unwinding activity and therefore, we address the possible involvement of a RNA helicase activity during. kRNA editing. INTRODUCTION. The unwinding of RNA ...
4050-4056 Nucleic Acids Research, 1994, Vol. 22, No. 20
\Q- ='), 1994 Oxford University Press
Trypanosoma brucei mitochondria contain RNA helicase activity Andreas Missel and H.Ulrich Goringer* Laboratorium fur Molekulare Biologie - Genzentrum der Universitat Munchen am Max-Planck-Institut fur Biochemie, Am Klopferspitz 18, 82152 Martinsried, Germany Received August 1, 1994; Revised and Accepted August 31, 1994
ABSTRACT Mitochondrial gene expression in kinetoplastid organisms such as Trypanosoma, Leishmania and Crithidia requires a posttranscriptional RNA processing event known as kRNA editing. During editing, uridine nucleotides get inserted and deleted into pre-mRNAs directed by small, metabolically stable RNAs, termed guide RNAs. Although the precise mechanism of the reaction is not understood, the accepted working model describes the formation of extended anti-parallel RNA helices between gRNA molecules with pre- and partially edited mRNAs as intermediates. These duplex structures must be separated to ensure the sequential action of multiple gRNAs in a 3' to 5' polarity on the mRNA molecule. In spite of this fact, no unwinding activity has heretofore been identified in kinetoplastid mitochondria. We report the characterisation of a RNA helicase activity within Trypanosoma brucei mitochondrial extracts. The activity unwinds 25- and 48 bp, tailed RNA duplex structures but fails to separate DNA strands. It can be destroyed by heat denaturation as well as by proteinase K treatment. The activity requires magnesium cations and acts in a NTP/dNTP dependent manner. Hydrolysis of a nucleoside triphosphate is required rather than mere NTP binding as deduced from a comparison of unwinding in the presence of ATP and AMP-PCP. RNA duplexes mimicking presumed kRNA editing intermediates are substrates of the unwinding activity and therefore, we address the possible involvement of a RNA helicase activity during kRNA editing. INTRODUCTION The unwinding of RNA helical secondary structures is a necessary step in a variety of biochemical processes as diverse as mRNA splicing, ribosome assembly, translational initiation and germ line cell differentiation. RNA helicases, the proteins that catalyse RNA unwinding reactions, seem to be ubiquitous. They form a superfamily of evolutionarily conserved polypeptides also referred to as 'DEAD/H box' proteins, based on the presence of a highly conserved 'LDEAD/HXXL' amino acid sequence motif. RNA *To whom
correspondence
should be addressed
helicases utilise energy from the hydrolysis of nucleoside triphosphates to promote the unwinding reaction and enzymes specifying both processivities have been found (reviewed in 1-3). Biochemical control of RNA secondary structure in trypanosomatid mitochondria must be extensive, as gene expression requires, in addition to transcription and translation, an additional RNA processing event termed kRNA editing. Editing completes the sequence information of otherwise cryptic mRNA molecules by inserting and to a lesser extent deleting uridine nucleotides at defined positions within the mRNA's primary sequence (reviewed in 4). The information for this reaction is provided by small, stable mitochondrial DNA transcripts, called guide RNAs (gRNAs). These molecules have an average length of 50-70 nucleotides including a 10-20 nucleotide posttranscriptionally added 3' oligo(U) extension and presumably mediate the editing process via anti-parallel basepairing with the pre- and partially edited mRNA molecules. Some mitochondrial mRNAs, described as pan-edited transcripts (5), require the addition of several hundred U-nucleotides which implies an interaction with various different gRNAs in order to complete the reaction. Studies of partially edited transcripts showed a general 3' to 5' polarity of the editing reaction. As demonstrated for the RPS 12 and ATPase 