ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Sept. 2010, p. 3956–3959 0066-4804/10/$12.00 doi:10.1128/AAC.00110-10 Copyright © 2010, American Society for Microbiology. All Rights Reserved.
Vol. 54, No. 9
Acquisition of a Transposon Encoding Extended-Spectrum -Lactamase SHV-12 by Pseudomonas aeruginosa Isolates during the Clinical Course of a Burn Patient䌤 Shuji Uemura,1* Shin-ichi Yokota,2 Hirotoshi Mizuno,1 Eiji Sakawaki,1 Keigo Sawamoto,1 Kunihiko Maekawa,1 Katsutoshi Tanno,1 Kazuhisa Mori,1 Yasufumi Asai,1 and Nobuhiro Fujii2 Department of Traumatology and Critical Care Medicine1 and Department of Microbiology,2 Sapporo Medical University School of Medicine, Sapporo 060-8543, Japan Received 25 January 2010/Returned for modification 8 April 2010/Accepted 2 June 2010
Three of seven clonally related Pseudomonas aeruginosa strains isolated from a burn patient produced the extended-spectrum -lactamase (ESBL) SHV-12. Its gene was flanked by two IS26 elements with a large transposon (>24 kb). The transposon also contained at least five IS26 elements and a gene encoding the amikacin resistance determinant aminoglycoside 6ⴕ-N-acetyltransferase type Ib [aac(6ⴕ)-Ib]. It was inserted into the gene PA5317 in the P. aeruginosa chromosome. The TEM- and SHV-type extended-spectrum -lactamases (ESBLs) are widely distributed among the Enterobacteriaceae (14), with the latter being more prevalent in Asia (5). In Japan, SHV-12 enzymes are found most frequently in Klebsiella pneumoniae and Escherichia coli (20, 22). In contrast, there are a few reports describing the isolation of TEM- or SHV-type ESBLs in Pseudomonas aeruginosa (19). In the Enterobacteriaceae, genes encoding SHV-type enzymes usually are located on plasmids (8), whereas they are primarily chromosomally encoded in P. aeruginosa (2, 10, 11, 15). We consider that the difference is one of the reasons that P. aeruginosa strains harboring genes for SHV-type enzymes are very rare. However, there has been only weak evidence for the insertion of these resistance determinants into the P. aeruginosa chromosome. In the present study, we identified the presence of an ESBL in P. aeruginosa isolates from a burn patient undergoing long-term intensive care. We explored the insertion sequences (IS) associated with these genes. Our investigations indicate that the P. aeruginosa isolates have acquired the ESBL gene during the clinical course. Seven P. aeruginosa strains were isolated from a 27-year-old female patient (total burn surface area, 83%). Isolated strains, sites of infection, and antimicrobial treatments are summarized in Fig. 1. All seven isolates were O-serotype E, which corresponds to the international antigenic scheme O11 (6), as determined by a panel of typing antisera (Denka Seiken, Tokyo, Japan). Random amplified polymorphic DNA-PCR (RAPD-PCR), which was performed according to reference 9, showed closely similar patterns among all seven isolates (Fig. 2). These suggested that they derived from the same clone.
