Activating transcription factor 3 (ATF3 ... - JK professional page

Comparative Biochemistry and Physiology, Part A 155 (2010) 172–182

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A j o 2 u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p a

Activating transcription factor 3 (ATF3) expression in the neural retina and optic nerve of zebrafish during optic nerve regeneration Katherine E. Saul, Joseph R. Koke, Dana M. García ⁎ Department of Biology, Texas State University-San Marcos, San Marcos, Texas 78666, USA

a r t i c l e

i n f o

Article history: Received 10 April 2009 Received in revised form 17 October 2009 Accepted 26 October 2009 Available online 5 November 2009 Keywords: Optic nerve regeneration Zebrafish ATF3 Differential gene expression cAMP Oligodendrocytes Astrocytes Retinal ganglion cells

a b s t r a c t Fish, unlike mammals, can regenerate axons in the optic nerve following optic nerve injury. We hypothesized that using microarray analysis to compare gene expression in fish which had experienced optic nerve lesion to fish which had undergone a similar operation but without optic nerve injury would reveal genes specifically involved in responding to optic nerve injury (including repair), reducing detection of genes involved in the general stress and inflammatory responses. We discovered 120 genes were significantly (minimally two-fold with a P-value ≤ 0.05) differentially expressed (up or down) at one or more time point. Among these was ATF3, a member of the cAMP-response element binding protein family. Work by others has indicated that elevated cAMP could be important in axon regeneration. We investigated ATF3 expression further by qRT-PCR, in situ hybridization and immunohistochemistry and found ATF3 expression is significantly upregulated in the ganglion cell layer of the retina, the nerve fiber layer and the optic nerve of the injured eye. The upregulation in retina is detectable by qRT-PCR by 24 h after injury, at which time ATF-3 mRNA levels are 8-fold higher than in retinas from sham-operated fish. We conclude ATF3 may be an important mediator of optic nerve regeneration-promoting gene expression in fish, a role which merits further investigation. © 2009 Elsevier Inc. All rights reserved.

1. Introduction Evolution of vertebrate animals has resulted in two distinctive forms of embryonic development — amniotic and anamniotic. Anamniotes (fish, amphibians), as compared to amniotes, in a sense never fully mature, and many genes that are developmentally silenced in amniotes as adults remain transcriptionally active throughout anamniotes' lifetimes. Anamniotes retain impressive regenerative capacities, even to the extent of entire limb replacement, while amniotes, mammals in particular, for the most part do not. This limited regenerative capacity of mammals is especially noteworthy in study of spinal cord injuries and neurodegenerative diseases that result in a loss of function due to the failure of neurons in the central nervous system (CNS) to survive and regenerate axons. Because the retina of the eye and optic nerve are part of the CNS and are accessible to experimental manipulation, optic nerve injury (ONI) and subsequent regeneration (ONR) – when it happens – have been used extensively as a model system for study of regenerative capacities of the central nervous system in vertebrates (for a recent review, see Garcia and Koke, 2009). Comparative studies in model organisms (zebrafish as anamniotes, mice as amniotes) may yield powerful insights, not just into clinically important information, but into evolutionary trade-offs regarding complexity and control of develop⁎ Corresponding author. Tel.: +1 512 245 3368; fax: +1 512 245 8713. E-mail addresses: [email protected] (K.E. Saul), [email protected] (J.R. Koke), [email protected] (D.M. García). 1095-6433/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpa.2009.10.042

ment. For example, several genes whose inactivity (e.g., BCL2) or activity (e.g. PTEN) seems to prevent ONR in mammals are also found to be over-expressed (BCL2) (Chen et al., 1997) or mutated (PTEN) (Groszer et al., 2006; Hu et al., 2005) in many metastatic cancers, implying their normal condition is necessary for maintenance of the differentiated state. Damage to the optic nerve of mammals and fish results in degeneration of axons distal to the injury site (towards the brain). In mammals, apoptosis of retinal ganglion cells (RGCs) in the retina results within 10–14 days (Cho et al., 2005). Growth of any new neurites that may sprout from the nerve stump is hampered by both physical and molecular barriers: specifically the formation of the glial scar (Goldberg and Barres, 2000; Ries et al., 2007) and molecular barriers that may include myelin inhibitory protein, semaphorin 3A, and chondroitin sulfate proteoglycans (Cao et al., 2008). In the mouse, it has been shown that optic nerve astrocytes are an obstacle to ONR; selectively poisoning them in the presence of reactivated Bcl2 is permissive to the tracking of newly formed neurites through the nerve casing en route to targets in the brain (Cho and Chen, 2008). In addition to extrinsic factors, factors intrinsic to RGCs themselves may block regeneration of crushed axons in mammals, even in the absence of astrocytes (Goldberg et al., 2002a,b). These factors include PTEN (phosphatase and tensin homolog), which blocks the downstream effects of PIP3 signaling by dephosphorylating PIP3, converting it to PIP2. PTEN seems to be constitutively active in adult mammalian RGCs. PIP3 activates, among many other things, Akt (a.k.a. protein

K.E. Saul et al. / Comparative Biochemistry and Physiology, Part A 155 (2010) 172–182

kinase B) which in turn inhibits TSC1, TSC2 (tuberous sclerosis complex 1, 2), relieving the inhibition of mTOR (mammalian target of rapamycin). Active mTOR integrates cellular signals in response to various stimuli, including hypoxia and nutrient availability, promotes protein synthesis and prevents apoptosis. Therefore, inactivation of PTEN would be expected to relieve inhibition of PIP3 and permit activation of mTOR and its downstream effectors. This expectation has been verified in an elegant study using adult, “floxxed” mice to remove the gene for PTEN from RGCs; RGCs of such mice with disregulated mTOR resist apoptosis after ONI and show robust neurite extension through the lesion into the distal stump within 14 days (Park et al., 2008). In lower vertebrates there is little evidence that astrocytes or intrinsic factors present an obstacle to nerve regeneration. Following optic nerve injury by crush or axotomy in fish, rapidly growing neurites sprout from the nerve stump and functionally re-enervate the brain (Attardi and Sperry, 1963; Bernhardt, 1989, 1999; Veldman et al., 2007). Presumably fish are able to regenerate the axons of the optic nerve because they are able to express or suppress genes in response to ONI appropriately to create a permissive environment (as compared to mammals) for RGC survival and neurite extension. In this study, we used cDNA microarray analysis to compare gene expression in zebrafish retina which had experienced ONI to that in fish which had undergone a similar operation, but without the optic nerve injury (sham-operated, or SO), and we made these comparisons at three different time points (3, 24, and 168 h). In so doing, we discovered 120 genes that were differentially expressed. Among these was activating transcription factor 3 (ATF3), a member of the ATF/CREB family (Hai and Hartman, 2001). Work by others has indicated that elevated cAMP could be important in axon regeneration (Hannila and Filbin, 2008; Muller et al., 2007); therefore, we investigated ATF3 further by quantitative RT-PCR (qRT-PCR), in situ hybridization (ISH) and immunohistochemistry. 2. Materials and methods 2.1. Animals All animal use protocols were approved by the Texas State University-San Marcos IACUC (approval # 0703_0122_07). Wildtype ZDR zebrafish (Danio rerio, Aquatica Tropicals, Plant City, FL, USA) were acclimated to a 12/12 h light/dark cycle for a minimum of 14 days before use. These fish represent a wild-type, lab-bred (but not inbred) lineage which originated from Scientific Hatcheries (Huntington, CA, USA) and have been maintained for 30 or more generations. We compared four interventions, designated optic nerve injured (ONI), sham-operated (SO), contralateral (CL) and control (CT). The surgical procedures for each are described below. 2.2. Optic nerve injury Optic nerve injury was performed as described below using a method modified from Liu and Londraville (2003). Zebrafish were anesthetized in 0.2% MS-222 (Finquel® tricaine methanesulfonate, Argent Chemical Laboratories, Redmond, WA, USA) dissolved in tank water. Each zebrafish was wrapped in a wet paper towel, exposing only the head, and placed on the stage of a stereomicroscope for dissection. By separating the dorsal connective tissue, cutting the lateral rectus muscle, and then angling the eye rostrally, the optic nerve was exposed. Taking care not to damage the ophthalmic artery, the optic nerve was partially severed (~ 90%) using 3 mm microscissors (EM Sciences, Hatfield, PA, USA). The eye was placed back into the socket and the fish revived by placing it in aerated aquarium water. Sham operations were identical except the optic nerve was not severed. Only one eye was operated on in each fish, yielding an

