Activation of genes encoding mitochondrial proteins involved in

ISSN 10214437, Russian Journal of Plant Physiology, 2011, Vol. 58, No. 5, pp. 914–920. © Pleiades Publishing, Ltd., 2011. Original Russian Text © V.N. Popov, A.T. Eprintsev, E.V. Maltseva, 2011, published in Fiziologiya Rastenii, 2011, Vol. 58, No. 5, pp. 758–765.

RESEARCH PAPERS

Activation of Genes Encoding Mitochondrial Proteins Involved in Alternative and Uncoupled Respiration of Tomato Plants Treated with Low Temperature and Reactive Oxygen Species V. N. Popov, A. T. Eprintsev, and E. V. Maltseva Plant Biochemistry and Physiology Department, Voronezh State University, Universitetskaya pl. 1, Voronezh, 394006 Russia; fax:7 (4732) 208755, email: [email protected] Received October 18, 2010

Abstract—Using Realtime PCR, the regulation of gene expression for proteins involved in alternative and uncoupled respiration in tomato (Lycopersicon esculentum Mill.) seedlings and cell culture was studied. The temperature of 4°C activated transcription of these genes. The effect of low temperature on the activities of a number of enzymes involved in oxidative metabolism of seedlings and cultivated cells was detected by spec trophotometric methods. When oxidative stress in tomato cell culture was created by treatments with hydro gen peroxide and antimycin A, it was established that the mRNA levels of the alternative oxidase, the uncou pling protein, and the ATP/ADP antiporter were controlled by ROS, and this may be the mechanism of “free” oxidation induction during cold stress adaptation. Keywords: Lycopersicon esculentum, gene expression, alternative respiratory pathways, reactive oxygen spe cies, antimycin A, hydrogen peroxide. DOI: 10.1134/S1021443711040091

INTRODUCTION Plants respond to cold stress by reorganizing meta bolic and physiological processes for adaptation to new conditions. During this process, cells use more energy and the respiration rate increases [1]. Previously, it has been shown that, in mitochondria from arabidopsis leaves [2], cucumber seedlings [3], and cauliflower fruit [4], cold treatment stimulated cyanideinsensitive respiration due to the induction of alternative oxidase (AO). Recent reports on gene expres sion patterns in young wheat seedlings showed simulta neous expression of the genes for AO, MnSOD, and a number of other enzymes in plants grown at 4°С for 1–3 days. At the above conditions, the activities of the genes for some subunits of the complex I were reduced. Ear lier we have proposed that AO has to be coexpressed with rotenoneinsensitive NADPHdehydrogenases, and in both systems, ROS possibly act as second mes sengers [5]. Wagner showed that Н2О2 may induce the AO gene expression in plant tissues [6]. The AO syn thesis was also activated when plants and yeast were grown in the presence of antimycin A with superoxide radical being a second messenger [7]. One has to note that some damage from the cold stress results specifically from ROS produced by the cell and causing damage at the cellular and subcellular Abbreviations: AO—alternative oxidase; BA—benzyladenine; MDH—malate dehydrogenase; MS—Murashige and Skoog nutrient medium; NBT—nitro blue tetrazolium.

levels [8]. Hydrogen peroxide is sufficiently stable, easily diffuses across the cellular membranes, and is an oxidative stress inducer in plant cells. The rate of ROS production increases when ubiquinone is reduced in the presence of antimycin A [9]. The higher membrane potential and longer ubisemiquinone lifetime stimulate mitochondrial ROS production [10]. Vianello et al. [11] reported the involvement of the ATP/ADP antiporter in fatty acid induced uncoupling in mitochondria of pea stems and sunflower hypocotyls as well. Similar involvement of the ATP/ADP antiporter in uncoupling was shown in potato tuber mitochondria [12]. On the other hand, Vercesi et al. [13] detected the UCPlike mitochon drial protein in potato tissues. It was named PUMP. UCPlike proteins were also identified in mitochon dria of other plants (arabidopsis, tomato, etc.) [13]. Uncoupling at low temperatures was proposed to be an adaptive mechanism both stimulating thermogenesis and lowering the membrane potential and, conse quently, the ROS production rate [14]. Accordingly, our goal was to measure changes in activities of some oxidative metabolism enzymes at low temperatures (4°С), as well as the content of mRNA of the genes for proteins involved in alternative and uncoupled respiration in tomato seedlings and possible ROS involvement in the regulation of these genes in callus culture.