MICs were determined basically by the microdilution method according to the proposal of the Clinical and Laboratory Standards Institute (CLSI) (3), except the concentration of clavulanic acid (CLA) was 2 g/ml according to Naas et al. (11). Four of the seven isolates, which were obtained from the burn sites during the earlier stages of the clinical course (on admission or on the 20th clinical day) or from sputum, were susceptible to cephalosporins. However, the other three strains, isolated from the burn sites later in the clinical course (24th clinical day), exhibited a broad spectrum of resistance to expanded-spectrum cephalosporins, and their MICs decreased following the addition of CLA. In addition, these three strains simultaneously harbored resistance to amikacin (Table 1). PCR was performed using HotStaTaq polymerase master mix (Qiagen, Hilden, Germany). PCR analysis for SHV-type ESBLs (17) indicated that blaSHV was present in the three resistant strains, which had the blaSHV-12 nucleotide sequence, but not in the four susceptible strains. PCR analysis for insertion sequence 26 (IS26) (7) showed that the three resistant strains also contained the same IS26 elements, which were detected both upstream and downstream of blaSHV-12, with the sequence between them being identical to part of plasmid pKPN4 (CP000649) (Fig. 3C). The determinations of the IS26 flanking sequences indicating the transposon insertion site were performed with TaKaRa LA PCR in vitro cloning kits (TaKaRa Ltd., Kyoto, Japan) using specific primer sets (Table 2). We identified a partial gene sequence downstream from IS26. The gene detected was PA5317, which encodes a probable binding protein component of an ABC dipeptide transporter in P. aeruginosa PAO1 (AE004091). We performed PCR amplifications with PA5317specific primers (Table 2) spanning the insertion site. These analyses indicated that the insertions in PA5317 were found only in the three strains carrying blaSHV-12 (Fig. 3A and B). Furthermore, the 8-bp duplication of the target site was identified in these resistant strains following amplification with
* Corresponding author. Mailing address: Department of Traumatology and Critical Care Medicine, Sapporo Medical University Hospital, 291, South-1, West-16, Chuo-ku, Sapporo 060-8543, Japan. Phone: 81-11-611-2111, ext. 3711. Fax: 81-11-611-4963. E-mail:
[email protected]. 䌤 Published ahead of print on 21 June 2010. 3956
VOL. 54, 2010
TRANSPOSON EXPRESSING SHV-12 IN P. AERUGINOSA
3957
TABLE 1. Antimicrobial susceptibilities of P. aeruginosa isolates from a burn patient MIC (g/ml) for strain: Antibiotic(s)
FIG. 1. Clinical course of a burn patient and P. aeruginosa isolates. A burn patient (27-year-old female) suffered from a total burn surface area of 83% and transferred to Sapporo Medical University Hospital on the fourth clinical day. All strains except P072204 were isolated from burn sites. P072204 was isolated from sputum. Arrows and bars indicate periods of antibiotic administration. PZFX, pazufloxacin; CZOP, cefozopran; DRPM, doripenem.
primers for PA5317 and the IS26 elements upstream and downstream of the insertion site. The inserted transposon was ⬎24 kb in size and contained at least five IS26 elements (Fig. 3C). The first part of the transposon (4,453 bp) exhibited a sequence identical to that of the plasmid pKPN4 and contained the blaSHV-12 gene. The second and fourth parts (⬎6.5 kb and 3,526 bp, respectively) shared sequences identical to that of Yersinia pestis biovar Orientalis strain IP275 (NZ_AAOS02000011). The third part (⬎1.1 kb) showed a sequence identical to that of Salmonella enterica
FIG. 2. RAPD-PCR analysis of P. aeruginosa isolates. RAPD-PCR analyses were carried out using primer 272 or 208 (9). Lanes 1 to 7 were isolates from the burn patient, and lanes 8 and 9 were serotype E strains isolated from other patients. Lanes: 1, P072201; 2, P072202; 3, P072203; 4, P072204; 5, P072205; 6, P072206; 7, P072207; 8, P070401; and 9, SP9715.
Ticarcillin Ticarcillin ⫹ CLAa Piperacillin Piperacillin ⫹ CLA Cefotaxime Cefotaxime ⫹ CLA Ceftazidime Ceftazidime ⫹ CLA Cefepime Cefepime ⫹ CLA Aztreonam Aztreonam ⫹ CLA Amikacin a
2201
2202
2203
2204
2205
2206
2207
16 16
32 32
32 32
64 64
⬎512 ⬎512
⬎512 ⬎512
⬎512 ⬎512
16 16
32 32
16 16
16 16
256 128
512 256
512 256
16 16
256 256
128 128
64 64
512 64
512 64
512 64
2 2
16 16
8 8
4 4
512 16
512 16
512 16
8 8
8 8
4 4
16 16
256 32
512 64
512 64
4 4
8 8
8 8
16 16
512 32
512 32
512 64
4
4
4
4
128
128
128
CLA, clavulanic acid at a concentration of 2 g/ml.