173

unoperated contralateral eye. Control fish were not handled, anesthetized or subjected to surgical manipulations until sacrificed. 2.3. RNA extraction All fish were sacrificed at midday to eliminate differences in gene expression associated with diurnal rhythm. Following euthanasia by overdose in MS-222, whole eyes were removed 3 h, 24 h, and 7 days following ONI or SO and immediately placed in RNA later (Ambion; Austin, TX, USA). For microarray analysis, the optic nerve injured eyes from 12–15 identically treated fish were pooled for each of three triplicate samples. The sclera and lens were removed, and the remaining eye tissues (retina, retinal pigment epithelium, and choroid) were placed in 1 ml of TRI-Reagent (Ambion) for RNA extraction. RNA clean-up was performed using RNAeasy spin columns (QIAGEN, Valencia, CA, USA). RNA quality and integrity was assessed using a Nanodrop spectrophotometer (Thermofisher Scientific, Waltham, MA, USA) and glyoxal gel electrophoresis with ethidium bromide (Applied Biosystems, Foster City, CA, USA) staining to detect the 18 S and 28 S rRNA bands. RNA samples were sent to Michigan State University's Research Technology Support Facility for an additional quality check using the Agilent BioAnalyzer and subsequent microarray analysis. 2.4. Microarray analysis The Zebrafish 14 K OciChipTM Oligo-nucleotide Array (Ocimum Biosolutions, Indianapolis, IN) was used for dual-color analysis comparing ONI and SO fish. A total of 9 OciChips were used to analyze the triplicate RNA samples at 3 h, 24 h and 168 h. The Ocimum 14 K OciChipTM Oligo-nucleotide Array comprises 14,067 unique, ~ 50-mer probes representing 8839 genes. Labeling and hybridization was carried out using standard procedures at the Michigan State University Research Technology Support Facility (http://www.genomics.msu.edu/) and following the microarray manufacturer's instructions. Slides were scanned using an Affymetrix 428 Array Scanner and analyzed with the GenePix Pro 3.0 software (Axon Instruments, Sunnydale, CA, USA). Array normalization and statistical analysis were performed using the “limma: Linear Models for Microarray Data” library module (version 2.2.0) of the R statistical package. Intensity data were normalized using the global LOWESS (locally weighted scatter plot smoothing) method with the least squares method used for the linear model fit. A one-way analysis of variance was performed on the ratios of the triplicate time points to determine whether statistically significant differences existed in gene expression between SO and ONI samples at the three time points (3, 24, and 168 h). To be included in the analysis, hybridized spots met a minimum criterion of exceeding a threshold intensity of 1000 fluorescence units in at least one channel for at least one sample at each time point. All of the microarray signal data have been deposited in the Gene Expression Omnibus (GEO) repository under the series accession number GSE17854. All genes that displayed greater than 2.0-fold change (up or down) at one or more time points were considered differentially expressed and were individually analyzed for gene ontology using the web-based search engine GeneTools (Beisvag et al., 2006). Ontology analysis was accomplished based on GenBank accession number. 2.5. Quantitative RT-PCR Reverse transcription was completed on 350 ng of RNA isolated from the pooled retinas of 2–3 fish using MMLV Reverse Transcriptase (Promega, Milwaukee, WI, USA) using random and oligo dT primers (Promega) for 60 min at 37 °C. Quantitative reverse transcriptase PCR (qRT-PCR) was carried out on an Eppendorf Realplex2 Mastercycler (Hamburg, Germany) using Invitrogen's Universal SYBR®

174


Table 1 Microarray results summarizing changes in gene expression as a result of ONI. Time after ONI

3h 24 h 168 h

Number of genes showing ≥ 2.0-fold expression changes in ONI Up

Down

12 10 43

4 9 47

GreenER™ Two-Step qRT-PCR Universal Kit (Invitrogen, Carlsbad, CA) following the cycling program: 5 min at 50 °C for cDNA synthesis, 95 °C for 10 min, 45 cycles [95 °C for 15 s, 60 °C for 15 s, 68 °C for 15 s], followed by melt curve analysis. The following primers were used: ATF3 (NM_200964), F-TCACGCTGGACGACTTCACAAACT and RTCTCAGTGTTCATGCAGGCTCTGT; ß-actin (NM_131031), F-ATCAGCATGGCTTCTGCTCT and R-GTGAGGAGGGCAAAGTGGTA; ribosomal gene L24 (NM_173235), F-ATGTGAGTCTGCGTTTCTGTCCAAG and RGCTTCTTCGACACCTCCTCAGACTG. ß-actin primers were purchased from Bio-Synthesis (Lewisville, TX, USA); other primers were purchased from Integrated DNA Technologies (http://www.idtdna. com/). Fold-changes were estimated using 2-ΔΔCT method described by Livak and Schmittgen (2001) using ß-actin and L24 as reference genes. The results presented here for whole eye extracts are based on the L24 gene, while results for retinal extracts are based on ß-actin

gene expression. Analysis was performed on triplicate biological replicates for each condition (ONI, SO, CL and CT) except for the 3 and 24 h time points for whole eye, in which duplicate samples were analyzed (not shown). In addition to the ONI, SO and unoperated control fish, we also included the contralateral eye of the ONI fish in the qRT-PCR analysis, in order to determine if the stress of handling the fish had an impact on gene expression (Chiang and Thomas, 1972). Comparison of results among ONI, SO, control, and contralateral eye was performed by two factor analysis of variance (ANOVA) using the R statistical package, followed by single factor ANOVA for each time point and post-hoc Tukey–Kramer test to determine significance of differences among treatment categories using StatPlus (Analyst Soft - http://www.analystsoft.com/en/). 2.6. In situ hybridization and immunofluorescence microscopy For in situ hybridization (ISH) and immunofluorescent localization of ATF3 mRNA and protein, respectively, both eyes, optic nerves and brain were dissected out intact in 4% PFA in PBS then fixed overnight. Following washing in PBS, the tissue was cryoprotected by incubation in 30% sucrose-PBS until the tissue sank. The intact visual tract was mounted to permit transverse sectioning to allow sections to include the CL and ONI retina, optic nerves, chiasma, and optic tectum of the brain. For ISH, ONI fish were sacrificed at 24 h after injury by overdose in MS-222. Sections were cut at 14 µm using a Zeiss Microm cryostat, collected on poly-L-lysine-coated coverslips and stored at −80 °C

Table 2 Genes showing 2.0-fold or greater increased expression 3 h after injury. Accession number

Name/description

Ratio (ONI:SO)

Previous reports in a nerve injury model

NM_200931.1 NM_200570.1 NM_200333.1 NM_001034972.1 NM_001012262.1 XM_001332616.1 BC076530.1 NM_214773.1 NM_001007383.1 NM_200319.1 NM_214716.1 AF028724.1

KDEL containing 1 Selenium-binding protein 1 CXXC finger 1 (PHD domain) Phosphatidylinositol 4-kinase III alpha Crystallin, gamma S2 Similar to peroxisomal biogenesis factor 6 Tumor protein p63 Acid phosphatase 5a, tartrate resistant zgc: 101832 (aka small ribonucleoprotein A′) Transmembrane protein 57 Heat shock protein 4, like Connexin 30.9

6.65 3.35 3.09 3.02 2.51 2.27 2.19 2.06 2.05 1.99 1.97 1.96

None (Purdey, 2001) None None None None None None (McWhorter et al., 2008) None None None

Table 3 Genes showing 2.0-fold or greater decreased expression 3 h after injury. Accession number

Name/description

Ratio (SO:ONI)

Previous reported in a nerve injury model

NM_200751.1⁎ BX323035.8 NM_131568.1 NM_213506.1

Retinal pigment epithelium-specific protein 65a DNA sequence from clone DKEYP-94H10 Transient receptor potential cation channel (trpc4apb) zgc:63491

2.22 2.17 2.13 2.04

(Schonthaler et al., 2007) None (Wu et al., 2008) None

⁎ This gene was represented in two different spots. Here the average fold-change is given.