914

ACTIVATION OF GENES ENCODING MITOCHONDRIAL PROTEINS INVOLVED

MATERIALS AND METHODS The work was done on green leaves of 21dayold tomato (Lycopersicum esculentum Mill.) seedlings grown in soil at a 12h photoperiod. To study the effect of low temperature on expression of the genes of inter est, plants were kept at 4°С for 1, 6, or 24 h. Control plants were kept at room temperature. Tomato callus cultures were grown on Murashige and Skoog nutrient medium (MS) supplemented with 2 mg/l BA and 2 mg/l αnaphthylacetic acid (NAA) [15]. Oxidative stress was created by adding 0.1 or 10 mM Н2О2 and 5 or 15 μM antimycin A to the cell cul ture. The enzyme activities were measured with an SF46 spectrophotometer (LOMO, Russia). To obtain enzy matic extracts, plant explants were homogenized in 5 volumes of the extraction buffer composed of 100 mM Tris–HCl, pH 7.5, 4 mM MgCl2, and 2 mM EDTA and centrifuged for 10 min at 5000 g. Aconitase (EC 4.2.1.3) was assayed by the increase in the OD240 due to cisaconitate formation in a colo rimetric solution composed of 100 mM Tris–HCl, pH 8.0, and 50 mM sodium citrate. The cisaconitate molar extinction coefficient was 0.972 × 106/(M cm) [16]. Malate dehydrogenase (MDH, EC 1.1.1.37) activ ity was measured at 340 nm by the rate of the NADH consumption in a buffer composed of 100 mM Tris– HCl, pH 8.0, 1 mM oxaloacetate, 0.2 mM NADH, and 10 mM MgCl2. The molar extinction coefficient used was 6.22 × 106/(M cm) [16]. External NADH dehydrogenase (NADHDH, EC 1.6.5.3) was measured by the rate of NADH consump tion at 340 nm in a buffer composed of 20 mM Tris–HCl, pH 7.4, 0.5 mM MgCl2, 0.12 mM NADH, and 1 mM CaCl2. The molar extinction coefficient used was 6.22 × 106/(M cm) [17]. Catalase (EC 1.11.1.6) was measured in 0.1 M phosphate buffer, pH 6.0, supplemented with 3% hydrogen peroxide by recording oxygen production at 230 nm. The molar extinction coefficient used was 44.5 × 106/(M cm) [16]. To measure peroxidase (EC 1.11.1.7), the increase in OD530 of a benzidine reagent composed of 0.1% benzidine, 6% CH3COONa, 3% CH3COOH, and 50% C2H5OH was measured [18]. The amount of enzyme producing 1 μmol of the product for 1 min at 25°С was taken as a unit of enzyme activity. Superoxide dismutase (SOD, EC 1.15.1.1) was measured at 540 nm according to Chevari et al. [19] in 0.1 M potassium phosphate buffer, pH 7.8, with 0.3 mM EDTA, 0.2 mM nitro blue tetrazolium (NBT), 0.09 mM phenazine methosulfate, and 1.6 mM NADH. The SOD activity was measured according to the following formula: D0 – Ds/D0) × 100%), where D0 is extinction without SOD (null sample) and Ds is extinction of the sample. The unit of the enzyme activity was the amount of the enzyme RUSSIAN JOURNAL OF PLANT PHYSIOLOGY