subsp. enterica serovar Newport strain SL254 plasmid pSN254 (NC_009140). The fifth part (4,367 bp) showed sequence similarity (81% identity) to Marinobacter aquaeolei VT8 (NC_008740), containing an integrase and aminoglycoside 6⬘N-acetyltransferase type Ib [aac(6⬘)-Ib], which provided the aminoglycoside acetyltransferase activity responsible for the amikacin resistance (16). Our report is the first isolation of SHV-12-producing P. aeruginosa strains in Japan, and there is only one report concerning a PER-1-type ESBL-producing P. aeruginosa (21). On the other hand, there are several reports of blaSHV-carrying P. aeruginosa, including the following: SHV-2a in France and Tunisia (1, 4, 10, 11), SHV-5 in Greece (12, 15), SHV-12 in Thailand and Korea (2, 13), and an unidentified SHV in Iran (18). The IS26 insertion sequence is widely distributed among the Enterobacteriaceae plasmids; on the other hand, only two studies have detected blaSHV associated with IS26 in P. aeruginosa (10, 11). However, these studies did not examine the regions around the IS26 elements. The present study is the first reported identification of an IS26 insertion into the P. aeruginosa chromosome. The IS26 composite transposon inserted chromosomally into PA5317 and an 8-bp duplicate sequence (TTC CCGCC) was identified. Furthermore, it is possible that this insertion occurred during the clinical course, since the transposon was detected in only the three isolates taken from the burn area later in the course of treatment. The IS26 composite transposon was very large (⬎24 kb) and, like blaSHV-12, it contained the antibiotic resistance gene aac(6⬘)-Ib, which causes amikacin resistance. The acquisition of the transposon appeared to occur immediately after amikacin administration and was not likely to be associated with ceftazidime (CAZ) treatment (Fig. 1). Amikacin selection pressure was strongly suggested to contribute to the later prevalence of transposonpositive strains. Several studies have suggested that P. aeruginosa represents a hidden reservoir for ESBLs (10, 11). The present study indicates that P. aeruginosa and the Enterobacteriaceae use dif-
3958
UEMURA ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
FIG. 3. Schematic representation of the transposon. (A) Insert position of the transposon in the P. aeruginosa chromosome. The transposon was inserted into the gene PA5317 (an ABC transporter; gray box). The P. aeruginosa genome DNA information follows the sequence of strains identified in strain PAO1 (accession no. AE004091). Dotted lines in the gray box represent the insertion site. The insertion sequence is indicated below, and the underlined nucleotides identify duplicate sequences. (B) Agarose gel electrophoresis shows the PCR products generated using the combination of primers, A-B, A-C, and B-D. The PCRs indicate that PA5317 does not contain an insert in strains P072201 to P072204, whereas the transposon is present in PA5317 in strains P072205 to P072207. Lanes: 1, P072201; 2, P072202; 3, P072203; 4, P072204; 5, P072205; 6, P072206; and 7, P072207. (C) Schematic representation of the transposon. The arrows represent genes and their orientation, including IS26 elements (gray) and antibiotic resistance determinants (black). The black bars denote sequence identity with the following: pKPN4, a plasmid from K. pneumoniae subsp. pneumoniae MGH 78578 (GenBank accession number CP000649); YPIP275, Y. pestis biovar Orientalis strain IP275 (GenBank accession number NZ_AAOS02000011); pSN254, a plasmid from S. enterica serotype Newport (GenBank accession number NC_009140); and ACICU, Acinetobacter baumannii ACICU (GenBank accession number NC_010611). The thin line denotes sequence homology with Marinobacter aquaeolei VT8 (GenBank accession number NC_008740; 81% identity). Dotted lines denote unidentified sequence. TABLE 2. PCR primers Primer name and type