Table 4 Genes showing 2-fold or greater increased expression 24 h after injury. Accession number

Name/description

Ratio (ONI:SO)

Previous reports in a nerve injury model

NM_200964 NM_001024811 NM_130992.1 NM_001001399 AY178796.1 BX000434.11 NM_201293 U93471.1 NM_001098251.1 NM_207060.1

Activating transcription factor 3 GTP-binding protein 1-like Noggin 2 Signal sequence receptor, ß Annexin 2a DNA sequence from clone CH211-2E18 S-adenosyl homocysteine hydrolase-like 1 Nuclear receptor subfamily 4, group A, member 2a Similar to Bardet-Biedl syndrome 1 Transmembrane protein 49

3.60 3.09 2.57 2.23 2.19 2.12 2.11 2.04 2.00 1.98

(Seijffers et al., 2007; Saito and Dahlin, 2008) None (Matsuura et al., 2008) None None None None (Ettl et al., 2006) None None


175

Table 5 Genes showing 2-fold or greater decreased expression 24 h after injury. Accession number

Name/description

Ratio (SO:ONI)

Previous reports in nerve injury model

NM_200410.1 XM_679775.1 NM_131594.1 NM_199946.1 NM_200711.1 NM_213364.2 NM_212866.1 XM_693793.2 NM_213000.1

Solute carrier family 16 (monocarboxylic acid transporters) Cerebellin 2a precursor ß-catenin-interacting protein Male germ cell-associated kinase Calbindin 2 Proline 4 hydroxylase, ß zgc:77051 Similar to ClpB caseinolytic peptidase B homolog Chimerin 1

2.43 2.12 2.12 2.10 2.09 2.08 2.04 2.01 2.00

None None None None None None None None None

until use. In situ hybridization was performed using methods modified from Braissant and Wahli (1998). Sections were post-fixed in 4% PFA (10 min at room temperature) and incubated in PBS containing 0.1% activated diethylpyrocarbonate (DEPC) 2 times for 15 min at room temperature. Sections were equilibrated for 15 min in 5X SSC (NaCl, 0.75 M; Na citrate, 0.075 M) and prehybridized for 2 h at 55 °C in hybridization buffer: 50% formamide (Sigma Aldrich), 5X SSC, 40 µg/mL salmon sperm DNA (Invitrogen). Hybridization reaction of ATF3 probes at a concentration of 200 ng/mL was carried out at 55 °C for 15 h. Probes (Eurofins MWG Operon, http://www. eurofinsdna.com/) were conjugated to DIG at the 5′ end with the

following sequences (5′ → 3′): GCAGGACACCTTGTCATC (antisense); GAGATGACAAGGTGTCCTGC (sense). Following hybridization, sections were washed 30 min in 2X SSC, 1 h in 2X SSC, 1 h in 0.1X SSC, and then equilibrated in Tris-buffer (100 mM Tris–HCl/150 mM NaCl) for 5 min; all these steps were performed at room temperature. Incubation with anti-DIG antibody conjugated to alkaline phosphatase (Roche, Indianapolis, IN, USA) diluted 1:1000 in Tris-buffer containing 0.5% nonfat dry milk was carried out for 2 h at room temperature. Sections were washed 3 times for 15 min in Tris-buffer prior to color development for 30 min in NBT/BCIP solution (Roche) diluted 1:500 in Tris-buffer.

Table 6 Genes showing 2-fold or greater increased expression 168 h after injury. Accession number

Name/description

Ratio (ONI:SO)


NM_200937 XM_694495.2 NM_198818.1 NM_213062.1 NM_001110403.1 NM_001002378.1 NM_212617.1 NM_200093.1 NM_131098.1 NM_200751.1 CR848747.8 NM_212758.1 AY391434.1 NM_001004679.1 NM_001007105.1 NM_212756.1 XM_001334747.1 XM_678183.2 AY178796.1 NM_001045851.1 NM_200577.1 NM_001002695.1 NM_214716.1 NM_199949.2 NM_139180.1 NM_200845.1 NM_200964.1 NM_001003558.1 NM_001002378.1 AY057057.1 NM_131708.1 NM_130926.1 CU302326.8 NM_152961.2 BC042319.1 NM_200185.1 BC064291.1 NM_201055.1 XM_679690.2 XM_688637.2 NM_001003447.1 NM_001105116.1

Inhibitor of growth family, member 3 Serum/glucocorticoid regulated kinase 2 Tubulin beta 5 Ubiquitin-like modifier activating enzyme 1 Heat shock protein 8 zgc:92066 YY1 transcription factor ORM1-like 1 Apolipoprotein Eb RPE-specific protein 65a Tubulin beta 5 Peptidylprolyl isomerase A Ribosomal protein SA zgc:103619 Apoptotic chromatin condensation inducer 1a Granulin 2 Similar to tubulin alpha 6 Similar to zinc finger protein 91 Annexin 2a zgc:154081 zgc:66026 zgc:92631 Heat shock protein 4, like Eukaryotic translation elongation factor 1 beta 2 Lysozyme zgc:77702 Activating transcription factor 3 Tubulin, alpha 8 like 3 zgc:92066 Baculoviral IAP repeat-containing 5a Trypsin Non-metastatic cells 2 DNA sequence from clone CH211-143F7 Fatty acid binding protein 3, muscle, heart Tubulin, alpha 1 Tubulin, alpha 8 like 4 Elongation factor 1-alpha zgc:55862 si:ch211-214 k9.2 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated Ribosomal protein L15 Novel protein similar to vertebrate praja family protein

3.96 3.52 3.50 3.12 2.78 2.72 2.62 2.59 2.54 2.54 2.51 2.49 2.49 2.45 2.42 2.38 2.34 2.28 2.26 2.24 2.21 2.16 2.16 2.16 2.15 2.15 2.13 2.12 2.12 2.12 2.09 2.09 2.09 2.06 2.06 2.05 2.04 2.02 1.99 1.97 1.97 1.96

None None (Veldman et al., 2007) None None None None None None (Schonthaler et al., 2007) (Veldman et al., 2007) None None None None (Cameron et al., 2005) None None None None None None None None None None (Seijffers et al., 2007; Saito and Dahlin, 2008; Veldman et al., 2007) None None None None None None None (Gulati-Leekha and Goldman, 2006; Senut et al., 2004) None None None None None None None

176


Table 7 Genes showing 2-fold or greater decreased expression 168 h after injury. Accession number

Name/description

Ratio (SO:ONI)


NM_212799.1 NM_131868.2 NM_001007160.1 NM_212755.1 NM_131838.2 NM_213202.1 XM_001338177.1 NM_212609.1a XM_686878.2 NM_213149.1 NM_131175.1 NM_194384.1 NM_200784.1 NM_200719.1 NM_152955.1 XM_001337793.1 XM_681309.1 NM_199968.1 NM_001030077.1 NM_131039.1 NM_001017711.1 NM_001020620.1 NM_200837.1b NM_212881.1 NM_199517.1 BX649356.19 NM_200785.1 NM_131319.1 NM_194393.1 NM_131567.1 NM_001003431.1 BC063938.1 CT027840.6 NM_213216.2 NM_199972.1 NM_212702.1 NM_001099994.1 XM_677731.1 NM_131693.1 AC024175.3 NM_131192.1 XM_690644.2 NM_001077302.1 NM_178132.2 NM_001007765.1 NM_200009.1