Vol. 58

915

needed to diminish the optical density during NBT reduction by 50%. MDA measurement is based on the reaction of MDA with TBA (thiobarbituric acid) in acidic condi tions at high temperature that produces a pink trime thyl complex with adsorption maximum at 532 nm. For the measurements, 1 ml of the homogenate and 2 ml of 0.25% TBA and 10% TCA were heated for 30 min at 95°С. After cooling the samples were centri fuged for 5 min at 5000 g and the optical density of the supernatant was measured. The MDA molar extinc tion coefficient was 1.56 × 105 /(M cm) [4]. The quantitative PCR was done with SYBR Green I at Chromo 4 (BioRad, United States). The normal ization was done using the gene for an elongation fac tor ef1α [20]. The primers for ef1α were the forward primer 5'ACAAGATTGGTGGTATTGGAAC3' and the reverse primer 5'GGTGCATCTGGTGCATCT CAACAGACTTS3'. The genespecific primers were designed based on the nucleotide and amino acids alignments of the genes in question from the genomes of species belonging to different taxonomic groups available at GeneBank, Swissprot and pdb by BLAST algorithm, http://www.ncbi.nlm.nih.gov/blast (United States). For the ndb1 gene, the forward primer was 5' CTGATGAATGGTTGCGAGTG3' and the reverse primer was 5'TCATCCTTATCCGCAGCTTT3'. For the nda1 gene the forward primer was 5'TCGT GAAGTTCATCATGCTCAG3' and the reverse primer was 5'ATAGGGAACGTTTGTGCCATCG 3'. For the pump gene the forward primer was 5'TAT TCGCAAGTAGCGCCTTT3' and the reverse primer was 5'ATCCCCTTCAACTGCCTTCT3'. For the aox1α the forward primer was 5'TGTTT TAGGCCATGGGAGAC3' and the reverse primer was 5'ACATCAGTGGGGAAACGAAG3'. For the ant gene the forward primer was 5'CTACTG GAAGTGGTTTGCTG3' and the reverse primer was 5'CATTGAACTGCCTCTCАCCT3'. For the nadp red gene the forward primer was 5'ACTGGTGAT GATGCACCTG3' and the reverse primer was 5' AСAATCТAAGCTTGTGAGGCTT3'. For the sod31 gene the forward primer was 5'СTCТG GСTGGGTGTGGCT3' and the reverse primer was 5'CTТACАTTТTTGTACTGCAАGT3'. The PCR program had the initial denaturing at 95°С for 5 min, then 45 cycles as follows: 95°C for 40 s, 61°C for 40 s, 72°C for 40 s, 72°C for 15 s. Experiments were performed in triplicate. To eval uate the significance of the data, the analysis of vari ance was done. The data were processed using statisti cal criteria. The significant differences at р < 0.05 are discussed [21]. RESULTS The analysis of the effect of low temperature on expression of the nda1 and ndb1 genes coding for an internal and an external rotenoneinsensitive No. 5

2011

916

POPOV et al. (а)

20

5

18 Transcript level, rel. units

(b)

140 120

16 14

100

12

80

10 60

8 6

40

4 2

4

20

6

1 2 3 0 24 Exposure, h

0 0

1

6

0

1

6

24

Fig. 1. Gene expression dynamics in green tomato leaves at low temperature (4°C). In (a) (1) nda1, (2) ndb1, (3) aox1α; in (b) (4) ant, (5) pump, (6) nadfred.

NADPHDH, respectively, in green tomato leaves showed that, after 24 h at 4°С, expression of these genes was 1.8 and 3.3 times higher, respectively, than that in the leaves of the control plants. The control leaves were kept at room temperature (0 h in Fig. 1).The considerable increase in the relative expression of aox1α coding for AO in leaves was observed already in the first hour of the cold treatment. The mRNA level of this gene proved to be over 5 times higher relative to control. By 24 h of cold, it was 17 times higher (Fig. 1a). The analysis of the dynamics of the expression of the ant gene coding for ATP/ADP antiporter showed that, after 6 h at 4°С, its mRNA content was 88 times higher relative to the control, but after 24 h it was merely 18 times higher. And for the pump gene for the uncoupling protein, the significant increase of the rel ative expression was shown: by 6 h it was 11 times higher, and by 24 h at 4°С it was 114 times higher than in control. The analysis of the cold treatment effect on nadpred gene for NADP reductase showed that its transcript level was more than 7 times higher after 24 h of plants incubation at 4°С (Fig. 1b).