Sequence (5⬘ to 3⬘)
Expected size(s) (bp) of amplicon(s)
Reference or source
ESBL SHV group-F SHV group-R
GGTTATGCGTTATATTCGCC TTAGCGTTGCCAGTGCTC
865
17
IS26 IS26-1 IS26-2
TTACATTTCAAAAACTCTGC ATGAACCCATTCAAAGGCCGG
705
7
PA5317 PA5317 A PA5317 B
AGCTACCTGCAGGCGGTATT GAACAGCAGGTCGTGTTCG
320
This study This study
TaKaRa LA PCR in vitro cloning kits IS26 35 A1 IS26 35 A2 IS26 35 B1 IS26 35 B2
CTTTGCGTAGTGCACGCATCACCTCAATACCTTTG GTTACGACGGGAGGAGAGATAAAAATCGACAGTGC CGTACGCTGGTACTGCAAATACGGCATCAGTTACC GCACTGTCGATTTTTATCTCTCCTCCCGTCGTAAC
This This This This
study study study study
VOL. 54, 2010
TRANSPOSON EXPRESSING SHV-12 IN P. AERUGINOSA
ferent mechanisms for the transfer of blaSHV-12, and it appears that transposons are more difficult to transmit than plasmids. However, we propose that careful attention be given to the transfer of these genes, especially with respect to the acquisition of multidrug resistance. Nucleotide sequence accession number. The sequences corresponding to the genetic elements described in this work were assigned the NCBI accession numbers GU592828 and GU592829.
10.
11.
12.
We thank Mami Yamaguchi and Michitoshi Kimura (Laboratory of Cell and Tissue, Department of BioMedical Engineering, Sapporo Medical University School of Medicine) for the analysis of DNA sequences.
13.
REFERENCES
15.
1. Brasme, L., P. Nordmann, F. Fidel, M. F. Lartigue, O. Bajolet, L. Poirel, D. Forte, V. Vernet-Garnier, J. Madoux, J. C. Reveil, C. Alba-Sauviat, I. Baudinat, P. Bineau, C. Bouquigny-Saison, C. Eloy, C. Lafaurie, D. Simeon, J. P. Verquin, F. Noel, C. Strady, and C. De Champs. 2007. Incidence of class A extended-spectrum -lactamases in Champagne-Ardenne (France): a 1 year prospective study. J. Antimicrob. Chemother. 60:956–964. 2. Chanawong, A., F. H. M’Zali, J. Heritage, A. Lulitanond, and P. M. Hawkey. 2001. SHV-12, SHV-5, SHV-2a and VEB-1 extended-spectrum -lactamases in Gram-negative bacteria isolated in a university hospital in Thailand. J. Antimicrob. Chemother. 48:839–852. 3. Clinical and Laboratory Standards Institute. 2006. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 7th ed. Approved standard M07-7. Wayne, PA. 4. Dubois, V., C. Arpin, V. Dupart, A. Scavelli, L. Coulange, C. Andre, I. Fischer, F. Grobost, J. P. Brochet, I. Lagrange, B. Dutilh, J. Jullin, P. Noury, G. Larribet, and C. Quentin. 2008. -lactam and aminoglycoside resistance rates and mechanisms among Pseudomonas aeruginosa in French general practice (community and private healthcare centres). J. Antimicrob. Chemother. 62:316–323. 5. Hawkey, P. M. 2008. Prevalence and clonality of extended-spectrum -lactamases in Asia. Clin. Microbiol. Infect. 14(Suppl. 1):159–165. 6. Homma, J. Y. 1982. Designation of the thirteen O-group antigens of Pseudomonas aeruginosa; an amendment for the tentative proposal in 1976. Jpn. J. Exp. Med. 52:317–320. 7. Kim, J., H. S. Shin, S. Y. Seol, and D. T. Cho. 2002. Relationship between blaSHV-12 and blaSHV-2a in Korea. J. Antimicrob. Chemother. 49:261–267. 8. Livermore, D. M. 1995. -Lactamases in laboratory and clinical resistance. Clin. Microbiol. Rev. 8:557–584. 9. Mahenthiralingam, E., M. E. Campbell, J. Foster, J. S. Lam, and D. P. Speert. 1996. Random amplified polymorphic DNA typing of Pseudomonas
14.