Phosphodiesterase 6G, cGMP-specific, rod, gamma G protein, alpha transducing activity polypeptide 1 Phosphodiesterase 6A, cGMP-specific, rod, alpha Opioid receptor, delta 1b ATPase, Na+/K+ transporting, beta 2b polypeptide G protein, beta polypeptide 3 Similar to KIAA1447 G protein, beta polypeptide 1 Tubulin, gamma complex associated protein 3 FK506 binding protein 5 Opsin 1, long-wave-sensitive, 1 Aldolase c, fructose-bisphosphate Coiled-coil-helix-coiled-coil-helix domain containing 10 ADP-ribosylation factor-like 3, like 2 Dachsund a Similar to Abelson murine leukemia viral oncogene homolog 1 Slit and trk like 4 protein ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Solute carrier family 9 (sodium/hydrogen exchanger), member 7 es1 protein G protein-coupled receptor kinase 1 b zgc:110664 zgc:73359 zgc:73371 N-myc downstream regulated family member 3a DNA sequence from clone CH211-209H5 zgc:73310 Opsin 1 (cone pigments), short-wave-sensitive 1 Guanylate cyclase activator 1C Retinal degradation slow 4 zgc:92880 Rhodopsin Zebrafish DNA sequence from clone CH211-271F14 Arginine and glutamate rich 1a Elongation of very long chain fatty acids-like 4 Bromodomain containing 3b Clusterin-like Phosducin 1 Muscle-specific beta 1 integrin binding protein Mitochondrial genome Opsin 1, short-wave-sensitive 2 Similar to radial spokehead-like protein 3 si:ch211-195b13.1 NK3 homeobox 2 NADH dehydrogenase Fe-S protein 1 zgc:73138

3.31 2.79 2.78 2.75 2.74 2.69 2.59 2.59 2.58 2.58 2.56 2.54 2.52 2.48 2.42 2.41 2.40 2.39 2.36 2.33 2.30 2.25 2.25 2.24 2.23 2.23 2.22 2.21 2.20 2.16 2.12 2.09 2.09 2.08 2.07 2.06 2.05 2.05 2.04 2.01 2.01 1.99 1.97 1.96 1.96 1.95

None (Cameron et al., 2005) None None None None None None None None (Raymond et al., 2006) None None None None None None None None None None None None None None None None None None None None None None None None None None None None None None None None None None None

a b

This gene was represented in two different spots. Here the average fold-change is given. This gene was represented in three different spots. Here the average fold-change is given.

For immunofluorescence, uninjured fish and ONI fish (24 and 72 h after injury) were sacrificed by overdose in MS-222. Sections were cut at 20 µm and collected on poly-L-lysine coated coverslips and stored at − 80 °C until use. ATF3 immunostaining was performed as described by Seijffers et al. (2007). Images were captured using an Olympus FV1000 laser scanning confocal microscope and prepared for publication using Adobe PhotoShop 10.0.1. 2.7. Intensity analysis of immunofluorescent staining for the ATF3 protein Staining intensity was determined using the pixel intensity tool of the Fluoview Software for the Olympus FV1000 laser scanning confocal system. RGCs were selected from two different retinal sections for each treatment category and time point and were measured for whole cell labeling using z projections of stacks containing ten 1.0 µm thick sections. RGC nuclei were measured using single, 1.0 µm optical sections to avoid inclusion of fluorescence from above or below the nuclei. Differences in pixel intensity were evaluated using two factor ANOVA and a post-hoc Tukey–Kramer test to determine where the differences lay.

3. Results 3.1. Microarray analysis Using the Zebrafish 14 K OciChipTM Oligonucleotide Array, we found 120 genes with at least a 2.0-fold difference (P ≤ 0.05) between ONI and SO eyes at one or more time points following surgery. The number of differentially expressed genes at 168 h was much greater than the number at 3 and 24 h (Tables 1–7). All genes that displayed greater than 2.0-fold differences at one or more time point were individually analyzed for known functional characteristics and gene ontology. The majority of the genes were not classified ontologically beyond the major categories of biological process, metabolic function and cellular component. However, in some cases this seemed to be a problem of notation rather than a lack of understanding of the genes in question. That said, of the genes that were classified, the greatest number fell into the molecular function category of nucleotide binding (15 genes), the biological process category of signal transduction (8 genes) and the cellular component category of integral to membrane (10 genes). Additional major categories under molecular function were metal ion binding (7 genes), including


calcium, zinc, manganese, magnesium and iron binding, and receptor activity and signal transducer activity (7 genes each). Interestingly, among the genes in the signal transducer activity were numerous genes associated with visual perception, almost all of which were substantially down-regulated at 168 h post-injury. One gene expressed at higher levels in ONI fish in the cell proliferation and differentiation categories was ATF3, a member of the cAMP-response element binding protein family of transcription factors. Because work by others has indicated that elevated cAMP could be important in axon regeneration (Hannila and Filbin, 2008; Muller et al., 2007), the increased expression of ATF3 in the injured eye was of particular interest. ATF3 showed no change in expression levels at 3 h, but increased expression levels at 24 and 168 h– 3.60and 2.13-fold, respectively (P b 0.005 in both cases). Therefore, ATF3 expression was examined further by qRT-PCR, in situ hybridization and immunolocalization.

3.2. ATF3 expression analysis by quantitative RT-PCR Two different qRT-PCR analyses were performed: one using RNA extracted from whole eyes (Fig. 1) and the other using RNA extracted from retina (Fig. 2). Quantitative RT-PCR performed using RNA extracted from whole eyes 3 h post-surgery revealed ATF3 expression levels to be significantly (P ≤ 0.05) increased in eyes that had undergone surgery (ONI and SO) relative to those that had not (control and contralateral). In contrast, there were no significant differences among any of the treatment groups (ONI, SO, control or contralateral) at the same time point based on qRT-PCR performed using retinal RNA. In whole eye samples taken 24 h after ONI, ATF3 expression was unchanged from the 3 h samples, while ATF3 expression in the SO eyes had declined significantly (P ≤ 0.05) compared to expression in SO eyes at 3 h (Fig. 1). However, because of variability among the 24 h ONI eyes the approximately 3-fold difference between expression levels in ONI relative to SO eyes was obscured. Levels of ATF3 expression in CL and CT eyes were not significantly different from each other or their 3 h levels (Fig. 1). However, at 24 h ATF3 expression appeared strongly and significantly upregulated in retinal ONI samples (approximately 28-fold) in comparison to levels

Fig. 1. qRT-PCR for whole eyes. The Y-axis shows relative Ct values (CtATF3 − CtL24); lower values indicate higher levels of gene expression. Three h after ONI or SO, ATF3 expression in both the ONI and the SO eyes was significantly upregulated compared to the CL and CT eyes, but was not significantly different between ONI and SO eyes. The largest increase in ATF3 gene expression was observed in ONI eyes at168 h, where a roughly 16-fold, significant (P b 0.001) increase in expression was observed in comparison to SO, CL, and CT eyes. For each bar in the graph, N = 3. For technical reasons, N = 2 at 3 and 24 h for the control; therefore, those data are not included in the graph. However, the mean relative Ct value at 3 h was 7.6 and at 24 h was 7.3. The variation is shown as SEM (standard error of the mean).