The study of dynamics of enzymes activities at low temperature (4°С) revealed a ninefold drop in the activity of aconitase relative to control after 6h incu bation, possibly pointing to a possible ROS accumula tion in the plant cells. The analysis of MDH and NADHDH showed that low temperature for 24 h activated these enzymes 1.2 and 2fold, respectively, relative to control. The study of the enzymes of the cellular antioxidant system showed that peroxidase activity remained at the relatively constant level during 24 h of incubation and catalase activity was even reduced twofold relative to control. After 6 h of tomato plant cooling, SOD activity was 2.1 times higher, and after 24 h 1.4 times higher than in control (Table 1). The changes in the antioxidant enzyme activities together with malfunctions in the mitochondrial res piratory chain may explain the observed early burst in ROS production leading to the oxidative stress [3]. It is known that ROS, namely hydrogen peroxide and superoxide radical, may be key factors regulating gene expression during cold adaptation [8]. To test the pos sible role of ROS in the observed changes in the gene activities, the tomato cell culture was supplemented with hydrogen peroxide and antimycin A, a compound

Table 1. Dynamics of enzymes activities in green tomato leaves at low temperature (4°C) Cold treatment, h

Aconitase, U/mg protein

MDH, U/mg protein

NADHDH, U/mg protein

Catalase, U/mg protein

Peroxidase, U/mg protein

SOD, U/mg protein

0 1 6 24

0.90 ± 0.07 0.20 ± 0.02 0.10 ± 0.01 0.10 ± 0.01

0.85 ± 0.06 0.71 ± 0.01 0.10 ± 0.01 1.02 ± 0.08

0.48 ± 0.01 0.39 ± 0.01 0.39 ± 0.01 0.96 ± 0.03

15.80 ± 1.14 8.38 ± 0.67 9.20 ± 0.60 7.12 ± 0.56

0.92 ± 0.08 0.89 ± 0.07 0.80 ± 0.06 1.10 ± 0.09

2.50 ± 0.16 3.60 ± 0.26 5.30 ± 0.33 3.60 ± 0.24

Notes: n = 3, p < 0.05. RUSSIAN JOURNAL OF PLANT PHYSIOLOGY

Vol. 58

No. 5

2011


917

Table 2. Effects of H2O2 and antimycin A on aconitase activity and MDA accumulation in tomato cell culture after 6 h of incubation Concentration of Aconitase activity, U/mg protein H2O2, mM 0 0.1 10

0.22 ± 0.01 0.07 ± 0.01 0.02 ± 0.01

MDA content, µmol/(mg protein)

Antimycin A con Aconitase activi MDA content, centration, µM ty, U/mg protein µmol/(mg protein)

121.00 ± 3.63 174.00 ± 6.09 252.00 ± 8.57

0 5 15

0.21 ± 0.01 0.06 ± 0.01 0.04 ± 0.01

140.20 ± 4.21 240.30 ± 8.42 246.60 ± 7.64

Notes: n = 3, p < 0.05.

