262–266. Kranzler, C., Lis, H., Shaked, Y., and Keren, N. (2011) The role of reduction in iron uptake processes in a unicellular, planktonic cyanobacterium. Environ Microbiol 13: 2990–2999.

Kranzler, C., Rudolf, M., Keren, N., and Schleiff, E. (2013) Iron in cyanobacteria. Genomics of Cyanobacteria 65: 57–105. Kutzki, C., Masepohl, B., and Bohme, H. (1998) The isiB gene encoding flavodoxin is not essential for photoautotrophic iron limited growth of the cyanobacterium Synechocystis sp. strain PCC 6803. FEMS Microbiol Let 160: 231–235. Landing, W.M., and Bruland, K.W. (1987) The contrasting biogeochemistry of iron and manganese in the Pacific Ocean. Geochim Cosmochim Acta 51: 29–43. Lanquar, V., Ramos, S.R., Lelievre, F., Barbier-Brygoo, H., Krieger-Liszkay, A., Kramer, U., and Thomine, S. (2010) Export of manganese by AtNRAMP3 and AtNRAMP4 is required for optimal photosynthesis and growth under manganese deficiency. Plant Physiol 152: 1986-1999. Laudenbach, D.E., and Straus, N.A. (1988) Characterization of a cyanobacterial iron stress-induced gene similar to psbC. J Bacteriol 170: 5018–5026. Li, H., Singh, A.K., McIntyre, L.M., and Sherman, L.A. (2004) Differential gene expression in response to hydrogen peroxide and the putative PerR regulon of Synechocystis sp. strain PCC 6803. J Bacteriol 186: 3331–3345.

Martin, J.H., Gordon, R.M., and Fitzwater, S.E. (1990) Iron in Antarctic waters. Nature 345: 156–158. Melkozernov, A.N., Bibby, T.S., Lin, S., Barber, J., and Blankenship, R.E. (2003) Time-resolved absorption and emission show that the CP43 ’ antenna ring of iron-stressed Synechocystis sp. PCC 6803 is efficiently coupled to the photosystem I reaction center core. Biochemistry 42: 3893–3903. Middag, R., deBaar, H.J.W., Laan, P., Cai, P.H., and van Ooijen, J.C. (2011) Dissolved manganese in the Atlantic sector of the Southern Ocean. Deep Sea Research Part II: Topical Studies in Oceanography 58: 2661–2677.


Accepted Article

Morel, F.M.M. (2008) The co-evolution of phytoplankton and trace element cycles in the oceans. Geobiology 6: 318–324. Morel, F.M.M., and Price, N.M. (2003) The biogeochemical cycles of trace metals in the oceans. Science 300: 944–947.

Oquist, G. (1974) Iron-deficiency in blue-green-alga Anacystis nidulans - Changes in pigmentation and photosynthesis. Physiologia Plantarum 30: 30–37. Oquist, G. (1971) Changes in pigment composition and photosynthesis induced by iron-deficiency in blue-green-alga Anacystis nidulans. Physiologia Plantarum 25: 188–191.

Park, Y.I, Sandström. S., Gustafsson, P., dna Oquist, G. (1999) Expression of the isiA gene is essential for the survival of the cyanobacterium Synechococcus sp. PCC 7942 by protecting photosystem II from excess light under iron limitation. Mol Microbiol 32: 123–129.

Peers, G., and Price, N.M. (2004) A role for managanese in superoxide dismutases and growth of iron-deficient diatoms. Limnol Oceanogr 49: 1774–1783. Pinto, F., Pacheco, C.C., Ferreira, D., Moradas-Ferreira, P., and Tamagnini, P. (2012) Selection of duitable reference genes for RT-qPCR analyses in cyanobacteria. PLoS ONE 7: e34983.

Pittman, J.K. (2005) Managing the manganese: molecular mechanisms of manganese transport and homeostasis. New Phytol 167: 733–742. Riethman, H.C., and Sherman, L.A. (1988) Immunological characterization of ironregulated membrane proteins in the cyanobacterium Anacystis nidulans R2. Plant Physiol 88: 497–505. Rona, P.A. (2003) Resources of the sea floor. Science 299: 673–674. Ryan-Keogh, T.J., Macey, A.I., Cockshutt, A.M., Moore, C.M., and Bibby, T.S. (2012) The cyanobacteria chlorophyll binding protein IsiA acts to increase the in vivo effective absorption cross section of PSI under iron limitation. J Phycol 48: 145–154.

Salomon, E., Bar-Eyal, L., Sharon, S., and Keren, N. (2013) Balancing photosynthetic electron flow is critical for cyanobacterial acclimation to nitrogen limitation. BBA - Bioenergetics 1827: 340–347.