177

Fig. 2. qRT-PCR for retinas. At 3 h post-ONI, no significant differences were apparent among the experimental groups (ONI, SO, CL, and CT). Twenty-four h after ONI, ATF3 expression in ONI retinas appeared sharply and significantly 18-fold upregulated in comparison to SO, CL, and CT retinas, in which ATF3 levels were not significantly different from one another. After 168 h, ATF3 expression in ONI eyes had not significantly decreased compared to the 24 h level of expression, remaining significantly higher than the levels seen in the SO, CL, and CT retinas. For each bar in the graph, N = 3, and the variation is shown as SEM.

observed in SO, CL, and CT retinas, which were not significantly different from one another or from all groups at 3 h post-ONI (Fig. 2). One week (168 h) after ONI, qRT-PCR showed ATF3 expression from whole eyes of ONI fish to be at the highest levels of any of the three time points, approximately 16 times higher than that found in SO, CL, CT. ATF3 levels in SO, CL and control eyes were not significantly different from one another (Fig. 1). Similar results were seen in extracts from retinal samples where ATF3 expression in ONI retinas was sharply up as compared to SO, CL, and CT retina (Fig. 2). Interestingly, at 168 h, ATF3 expression levels observed in retinal samples were not statistically different from that seen in whole eye samples (Figs. 1 and 2). 3.3. In situ hybridization and immunohistochemistry ISH on sections of zebrafish retinas obtained 24 h post-ONI using the antisense probe revealed strong staining of RGC cytoplasm and the nerve fiber layer, as compared to the sense probe (Fig. 3). The RGC axons appeared myelinated (Fig. 3B and C), and most of the antisense reaction product appeared to be in the cytoplasm near the membrane of the myelinating cells (Fig. 3B). The intensity of the reaction product generated by the antisense probe obscured the transition between the axon bundles and the perikaryon of the RGCs, and the reaction product also extended into the injured optic nerve (Fig. 3A). Immunofluorescence staining indicated little or no presence of the ATF3 protein in the cytoplasm of retinal ganglion cells from fish not subjected to ONI (Fig. 4A). Twenty-four and 72 h after ONI, fluorescent labeling due to anti-ATF3 was seen in the cytoplasm and nuclei of RGCs in ONI retinas and to a slightly lesser extent in the respective CL retinas (Fig. 4C–F). Pixel intensity and statistical analysis of ATF3 labelling indicated a doubling of staining intensity measured over whole RGCs (nuclei and cytoplasm) 24 h after ONI, with no significant difference between the ONI and CL retinas (Fig. 5A). A slight but significant drop in ATF3 staining intensity was observed 72 h after ONI (as compared to 24 h), but again there was no significant difference between the ONI and CL retinas (Fig. 5A). However, the result was strikingly different when examining nuclei exclusive of cytoplasm. In comparison to the whole cell results, nuclei observed in RGCs from ONI fish injured 24 h prior to immunolabeling showed about 40% more ATF3 labeling than any of the other categories, including the 24 h CL retina. ATF3 staining in nuclei after ONI, in both the ONI and CL retinas was significantly more intense than that seen in uninjured (0 h) fish. As seen in the whole cell analysis, nuclear labeling declined

178


Fig. 3. In situ hybridization of ATF3 probes. Micrographs showing results of in situ hybridization on cryosections of retina from ONI eyes fixed 24 h after injury. Panels A and B show low magnification views of retina and optic nerve from antisense and sense probed tissue sections, respectively. In A, the retinal layers are keyed, where 1 is the nerve fiber layer, 2 indicates the nuclei of the RGCs, 3 the inner plexiform layer, 4 the inner nuclear layer, 5 the outer nuclear layer, 6 the photoreceptors, 7 the RPE, and 8 the choroid. All images were obtained at the same brightness and contrast settings using digital scanning microscopy. Comparison of results between the antisense and sense probes in the inner plexiform layers was somewhat confounded ostensibly by endogenous phosphatases that may have caused false positive staining. However, in the nerve fiber layer (1) and in the optic nerve, dense reaction product is apparent in panel A (antisense probe) and not apparent in panel B (sense probe) in the same locations. Panels C is an enlargement of the area indicated by the yellow-outlined box in panel A, showing dense reaction product resulting from the antisense probe in the perikaryon areas of RGCs and what appear to be myelinating cells in the bundled fiber layer. Because of the density of the reaction product, the boundary between RGC cytoplasm and the myelinating cells is obscured. Panel D is similar to C, except the sense probe was used. No reaction product resembling that seen in panel C is apparent. The calibration bars in C and D represent 40 µm.

from 24 to 72 h after ONI, but remained significantly elevated compared to nuclei of RGCs from uninjured fish (Fig. 5B). In addition, ATF3 labeling was observed 24 h after injury in the injured optic

nerve, but not in the CL uninjured nerve, in a similar pattern as seen by ISH with the antisense probe for ATF3 (Fig. 6). Labeling was particularly strong in the nuclei and cytoplasm of cells resembling

Fig. 4. Immunofluorescence localization of the ATF3 protein in RGCs. Each panel shows a portion of the RGC layer in a 1 µm thick optical section through nuclei. Blue staining is from DAPI; the red indicates ATF3 antibody localization. Panel A shows a representative area from a fish not subjected to ONI. Panel B shows the immunofluorescence control (no antiATF3 present). Panels C and D show ATF3 localization 24 h after ONI in the RGC layer from ONI retina and CL retina, respectively. The large arrows indicate labeling in the cytoplasm and nuclei of RGCs, while the small arrows in C show labeling in the bundled axon layer. Panels E and F are similar to C and D 72 h after ONI. See Fig. 5 for staining intensity measurements and statistical analysis of these images.


Fig. 5. Intensity analysis of immunofluorescent staining for the ATF3 protein. Staining intensity was determined using the pixel intensity tool of the Fluoview Software for the Olympus FV1000 laser scanning confocal system. Panel A, RGCs from randomly selected areas of two different sections for each category and time point were measured for whole cell labeling using z projections of stacks containing ten 1.0 µm thick sections. Panel B, RGC nuclei were measured using single optical sections to avoid inclusion of fluorescence from above or below the nuclei. N = 15 for each category and time point. In both panels, the error bars indicate standard error of the mean. “⁎” indicates the 0 h value is significantly less than all the other categories. The 24 h CL and ONI values are not different from each other, but are different from the 72 h CL and ONI values (also not different from one another). In panel B, the “⁎⁎” at 24 h indicates that ATF3 staining in this group was significantly greater than in all other categories. No other significant differences were found.

optic nerve astrocytes, as described by Macdonald et al. (1997), observed closest to the injury site (Fig. 6). 4. Discussion In this study we report 120 genes differentially regulated in response to optic nerve injury. Our experimental design incorporated RNA extracted from the retinas of sham-operated fish to compare to RNA extracted from retinas of optic nerve injured fish. With this comparison, we attempted to eliminate “noise” from non-neuronal tissue repair and inflammatory responses, while emphasizing “signal” — gene responses specific to neural injury and regeneration. The time points of 3, 24, and 168 h were chosen to capture early responders and then compare expression profiles after one day and one week. Others have reported regenerating axons first form terminal arbors in the brain at 7 days (Bernhardt et al., 1996). Complementary DNA microarray analysis of retinal regeneration (Cameron et al., 2005) and optic nerve regeneration in zebrafish have been previously reported (Veldman et al., 2007). Veldman et al. (2007) used laser capture microdissection to examine changes in gene expression in RGCs 3 days after optic nerve crush injury. Among the 120 genes that we report here as being differentially regulated, only a small minority (b20%) have been previously reported as being associated with nerve injury or repair. Many of these genes include cytoskeletal genes, e.g. various tubulin genes, expression of which could be related to axonal extension. Many more genes have been