RUSSIAN JOURNAL OF PLANT PHYSIOLOGY

Vol. 58

gen peroxide. The maximal expression of this gene was observed at 0.1 mM Н2О2 (Fig. 2). The study of the expression regulation of the genes involved in alternative and uncoupled respiration in tomato cell culture in the presence of antimycin A by Realtime PCR showed that the presence of 5 μM antimycin A in the cultivation medium led to 4 times higher sod31 expression relative to control. Under these conditions, the aox1α mRNA content grew up more than threefold relative to control. Five micro moles per liter of antimycin A did not considerably affect the ndb1 expression, and this inhibitor concen tration lowered the content of nda1 mRNA. At 15 μM antimycin A, the lower transcript levels were observed for sod31, aox1α, nda1, and ndb1. Antimycin A in the callus cultivation medium also helped to increase mRNA levels of the genes for the respiration uncouplers. Thus, at 5 μM antimycin A, the ant expression was 9 times higher than in controls. However, 15 μM antimycin A did not practically change the expression level of the gene for the 35 Transcript level, rel. units

that causes intracellular generation of superoxide rad ical [7]. Aconitase served a marker of oxidative stress in tomato cell culture (Table 2). This enzyme is inhibited by hydrogen peroxide [22], and suppression of aconi tase activity in plant green leaves at low temperature may result from the development of the oxidative stress. The addition of 0.1 and 10 mM exogenous Н2О2 led to 3 and 10 times lower aconitase activity, respec tively, relative to control after 6 h of incubation. Anal ogously, 5 and 15 μM of antimycin A resulted in 3.5 and 5.2fold enzyme inactivation, respectively, with comparison to control. The presence of 0.1 and 10 mM hydrogen peroxide in the callus culture medium activated lipid peroxida tion with accumulation of its product MDA by 144 and 208%, respectively, with comparison to control. MDA was also accumulated when antimycin A was added to the cultivation medium. Thus, 5 and 15 μM antimycin A elevated MDA level by 70–80% with respect to control (Table 2). The Realtime PCR showed that 0.1 and 10 mM hydrogen peroxide applied for 6 h led to the higher content of nda1, ndb1, aox1a, ant, and pump tran scripts. Growth of tomato callus cultures in the pres ence of 0.1 mM hydrogen peroxide led to a 5fold increase in the aox1α gene expression relative to con trol. The relative expression levels of nda1, ndb1 were not changed at this concentration, whereas 10 mM hydrogen peroxide caused over eightfold increase in the expression of nda1 and aox1α relative to control. The ndb1 expression was not really changed even at 10 mM Н2О2. The presence of 0.1 mM hydrogen peroxide in tomato callus culture medium sharply increased the transcriptional activities of the genes for the proteins involved in alternative oxidation. Thus, the pump and ant transcripts were 3 times higher with 0.1 mM hydrogen peroxide, and the transcripts of the two genes were elevated 30 and 12fold, respectively, in the presence of 10 mM Н2О2 in comparison with con trol. The increase in the transcriptional activity of the sod31 gene for MnSOD also points to the develop ment of the oxidative stress in the presence of hydro

30 25 20 15 10 3

5

4 56

12 0 0

0.1 10 H2O2 concentration, mM

Fig. 2. Effect of hydrogen peroxide on the expression of genes for proteins of alternative and uncoupled respiration in tomato cell culture. (1) nda1, (2) ndb1, (3) aox1α, (4) ant, (5) pump, (6) sod31.

No. 5

2011

918

POPOV et al.

chain performance at low temperature (Fig. 1b). The reducing equivalents produced in this process may be used by the mitochondrial NADPHDH, and the lat ter will reoxidize NADPH and thus let the necessary for thermogenesis uncoupled and alternative respira tory pathways to work. It is known that AO, the plant uncoupling protein, and ATP/ADP antiporter partic ipate in thermogenesis. These enzymes are able to convert the energy of reducing equivalents and of the transmembrane proton gradient into heat.

12

Transcript level, rel. units

10

8

6

4

2 1 2 3 4 5 6 0 0 5 15 Antimycin A concentration, µM

Fig. 3. Effect of antimycin A on the expression of genes for proteins of alternative and uncoupled respiration in tomato cell culture. (1) nda1, (2) ndb1, (3) aox1α, (4) ant, (5) pump, (6) sod31.