Salomon, E., and Keren, N. (2011) Manganese limitation induces changes in the activity and in the organization of photosynthetic complexes in the cyanobacterium Synechocystis sp. strain PCC 6803. Plant Physiol 155: 571– 579. Salomon, E., Renger, G., and Keren, N. (2011) Mn transport and the assembly of photosystem II. In Bioenergetic processes of cyanobacteria: From evolutionary sngularity to ecological Diversity. Pescheck, G.A. and Renger, G. (eds). Springer Science, 423–442. 15 This article is protected by copyright. All rights reserved.

Accepted Article

Sandstrom, S., Ivanov, A.G., Park, Y.I., Oquist, G., and Gustafsson, P. (2002) Iron stress responses in the cyanobacterium Synechococcus sp. PCC 7942. Physiologia Plantarum 116: 255–263. Sharon, S., Salomon, E., Kranzler, C., Lis, H., Lehmann R., Georg, J., Zer, H., Hess, W.R., and Keren, N. (2014) The hierarchy of transition metal homeostasis: Iron controls manganese accumulation in a unicellular cyanobacterium. BBA Bioenergetics 1837: 1990–1997.

Shcolnick, S., and Keren, N. (2006) Metal homeostasis in cyanobacteria and chloroplasts. Balancing benefits and risks to the photosynthetic apparatus. Plant Physiol 141: 805–810. Shcolnick, S., Shaked, Y., and Keren, N. (2007) A role for MrgA, a DPS family protein, in the internal transport of Fe in the cyanobacterium Synechocystis sp. PCC 6803. BBA 1767: 814–819. Shcolnick, S., Summerfield, T.C., Reytman, L., Sherman, L.A., and Keren, N. (2009) The mechanism of iron homeostasis in the unicellular cyanobacterium Synechocystis sp PCC 6803 and its relationship to oxidativestress. Plant Physiol 150: 2045–2056.

Sherman, D.M., and Sherman, L.A. (1983) Effect of iron-deficiency and iron restoration on ultrastructure of Anacystis nidulans. J Bacteriol 156: 393–401. Frausto da Silva, J.J.R., and Williams, R.J.P. (2001) The biological chemistry of the elements. Oxford University Press, Oxford Singh, A.K., Li, H., Bono, L., and Sherman, L.A. (2005) Novel adaptive responses revealed by transcription profiling of a Synechocystis sp. PCC 6803 Delta isiA mutant in the presence and absence of hydrogen peroxide. Photosynt Res 84: 65–70. Singh, A.K., McIntyre, L.M., and Sherman, L.A. (2003) Microarray analysis of the genome-wide response to iron deficiency and iron reconstitution in the cyanobacterium Synechocystis sp. PCC 6803. Plant Physiol 132: 1825–1839. Singh, A.K., and Sherman, L.A. (2006) Iron-independent dynamics of IsiA production during the transition to stationary phase in the cyanobacterium Synechocystis sp. PCC 6803. FEMS Microbiol Let 256: 159–164.

Singh, A.K., and Sherman, L.A. (2007) Reflections on the function of IsiA, a cyanobacterial stress-inducible, Chl-binding protein. Photosynt Res 93: 17-25. Sunda, W.G., and Huntsman, S.A. (1998) Interactive effects of external manganese, the toxic metals copper and zinc, and light in controlling cellular manganese and growth in a coastal diatom. Limnol Oceanogr 43: 1467–1475. Thomine, S., and Vert, G. (2013) Iron transport in plants: better be safe than sorry. Curr Opin Plant Biol 16 322-327. 16 This article is protected by copyright. All rights reserved.

Accepted Article

Vaara, M. (1992) Agents that increase the permeability of the outer membrane. Microbiol Rev 56: 395–411.

Vinnemeier, J., Kunert, A., and Hagemann, M. (1998) Transcriptional analysis of the isiAB operon in salt-stressed cells of the cyanobacterium Synechocystis sp. PCC 6803. FEMS Microbiol Let 169: 323–330. von der Heyden, B.P., Roychoudhury, A.N., Mtshali ,T.N., Tyliszczak, T., and Myneni, S.C.B (2012) Chemically and geographically distinct solid-phase iron pools in the southern ocean. Science 338: 1199–1201. Wilson, A., Boulay, C., Wilde, A., Kerfeld, C.A., and Kirilovsky, D. (2007) Light induced energy dissipation in iron starved cyanobacteria: Roles of OCP and IsiA proteins. The Plant Cell Online 19: 656–672. Yamaguchi, K., Suzuki, L., Yamamoto, H., Lyukevich, A., Bodrova, I,.Los, D.A., Piven, I., Zinchenko, V., Kanehisa, M., and Murata, N. (2002) A twocomponent Mn2+-sensing system negatively regulates expression of the mntCAB operon in synechocystis. Plant Cell 14: 2901–2913.