179

described as being involved in development or differentiation in noninjury models, for example, baculoviral IAP repeat containing 5a, also known as survivin. Work done by Delvaeye et al. (2009), indicates that this gene is expressed in retina during development, and knocking it down results in both microcephaly and microphthalmia in zebrafish larvae, implying that it is important in development of the central nervous system. In mice, survivin is expressed in proliferating, but not quiescent cells (Adida et al., 1998) and by neural progenitor cells (Pennartz et al., 2004). In the context of our model, neural progenitors are retained in the retina of fish throughout their whole lives (Fausett and Goldman, 2006) and may increase proliferative activity in response to optic nerve injury. Numerous genes associated with phototransduction declined in expression in the optic nerve injured fish relative to the shamoperated fish. For example, there were greater than 2-fold decreases in expression of two, short wavelength opsins as well as rhodopsin in the optic nerve injured eye at 168 h post-injury. Green-sensitive opsin has been reported by Cameron et al. (2005) to decrease nearly 2-fold in fish which have sustained retinal injury; however, that downregulation appears to be transient with expression levels recovering to normal values by three days post-lesion. We found other components of the visual signaling pathway were also expressed at lower levels in the optic nerve injured eye. The general decline in genes associated with phototransduction may result from a decrease in the number of photoreceptors as a result of apoptosis or from decreased activity of the photoreceptors consequent to retrograde signals or lack thereof. This conjecture requires further investigation. Veldman et al. (2007) found ATF3 among many members of the CREB/ATF family upregulated following optic nerve crush. The present study used RNA derived from retina and choroid as we were interested in the responses of all the cell types present, particularly glia, to severing the optic nerve. Despite these differences in experimental design, like Veldman et al. (2007), who reported a N20-fold increase in ATF3 expression, we saw higher expression levels for ATF3 in the retinas taken from injured fish. We found ATF3 significantly upregulated in extracts from whole ONI and SO eyes 3 h after ONI or SO based on qRT-PCR analysis. The amount of upregulation was not significantly different between ONI and SO, and both were significant in comparison to CL and CT eyes. No such differences in ATF3 expression were seen in retina-only extracts. ATF3 is known to be induced by tissue injury or stress in a number of different cell types in addition to neurons (Hai et al., 1999); therefore, the differences we observed 3 h post-ONI between whole eye and retina-only are likely due to non-neuronal tissue injured during the surgical procedure. This inference is supported by comparing the 3 h levels of ATF3 expression between the ONI and SO whole eyes (Fig. 1) and then to the same in the retinal samples (Fig. 2). At 24 h postsurgery, ATF3 expression levels in samples derived from shamoperated whole eye returned to levels not different from CL and CT (Fig. 1). However, 24 h post-surgery retinal samples showed ATF3 expression reaching the highest fold-change value recorded in this study (Fig. 2). The sharp difference between results from whole eye and retinal samples apparently results from an abrupt increase between 3 and 24 h in ATF3 expression in RGCs and possibly associated axonal glia (Fig. 3), an increase obscured by decreasing ATF3 expression in non-retinal tissues in the whole eye preparations. This interpretation is reinforced by comparison of extracts 168 h after ONI, where ATF3 expression levels are not significantly different between whole eye and retinal extracts in the ONI group, and both remain significantly upregulated in comparison to the SO, CL, and CT groups (Figs. 1 and 2). ISH using the ATF3 antisense probe after ONI did not reveal heightened ATF3 expression in any cell type in the retina other than RGC cell bodies and cellular elements in the nerve fiber layer at 24 (Fig. 3) or 168 h (not shown) after injury. The pattern of labeling in the nerve fiber layer was reminiscent of internodal regions of

180


Fig. 6. ATF3 immunofluorescence in optic nerve 72 after ONI. Panel A shows a portion of the optic nerve injured 72 h prior to fixation and immunostained for ATF3 (red). The cut edge is at the left, and the back of the eye is at right. The blue stain results from DAPI, showing the location of nuclei. The image is a projection of 20 optical sections, each 1 µm thick. Note the apparent gradient of ATF3 expression, brightest at both ends and less bright in the center. The arrow indicates cytoplasmic and nuclear localization of ATF3 in what appears to be an optic nerve astrocyte. Labeling is more obvious in panel B, which is an image obtained at higher magnification. In panel B, many cells can be seen (examples indicated by arrows) with ATF3 staining in the cytoplasm and to a lesser extent in nuclei (pink spots due to colocalization with DAPI). Panel C shows the CL optic nerve from the same section from which images A and B were obtained. All three images were recorded and processed to maintain identical sensitivity and brightness settings.

myelinated axons. Myelination of the intraretinal RGC axons in zebrafish has been attributed to oligodendrocytes and the myelin described as “loose” myelin (Schweitzer et al., 2007). In contrast, in mammals the majority of intraretinal RGC axons are unmyelinated (Perry and Lund, 1990). Our own examination of the inner retina using transmission electron microscopy revealed many, but not all, RGC axons to be myelinated (data not shown). Optic tract oligodendrocytes of fish have been reported to have many molecular and morphological similarities to Schwann cells (Bastmeyer et al., 1994), and although the resolution of the ISH technique used in this study was insufficient to be conclusive, it appears that the majority of the upregulated ATF3 expression in response to ONI at 24 h may have occurred in intraretinal oligodendrocytes, while after 168 h ATF3 expression appeared most intense in the RGC cytoplasm (data not shown). Immunofluorescence results roughly mirrored results obtained by ISH in that intensity of labeling in the RGCs in retinas ipsilateral to the injury site was significantly higher than in either contralateral retinas or retinas from uninjured fish. Furthermore, while both nuclei and cytoplasm were labeled, the contrast between injured and uninjured was most striking in the nuclear labeling both in the retina as well as in the optic nerve. The difference in the labeling of the optic nerve was particularly noteworthy as the nuclear labeling in that region indicates non-neuronal cells are expressing ATF3. The cells labeled with anti-ATF3 appear to be astrocytes. The ATF3 protein also has been found by immunohistochemical techniques in small numbers of cells in the optic nerve of rats after crush injury (Hunt et al., 2004). Upregulation of ATF3 mRNA transcription in response to injury or other noxious stimuli has been reported in many studies of mammalian neurons. ATF3 is a member of the ATF/CREB family and is a basic region-leucine zipper (bZip) DNA

binding protein that when phosphorylated by protein kinase A (PKA) can homodimerize or heterodimerize with related bZip proteins such as JunB, JunC (a.k.a. c-Jun), JunD, ATF2, CREB2, and CHOP. With respect to initiation of transcription, the homodimer seems to act as a repressor, while the heterodimers appear to be activators (Hai and Hartman, 2001). In a mouse model, constitutive over-expression of ATF3 was found to cause upregulation of Hsp27, c-Jun and SPRR1A in uninjured dorsal root ganglion (DRG) neurons (Seijffers et al., 2007). Hsp27 is a known downstream target of ATF3 in injured DRG neurons (Benn et al., 2002). SPRR1A is a small proline-rich protein upregulated ~60-fold in DRG after peripheral (sciatic) nerve injury, and it has been shown to colocalize with F-actin at the membrane in regenerating growth cones (Bonilla et al., 2002). SPRR1A, c-Jun, and ATF3 all contain functional AP-1 binding regions in their promoters (Cai et al., 2000), which can be recognized by heterodimers of ATF3/c-Jun, causing Seijffers et al. (2007) to speculate that c-Jun and ATF3 regulate each other's production and synergize to enhance neurite outgrowth in regenerating peripheral nerve. Hsp27, c-Jun and SPRR1A were not represented on our microarray; however, qRT-PCR analysis of c-Jun indicated a pattern of expression similar to that seen for ATF3. In other words, c-Jun levels in injured and uninjured retinas was the same at 3 h post-surgery; however, at 24 and 168 h c-Jun levels were significantly higher in injured versus sham-operated retinas and were significantly higher than they were at 3 h (data not shown). Veldman et al. (2007) also reported 10- to 20-fold upregulation of c-Jun in RGCs taken from injured fish based on qRT-PCR analysis. Quantitative RT-PCR analysis was not performed for either Hsp27 or SPRR1A. In DRG neurons elevated cAMP levels act through PKA to allow neurites to overcome the myelin inhibitory factors and grow in the