ATP/ADP antiporter. For the pump gene, it was shown that 5 and 15 μM of antimycin A increased the mRNA content of this gene 5 and 9fold, respectively, relative to control (Fig. 3). DISCUSSION Earlier, it has been shown that cold stress reduced the content of nda1 and ndb1 transcripts and corre sponding proteins in potato leaves (as measured by antibody assays) and the rate of rotenoneinsensitive NADH oxidation in leaf mitochondria [23]. In this work, activation of the genes for AO and uncoupling proteins was not also observed. The significant activation of the aox1a, ant, and pump genes and some increase in the nda1 and ndb1 mRNA content at 4°С point to the functioning mech anisms helping tomato plants to adapt to low temper ature, possibly futile reoxidation of cellular reducing equivalents without increasing ATP synthesis, and indicate that tomato is a coldresistant species (Fig. 1). The excessive amounts of reducing equivalents elevate the ΔμH+ of the electron transport chain that increases the probability of slowing it down and, as a consequence, help to produce ROS. The activity of the rotenoneinsensitive NADP)HDH allows for oxidation of NADPH providing for normal function ing of plant mitochondria. Stronger expression of the nadpred gene for NADP reductase may indicate the intensification of the chloroplast electron transport

The uncoupling was initially discovered in relation to thermogenesis of warmblooded animals. But later the plant biochemical mechanisms of thermogenesis, mainly the role of AO during Araceae flowering, were also described [14]. In an early work, Lambers (1982, cited after [9]) proposed that the alternative respira tory pathway is intensified when the mitochondrial electron transport pathways are saturated with reduc ing equivalents. But free oxidation was later shown to be an efficient mechanism of protection from ROS [14, 24, 25]. In addition, it is ROS that are the key fac tor of the AO expression [6, 7] and possibly of the uncoupling protein regulation. The activities of the alternative respiratory pathways provide for the pro tection of the mitochondrial electron transport chain, on one hand, by the reduction in ROS production and, on the other hand, by efficient reoxidation of the cel lular pools of oxidizing equivalents, thus preventing blocking NADHdependent processes. Here we showed that the addition of hydrogen per oxide to tomato cell culture causes an increase in mRNA levels of aox1a, ant, and pump that is similar to the increase of them in a coldtreated green plants. It was established [3], that cold causes a significant growth in hydrogen peroxide production rate in plant tissues and it is possible that it is hydrogen peroxide that serves as a second messenger for the induction of not only AO but also the uncoupling proteins. The AO induction has been earlier shown in petunia calli. It should be noted that, in tomato cell culture, the ATP/ADP antiporter was induced at low peroxide concentrations, but at higher Н2О2 concentrations the content of uncoupling protein mRNA grew abruptly. Both of these carriers are capable of fatty acidinduced uncoupling of respiration and oxidative phosphoryla tion during plant cold adaptation [11, 13], but it seems that the constitutively present antiporter is firstly acti vated, and the uncoupling protein gets involved in uncoupling yet when the cell is considerably damaged; thus, in these conditions, aconitase activity was an order of magnitude lower. The addition of antimycin A to cell culture resulted in similar consequences. At 5 μM antimycin A, the aox1α and ant transcript levels were higher, whereas a further increase in the inhibitor concentration increased the pump gene transcript con tent, and the activities of the rest of the genes analyzed were lower, possibly indicating a considerable toxic effect and lower overall mitochondrial activity.