16. 17.
18.
19.
20.
21.
22.
3959
aeruginosa isolates recovered from patients with cystic fibrosis. J. Clin. Microbiol. 34:1129–1135. Mansour, W., S. Dahmen, L. Poirel, K. Charfi, D. Bettaieb, N. Boujaafar, and O. Bouallegue. 2009. Emergence of SHV-2a extended-spectrum -lactamases in clinical isolates of Pseudomonas aeruginosa in a university hospital in Tunisia. Microb. Drug Resist. 15:295–301. Naas, T., L. Philippon, L. Poirel, E. Ronco, and P. Nordmann. 1999. An SHV-derived extended-spectrum -lactamase in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 43:1281–1284. Neonakis, I. K., E. V. Scoulica, S. K. Dimitriou, A. I. Gikas, and Y. J. Tselentis. 2003. Molecular epidemiology of extended-spectrum -lactamases produced by clinical isolates in a university hospital in Greece: detection of SHV-5 in Pseudomonas aeruginosa and prevalence of SHV-12. Microb. Drug Resist. 9:161–165. Oh, S. J., S. U. Lee, H. Y. Hwang, I. K. Bae, H. S. Jo, B. H. Lee, and S. H. Jeong. 2006. Prevalence of class A extended-spectrum -lactamases in clinical isolates of Acinetobacter baumannii and Pseudomonas aeruginosa. Korean J. Lab. Med. 26:14–20. Paterson, D. L., and R. A. Bonomo. 2005. Extended-spectrum -lactamases: a clinical update. Clin. Microbiol. Rev. 18:657–686. Poirel, L., E. Lebessi, M. Castro, C. Fevre, M. Foustoukou, and P. Nordmann. 2004. Nosocomial outbreak of extended-spectrum -lactamase SHV5-producing isolates of Pseudomonas aeruginosa in Athens, Greece. Antimicrob. Agents Chemother. 48:2277–2279. Poole, K. 2005. Aminoglycoside resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 49:479–487. Rasheed, J. K., C. Jay, B. Metchock, F. Berkowitz, L. Weigel, J. Crellin, C. Steward, B. Hill, A. A. Medeiros, and F. C. Tenover. 1997. Evolution of extended-spectrum -lactam resistance (SHV-8) in a strain of Escherichia coli during multiple episodes of bacteremia. Antimicrob. Agents Chemother. 41:647–653. Shahcheraghi, F., V. S. Nikbin, and M. M. Feizabadi. 2009. Prevalence of ESBLs genes among multidrug-resistant isolates of Pseudomonas aeruginosa isolated from patients in Tehran. Microb. Drug Resist. 15:37–39. Weldhagen, G. F., L. Poirel, and P. Nordmann. 2003. Ambler class A extended-spectrum -lactamases in Pseudomonas aeruginosa: novel developments and clinical impact. Antimicrob. Agents Chemother. 47:2385–2392. Yagi, T., H. Kurokawa, N. Shibata, K. Shibayama, and Y. Arakawa. 2000. A preliminary survey of extended-spectrum -lactamases (ESBLs) in clinical isolates of Klebsiella pneumoniae and Escherichia coli in Japan. FEMS Microbiol. Lett. 184:53–56. Yamano, Y., T. Nishikawa, T. Fujimura, T. Yutsudou, M. Tsuji, and H. Miwa. 2006. Occurrence of PER-1 producing clinical isolates of Pseudomonas aeruginosa in Japan and their susceptibility to doripenem. J. Antibiot. (Tokyo) 59:791–796. Yamasaki, K., M. Komatsu, T. Yamashita, K. Shimakawa, T. Ura, H. Nishio, K. Satoh, R. Washidu, S. Kinoshita, and M. Aihara. 2003. Production of CTX-M-3 extended-spectrum -lactamase and IMP-1 metallo -lactamase by five Gram-negative bacilli: survey of clinical isolates from seven laboratories collected in 1998 and 2000, in the Kinki region of Japan. J. Antimicrob. Chemother. 51:631–638.