spinal cord after a dorsal column injury (Neumann et al., 2002; Qiu et al., 2002). As ATF3 is a CREB protein and is activated by phosphorylation by PKA, which in turn is activated by cAMP, one might expect constitutive overexpression of ATF3 to promote spinal nerve regeneration after injury. However, Seijffers et al. (2007) found that while constitutive overexpression promotes regeneration of peripheral nerves from the dorsal root ganglion (DRG), it does not overcome the inhibitory effects of CNS myelin in vitro or in vivo. This finding leads to interesting questions about how a transcription factor's effects are regionalized within a single cell and suggest that downstream signaling elements are key determinants of success in regeneration. By the same token, the upregulation of ATF3 has been observed in both mammalian retinas and optic nerves as well as those of fish, hinting that other differences, for example in the genes that ATF3 activates, must account for the differential ability of animals to regenerate the optic nerve. Future studies will be directed at further elucidation of the role of cAMP in neurons and astrocytes of regenerating nerve tissue, both in fish and mammalian models. We have evidence that cAMP is involved in initiation of the reactive state in vitro in F98 cells, a rat astrocytoma cell line used extensively for studies of reactive astrocytosis (Malhotra et al., 1995; Boran and Garcia, 2007; Ramsey et al., 2005). In vivo, it has been found that cAMP levels normally fall in neurons after axonal injury (axotomy, contusion), and experimental elevation of cAMP by inhibition of phosphodiesterase and injection of dbcAMP can result in axonal regrowth and functional recovery in mice (Pearse et al., 2004). Understanding differences between mammals and fish as well as in vitro and in vivo models could pave the way for enhancing recovery of function in injured patients. Acknowledgements The authors wish to acknowledge the patient help with statistical analysis of the results provided by Dr. Jeff Landgraf at Michigan State University (microarray) and Dr. Floyd Weckerly at Texas State University-San Marcos (microarray and qRT-PCR). Technical assistance with qRT-PCR by Dr. Angela Archer formerly at Eppendorf is also gratefully acknowledged. We acknowledge Dr. Nihal Dharmasiri for use of his dissecting scope and digital camera and Dr. Tim Raabe for his assistance with experimental design, and Mayuri Patel, Amanda Mosier and John Miller for assisting with the surgeries. We thank Ayme Cardwell for her efforts in immunohistochemistry. This study was supported by NSF grants IOB-0615762 to DMG and DBI0821252 to JRK and DMG, a Texas State Research Enhancement Award to JRK, and funds from the Department of Biology and College of Science at Texas State University-San Marcos. References Adida, C., Crotty, P.L., McGrath, J., Berrebi, D., Diebold, J., Altieri, D.C., 1998. Developmentally regulated expression of the novel cancer anti-apoptosis gene survivin in human and mouse differentiation. Am. J. Pathol. 152, 43–49. Attardi, D.G., Sperry, R.W., 1963. Preferential selection of central pathways by regenerating optic fibers. Exp. Neurol. 7, 46–64. Bastmeyer, M., Jeserich, G., Stuermer, C.A., 1994. Similarities and differences between fish oligodendrocytes and Schwann cells in vitro. Glia 11, 300–314. Beisvag, V., Junge, F.K., Bergum, H., Jolsum, L., Lydersen, S., Gunther, C.C., Ramampiaro, H., Langaas, M., Sandvik, A.K., Laegreid, A., 2006. GeneTools–application for functional annotation and statistical hypothesis testing. BMC Bioinformatics 7, 470. Benn, S.C., Perrelet, D., Kato, A.C., Scholz, J., Decosterd, I., Mannion, R.J., Bakowska, J.C., Woolf, C.J., 2002. Hsp27 upregulation and phosphorylation is required for injured sensory and motor neuron survival. Neuron 36, 45–56. Bernhardt, R., 1989. Axonal pathfinding during the regeneration of the goldfish optic pathway. J. Comp. Neurol. 284, 119–134. Bernhardt, R.R., Tongiorgi, E., Anzini, P., Schachner, M., 1996. Increased expression of specific recognition molecules by retinal ganglion cells and by optic pathway glia accompanies the successful regeneration of retinal axons in adult zebrafish. J. Comp. Neurol. 376, 253–264. Bernhardt, R.R., 1999. Cellular and molecular bases of axonal regeneration in the fish central nervous system. Exp. Neurol. 157, 223–240.