Vol. 58

No. 5

2011


It was not possible to unequivocally conclude about the role of ROS in the NADPHDH gene regulation. Hydrogen peroxide, but not antimycin A, elevated the expression of nda1 coding for internal NADPHDH, but the ndb1 gene activity was not changed. The lower aconitase enzymatic activity and higher content of the lipid peroxidation products in the pres ence of hydrogen peroxide and antimycin A in the cul ture medium indicate the accumulation of ROS in tis sues and, therefore, the oxidative stress development. The higher ROS level in a cell may signal that the mitochondrial electron transport chain is not working optimally, and, to prevent its complete halting and fur ther ROS production, the alternative respiratory path ways are to be activated. A way to do it may be the increase in expression of the corresponding genes. The correlation of expression of genes for alternative respi ratory pathways and for the cellular antioxidant system observed by us shows that, in the conditions of active photosynthesis, the excessive ROS production is pre vented by simultaneously acting mechanisms, with free oxidation of the respiratory substrates being one of them. Our work on the induction expression of the genes for AO, NADPHDH, and the pathways of FA induced respiration uncoupling confirmed the role of these enzymes in protecting tomato plants from low temperatures. In addition, not only AO but also pump and ant genes may be activated by Н2О2 and antimycin A. Thus, both alternative oxidation of the respiratory substrates and uncoupling of oxidation and phospho rylation result in the induction of thermogenesis, reduce the semiquinone lifetime and, therefore, the probability of superoxide production by transporting electron from semiquinone to oxygen [24]. ACKNOWLEDGMENTS This work was partially supported by the Federal Tar geted Program Scientific and ScientificPedagogical Per sonnel of the Innovative Russia (P395, 14.740.11.0114, 14.740.11.0169, and 02.740.11.0097). REFERENCES 1. Semikhatova, O.A., Maintenance Respiration and the Cost of Plant Adaptation, Russ. J. Plant Physiol., 1995, vol. 42, pp. 277–284. 2. Armstrong, A.F., Badger, M.R., Day, D.A., Barthet, M.M., Smith, P.C., Millar, A.H., Whelan, J., and Atkin, O.K., Dynamic Changes in the Mitochondrial Electron Transport Chain Underpinning Cold Accli mation of Leaf Respiration, Plant Cell Environ., 2008, vol. 31, pp. 1156–1169. 3. Szal, B., Lukawska, K., Zdolinska, I., and Rychter, A.M., Chilling Stress and Mitochondrial Genome Rearrange ment in the MSC16 Cucumber Mutant Affect the Alternative Oxidase and Antioxidant Defense System to a Similar Extent, Physiol. Plant., 2009, vol. 137, pp. 435–445. RUSSIAN JOURNAL OF PLANT PHYSIOLOGY