Yeremenko,N., Kouril, R., Ihalainen, J.A., D’Haene, S., van Oosterwijk, N., Andrizhiyevskaya, E.G., Keegstra, W., Dekker, H.L., Hagemann, M., Boekema, E.J., Matthijs, H.C.P. and Dekker, J.P. (2004) Supramolecular organization and dual function of the IsiA chlorophyll-binding protein in cyanobacteria. Biochemistry 43: 10308–10313.

Tables:


Accepted Article Time:

MnH/Fe-

MnL/Fe-

Mn quota (atoms cell-1)

Fe quota (atoms cell-1)

0

22

22/0 (%)

0

22

5.18X106 ±

5.65X106 ±

109.1 ±

1.62X108 ±

1.04X108 ±

5.80X105

1.37X105

12.5

1.45X107

5.30X105

6.87X105 ±

7.45X105 ±

108.4 ±

1.46X108 ±

1.3X108 ±

4.43X10

4

2.03X10

5

30.4

8.69X10

6

1.28X10

22/0 (%)

7

63.9 ± 6.6 89.0 ± 10.2

Table 1: Manganese and iron quota of Fe limited Synechocystis 6803 cultures. Metal content was determined by ICP-MS and normalized on a per cell basis. Percent change in metal content was calculated as content at 22 hours divided by the value of time 0. Standard errors are presented for n=3.

FP

RP

futA2

ATTCTTCACGGCATTACAAC

TGGATACGCTCAATCAGTTC

isiA

CTGATCAGTCTGGGCTTTTT

AAATCGGGAAATTTCAAACA

mntC

GGGAAACAGAGGAGAAAAAG

TGGATTCCACCACTAACTTG

rnpB

GGAGTTGCGGATTCCTGTCA

CGTTACCCAGCAAGTTTGGC

Table 2: List of primer sequences for q-RT-PCR


Accepted Article

Figures Figure 1: Growth curves of Synechocystis 6803 cultures. Mn limitation acclimated cells (MnL) and not limited (MnH) Synechocystis 6803 cells were washed twice and

brought to the same cell density. Cells were grown for 12 days in YBG11 media, either with or without an iron source (Fe+ and Fe-, respectively). Cell density was measured manually with a hemocytometer. Error bars represent standard error with n=3.

Figure 2: Photochemical activity of Synechocystis 6803 cultures. Photochemical activity of PSI and PSII was measured periodically throughout the experiment and was calculated from time resolved absorption measurements of P700 during actinic illumination (Salomon et al., 2013). Additional details on the method are included in Supplemental fig. S1. Chlorophyll per cell values are provided Supplemental fig. S2

A) Maximal PSI photochemical activity of all treatments, as calculated from the maximal absorbance changes at 705 nm. B) PSII activity as calculated from the contribution of electrons originating in PSII to the reduction of PSI, in the light. Error bars represent standard deviation (n=3).

Figure 3: Absorption spectra of Synechocystis 6803 cultures. Transition into iron limited state was monitored by absorption spectra at time 0 (A), 48 h (B) and 96 h (C). Spectra were normalized to OD800 to help evaluate their structure. D) 1st order derivatives of the 96 h data.

Figure 4: Transcriptional changes of Synechocystis 6803 cultures during the

transition to iron limitation. RNA was extracted from MnL and MnH cultures, immediately after the iron depletion step (Time 0) and 22 hours later (Time 22). The relative transcription of futA2, isiA and mntC was measured by Q- RT-PCR. Transcript levels were normalized to rnpB expression. Error bars represent standard

deviation (n=3). Samples from these cultures were also used for metal content determination (Table 2).


Accepted Article

Figure 5: Blue Native PAGE analysis of Synechocystis 6803 following iron limitation. Proteins extracted from the different cultures after 12 days of growth were separated by a linear 4.5-12.5% BN-PAGE, on an equal chlorophyll basis (5 μg chlorophyll/lane). Marked protein complexes are PSI-IsiA super-complexes, PSI trimers (III), dimers (II) and monomers (PSI). As a result of low detergent levels, PSII is seen only in its monomeric form. The annotation for the main photosynthetic complexes was verified with LC-MS/MS performed on bands excised from the gel.

EMI_12826_F1


Accepted Article

EMI_12826_F2


Accepted Article

EMI_12826_F3


Accepted Article

EMI_12826_F4

EMI_12826_F5