181

Bonilla, I.E., Tanabe, K., Strittmatter, S.M., 2002. Small proline-rich repeat protein 1A is expressed by axotomized neurons and promotes axonal outgrowth. J. Neurosci. 22, 1303–1315. Boran, M.S., Garcia, A., 2007. The cyclic GMP-protein kinase G pathway regulates cytoskeleton dynamics and motility in astrocytes. J. Neurochem. 102, 216–230. Braissant, O., Wahli, W., 1998. Differential expression of peroxisome proliferatoractivated receptor-alpha, -beta, and -gamma during rat embryonic development. Endocrinology 139, 2748–2754. Cai, Y., Zhang, C., Nawa, T., Aso, T., Tanaka, M., Oshiro, S., Ichijo, H., Kitajima, S., 2000. Homocysteine-responsive ATF3 gene expression in human vascular endothelial cells: activation of c-Jun NH(2)-terminal kinase and promoter response element. Blood 96, 2140–2148. Cameron, D.A., Gentile, K.L., Middleton, F.A., Yurco, P., 2005. Gene expression profiles of intact and regenerating zebrafish retina. Mol. Vis. 11, 775–791. Cao, Y., Shumsky, J.S., Sabol, M.A., Kushner, R.A., Strittmatter, S., Hamers, F.P., Lee, D.H., Rabacchi, S.A., Murray, M., 2008. Nogo-66 Receptor Antagonist Peptide (NEP1–40) Administration Promotes Functional Recovery and Axonal Growth After Lateral Funiculus Injury in the Adult Rat. Neurorehabil. Neural Repair 22, 262–278. Chen, D.F., Schneider, G.E., Martinou, J.C., Tonegawa, S., 1997. Bcl-2 promotes regeneration of severed axons in mammalian CNS. Nature 385, 434–439. Chiang, T.S., Thomas, R.P., 1972. Consensual ocular hypertensive response to prostaglandin. Invest. Ophthalmol. 11, 169–176. Cho, K.S., Chen, D.F., 2008. Promoting optic nerve regeneration in adult mice with pharmaceutical approach. Neurochem. Res. Cho, K.S., Yang, L., Lu, B., Feng Ma, H., Huang, X., Pekny, M., Chen, D.F., 2005. Reestablishing the regenerative potential of central nervous system axons in postnatal mice. J. Cell Sci. 118, 863–872. Delvaeye, M., De Vriese, A., Zwerts, F., Betz, I., Moons, M., Autiero, M., Conway, E.M., 2009. Role of the 2 zebrafish survivin genes in vasculo-angiogenesis, neurogenesis, cardiogenesis and hematopoiesis. BMC Dev. Biol. 9, 25. Ettl, A.K., Holzschuh, J., Driever, W., 2006. The zebrafish mutation m865 affects formation of dopaminergic neurons and neuronal survival, and maps to a genetic interval containing the sepiapterin reductase locus. Anat. Embryol. (Berl.) 211 (Suppl 1), 73–86. Fausett, B.V., Goldman, D., 2006. A role for alpha1 tubulin-expressing Muller glia in regeneration of the injured zebrafish retina. J. Neurosci. 26, 6303–6313. Garcia, D.M., Koke, J.R., 2009. Astrocytes as gate-keepers in optic nerve regeneration — a mini-review. Comp. Biochem. Physiol. A 152, 135–138. doi:10.1016/j.cbpa.2008.09.026. Goldberg, J.L., Barres, B.A., 2000. The relationship between neuronal survival and regeneration. Annu. Rev. Neurosci. 23, 579–612. Goldberg, J.L., Espinosa, J.S., Xu, Y., Davidson, N., Kovacs, G.T., Barres, B.A., 2002a. Retinal ganglion cells do not extend axons by default: promotion by neurotrophic signaling and electrical activity. Neuron 33, 689–702. Goldberg, J.L., Klassen, M.P., Hua, Y., Barres, B.A., 2002b. Amacrine-signaled loss of intrinsic axon growth ability by retinal ganglion cells. Science 296, 1860–1864. Groszer, M., Erickson, R., Scripture-Adams, D.D., Dougherty, J.D., Le Belle, J., Zack, J.A., Geschwind, D.H., Liu, X., Kornblum, H.I., Wu, H., 2006. PTEN negatively regulates neural stem cell self-renewal by modulating G0–G1 cell cycle entry. Proc. Natl. Acad. Sci. U. S. A. 103, 111–116. Gulati-Leekha, A., Goldman, D., 2006. A reporter-assisted mutagenesis screen using alpha 1-tubulin-GFP transgenic zebrafish uncovers missteps during neuronal development and axonogenesis. Dev. Biol. 296, 29–47. Hai, T., Hartman, M.G., 2001. The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis. Gene 273, 1–11. Hai, T., Wolfgang, C.D., Marsee, D.K., Allen, A.E., Sivaprasad, U., 1999. ATF3 and stress responses. Gene Expr. 7, 321–335. Hannila, S.S., Filbin, M.T., 2008. The role of cyclic AMP signaling in promoting axonal regeneration after spinal cord injury. Exp. Neurol. 209, 321–332. Hu, X., Pandolfi, P.P., Li, Y., Koutcher, J.A., Rosenblum, M., Holland, E.C., 2005. mTOR promotes survival and astrocytic characteristics induced by Pten/AKT signaling in glioblastoma. Neoplasia 7, 356–368. Hunt, D., Hossain-Ibrahim, K., Mason, M.R., Coffin, R.S., Lieberman, A.R., Winterbottom, J., Anderson, P.N., 2004. ATF3 upregulation in glia during Wallerian degeneration: differential expression in peripheral nerves and CNS white matter. BMC Neurosci. 5, 9. Liu, Q., Londraville, R.L., 2003. Using the adult zebrafish visual system to study cadherin2 expression during central nervous system regeneration. Methods Cell Sci. 25, 71–78. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Macdonald, R., Scholes, J., Strahle, U., Brennan, C., Holder, N., Brand, M., Wilson, S.W., 1997. The Pax protein Noi is required for commissural axon pathway formation in the rostral forebrain. Development 124, 2397–2408. Malhotra, S.K., Bhatnagar, R., Shnitka, T.K., Herrera, J.J., Koke, J.R., Singh, M.V., 1995. Rat glioma cell line as a model for astrogliosis. Cytobios 82, 39–51. Matsuura, I., Taniguchi, J., Hata, K., Saeki, N., Yamashita, T., 2008. BMP inhibition enhances axonal growth and functional recovery after spinal cord injury. J. Neurochem. 105, 1471–1479. McWhorter, M.L., Boon, K.L., Horan, E.S., Burghes, A.H., Beattie, C.E., 2008. The SMN binding protein Gemin2 is not involved in motor axon outgrowth. Dev. Neurobiol. 68, 182–194. Muller, A., Hauk, T.G., Fischer, D., 2007. Astrocyte-derived CNTF switches mature RGCs to a regenerative state following inflammatory stimulation. Brain 130, 3308–3320. Neumann, S., Bradke, F., Tessier-Lavigne, M., Basbaum, A.I., 2002. Regeneration of sensory axons within the injured spinal cord induced by intraganglionic cAMP elevation. Neuron 34, 885–893.

182


Park, K.K., Liu, K., Hu, Y., Smith, P.D., Wang, C., Cai, B., Xu, B., Connolly, L., Kramvis, L., Sahin, M., He, Z., 2008. Promoting axon regeneration in the adult CNS by modulation of the PTEN/mTOR pathway. Science 322, 963–966. Pearse, D.D., Pereira, F.C., Marcillo, A.E., Bates, M.L., Berrocal, Y.A., Filbin, M.T., Bunge, M.B., 2004. cAMP and Schwann cells promote axonal growth and functional recovery after spinal cord injury. Nat. Med. 10, 610–616. Pennartz, S., Belvindrah, R., Tomiuk, S., Zimmer, C., Hofmann, K., Conradt, M., Bosio, A., Cremer, H., 2004. Purification of neuronal precursors from the adult mouse brain: comprehensive gene expression analysis provides new insights into the control of cell migration, differentiation, and homeostasis. Mol. Cell. Neurosci. 25, 692–706. Perry, V.H., Lund, R.D., 1990. Evidence that the lamina cribrosa prevents intraretinal myelination of retinal ganglion cell axons. J. Neurocytol. 19, 265–272. Purdey, M., 2001. Does an ultra violet photooxidation of the manganese-loaded/ copper-depleted prion protein in the retina initiate the pathogenesis of TSE? Med. Hypotheses 57, 29–45. Qiu, J., Cai, D., Dai, H., McAtee, M., Hoffman, P.N., Bregman, B.S., Filbin, M.T., 2002. Spinal axon regeneration induced by elevation of cyclic AMP. Neuron 34, 895–903. Ramsey, G., García, D.M., Koke, J.R., 2005. Is reactive astrogliosis regulated by a cAMPdependent CaMK pathway? FASEB J. 19 Abstract 680.13. Raymond, P.A., Barthel, L.K., Bernardos, R.L., Perkowski, J.J., 2006. Molecular characterization of retinal stem cells and their niches in adult zebrafish. BMC Dev. Biol. 6, 36. Ries, A., Goldberg, J.L., Grimpe, B., 2007. A novel biological function for CD44 in axon growth of retinal ganglion cells identified by a bioinformatics approach. J. Neurochem. 103, 1491–1505.

Saito, H., Dahlin, L.B., 2008. Expression of ATF3 and axonal outgrowth are impaired after delayed nerve repair. BMC Neurosci. 9, 88. Schonthaler, H.B., Lampert, J.M., Isken, A., Rinner, O., Mader, A., Gesemann, M., Oberhauser, V., Golczak, M., Biehlmaier, O., Palczewski, K., Neuhauss, S.C., von Lintig, J., 2007. Evidence for RPE65-independent vision in the cone-dominated zebrafish retina. Eur. J. NeuroSci. 26, 1940–1949. Schweitzer, J., Gimnopoulos, D., Lieberoth, B.C., Pogoda, H.M., Feldner, J., Ebert, A., Schachner, M., Becker, T., Becker, C.G., 2007. Contactin1a expression is associated with oligodendrocyte differentiation and axonal regeneration in the central nervous system of zebrafish. Mol. Cell. Neurosci. 35, 194–207. Seijffers, R., Mills, C.D., Woolf, C.J., 2007. ATF3 increases the intrinsic growth state of DRG neurons to enhance peripheral nerve regeneration. J. Neurosci. 27, 7911–7920. Senut, M.C., Gulati-Leekha, A., Goldman, D., 2004. An element in the alpha1-tubulin promoter is necessary for retinal expression during optic nerve regeneration but not after eye injury in the adult zebrafish. J. Neurosci. 24, 7663–7673. Veldman, M.B., Bemben, M.A., Thompson, R.C., Goldman, D., 2007. Gene expression analysis of zebrafish retinal ganglion cells during optic nerve regeneration identifies KLF6a and KLF7a as important regulators of axon regeneration. Dev. Biol. 312, 596–612. Wu, D., Huang, W., Richardson, P.M., Priestley, J.V., Liu, M., 2008. TRPC4 in rat dorsal root ganglion neurons is increased after nerve injury and is necessary for neurite outgrowth. J. Biol. Chem. 283, 416–426.