Vol. 58

919

4. Popov, V.N., Albert, C.P., Skulachev, V.P., and Wagner, A.M., StressInduced Changes in Ubiquinone Con centration and Alternative Oxidase in Plant Mitochon dria, BioSci. Rep., 2001, vol. 21, pp. 369–379. 5. Bertsova, Yu.V., Popov, V.N., and Bogachev, A.V., NADH Oxidation by Mitochondria from the Ther mogenic Plant Arum orientale, Biochemistry (Moscow), 2004, vol. 69, pp. 580–584. 6. Wagner, A.M., A Role for Active Oxygen Species as Second Messengers in the Induction of Alternative Oxidase Gene Expression in Petunia hybrida Cells, FEBS Lett., 1995, vol. 368, pp. 339–342. 7. Minagawa, N., Koga, S., Nakano, M., Sakajo, S., and Yoshimoto, A., Possible Involvement of Superoxide Anion in the Induction of CyanideResistant Respira tion in Hansenula anomala, FEBS Lett., 1992, vol. 302, pp. 217–219. 8. Parkin, K.L., Marangoni, A., Jackman, R., Yada, R., and Stanley, D., Chilling Injury: A Review of Possible Mechanisms, Food Biochem., 1989, vol. 13, pp. 127– 153. 9. Popov, V.N., Possible Role of Free Oxidation Processes in the Regulation of Reactive Oxygen Species Produc tion in Plant Mitochondria, Biochem. Soc. Trans., 2003, vol. 31, pp. 1316–1317. 10. Korshunov, S.S., Skulachev, V.P., and Starkov, A.A., High Protonic Potential Actuates a Mechanism of Pro duction of Reactive Oxygen Species in Mitochondria, FEBS Lett., 1997, vol. 416, pp. 15–18. 11. Vianello, A., Petrussa, E., and Macri, F., ATP/ADP Antiporter Is Involved in Uncoupling of Plant Mito chondria Induced by Low Concentrations of Palmitate, FEBS Lett., 1994, vol. 349, pp. 407–410. 12. Popov, V.N., Markova, O.V., Mokhova, E.N., and Skulachev, V.P., Effects of Cold Exposure In Vivo and Uncouplers and Recouplers In Vitro on Potato Tuber Mitochondria, Biochim. Biophys. Acta, 2002, vol. 1553, pp. 232–237. 13. Vercesi, A.E., Martins, I.S., Silva, M.A.P., Leite, H.M.F., Cuccovia, I.M., and Chaimovich, H., PUMP in Plants, Nature, 1995, vol. 375, p. 24. 14. Skulachev, V.P., Role of Uncoupled and NonCoupled Oxidations in Maintenance of Safely Low Levels of Oxygen and Its OneElectron Reductants, Quart. Rev. Biophys., 1996, vol. 29, pp. 169–202. 15. Tsyrenov, V.Zh., Osnovy biotekhnologii: Kul’tivirovanie izolirovannykh kletok i tkanei rastenii (Basics of Bio technology: Plant Cell and Tissue Cultures), Ulan Ude: Vses. Gos. Techn. Univ., 2003. 16. Eprintsev, A.T. and Fedorina, O.S., Functioning of Malate Dehydrogenase System in Mesophyll and Bun dle Sheath Cells of Maize Leaves under Salt Stress Conditions, Russ. J. Plant Physiol., 2007, vol. 54, pp. 728–735. 17. Fomenko, O.Yu., Distribution of Pathways for Free Oxidation of Respiratory Substrates and Regulation of Their Expression in Higher Plant Mitochondria, Cand. Sci. (Biol.) Dissertation, Voronezh: Voronezh. Gos. Univ., 2007. 18. Zemlyanukhin, A.A. and Zemlyanukhin, L.A., Bol’shoi praktikum po fiziologii i biokhimii rastenii (Workshop for No. 5

2011

920

19. 20.

21. 22.

POPOV et al. Plant Physiology and Biochemistry), Voronezh: Voron ezh. Gos. Univ., 1996. Chevari, S., Chaba, I., and Sekei, I., Spectrophotome ter Method for Superoxide Dismutase Determination, Lab. Delo, 1981, no. 11, pp. 678–680. Nicot, N., Hausman, J.F., Hoffmann, L., and Evers, D., Housekeeping Gene Selection for RealTime RTPCR Normalization in Potato during Biotic and Abiotic Stress, Exp. Bot., 2005, vol. 56, pp. 2907–2914. Lakin, G.F., Biometriya (Biometrics), Moscow: Vysshaya Shkola, 1990. Andersson, U., Leighton, B., Young, M.E., Blom strand, E., and Newsholme, E.A., Inactivation of Aconitase and Oxoglutarate Dehydrogenase in Skeletal Muscle In Vitro by Superoxide Anions and/or Nitric

Oxide, Biochem. Biophys. Res., 1998, vol. 249, pp. 512– 516. 23. Svensson, A.S. and Rasmusson, A.G., LightDepen dent Gene Expression for Proteins in the Respiratory Chain of Potato Leaves, Plant J., 2001, vol. 28, pp. 73–82. 24. Skulachev, V.P., Why Are Mitochondria Involved in Apoptosis? Permeability Transition Pores and Apopto sis as Selective Mechanisms to Eliminate Superoxide Producing Mitochondria and Cell, FEBS Lett., 1996, vol. 397, pp. 7–10. 25. Popov, V.N., Simonian, R.A., Skulachev, V.P., and Starkov, A.A., Inhibition of the Alternative Oxidase Stimulates H2O2 Production in Plant Mitochondria, FEBS Lett., 1997, vol. 415, pp. 87–90.


Vol. 58

No. 5

2011