6 (A6) mRNAs in Leishmania tarentolae, respectively 8 or 6 different gRNAs must hybridise in a sequential order to the pre-, and partially edited mRNAs (6). During this interaction 30-45 bp, anti-parallel duplex structures are formed and only the displacement of a downstream gRNA allows base-pairing of the next, more upstream gRNA molecule. Based on the thermodynamic stability of these helices it seems likely that these stem structures must be actively unwound to ensure the progression of the reaction starting from the 3' end of the pre-edited mRNA. For this reason, we were interested in whether RNA helicase activity could be identified in these organelles especially since no such activity has yet been described in kinetoplastid organisms. We show here that mitochondrial extracts of Trypanosoma brucei do contain RNA helicase activity. Preformed RNA duplexes but not double stranded DNA molecules become unwound when incubated with a low salt, mitochondrial, detergent extract. The reaction is sensitive to heat and predigestion
Nucleic Acids Research, 1994, Vol. 22, No. 20 4051 with proteinase K. In line with characteristic features of this class of enzymes the activity requires the hydrolysis of a nucleoside triphosphate in the presence of magnesium cations. Since guide RNA molecules base-paired to their cognate mRNA seemed to be the preferred substrate in the unwinding reaction the potential role of an RNA helicase during kinetoplastid RNA editing is discussed.
MATERIALS AND METHODS Mitochondria isolation and extract preparation Mitochondrial vesicles were prepared from the procyclic life stage of Trypanosoma brucei strain IsTaR 1.7 (7) according to Harris et al., 1990 (8). All preparations were routinely tested for their ability to perform in vitro transcription (8) as well as for their succinate dehydrogenase activity (9). Low salt detergent extracts of the mitochondrial vesicles were prepared in 6 mM Hepes pH7.5, 30 mM KCl and 0.5 mM DTT with 0.2% (v/v) Nonidet P-40 in the presence of various protease inhibitors (1 yg/ml leupeptin, 0.01% (w/v) phenylmethylsulfonyl fluoride (PMSF), 10 pg/ml bovine trypsin inhibitor). Extracts, prepared in this manner, are competent to form gRNA/pre-mRNA chimeric molecules (10) as well as gRNA specific RNP complexes (11). Protein concentrations were determined in a dye binding assay using bovine plasma gamma globulin as a standard (12). Total T. brucei protein extracts as well as S100 supernatants were prepared by standard methods (13, 14). Preparation of helicase substrates Two different double stranded (ds) RNA substrates were used in this study and were prepared by annealing of partially complementary single stranded (ss) RNA molecules. For the synthesis of RNAI (Fig. IA), pBluescript SK+ plasmid DNA (Stratagene) was linearised with HincH or EcoRI and transcribed using T3 or T7 polymerase respectively, following standard protocols. Only the T7 transcription was performed in the presence of (a-32P)-UTP to yield a uniformly radioactively labelled RNA molecule. RNAII (Fig. iB) is the annealing product of radioactively labelled guide RNA gA6-14 (15), transcribed from XbaI linearised plasmid pBS-gA6-14 as described by Goringer et al., 1994 (11). The complementary 3' domain of the fully edited T. brucei ATPase 6 mRNA was prepared by T7 transcription of EcoRI linearized plasmid p56S which is a derivative of p56, generously provided by J.Bhat and K.Stuart (16). Plasmid p56S was constructed by amplification of a 1 l9nt fragment of p56 DNA using the primer molecules GGGTCGACGATTTTTTGTTGTTTTTG and GGGAATTCGATCTTATTCTATAACTCC. The PCR product which encoded positions 701-805 of the ATPase 6 mRNA (17) was cloned into pBluescriptII (Stratagene) and verified by DNA sequencing. All transcription products were purified on denaturing 6 - 8 % (w/v) polyacrylamide gels, eluted from the gel matrix and ethanol precipitated before resuspension in ddH2O. Annealing of the different complementary RNA transcripts was performed in 10 mM Hepes pH 7.5, 5 mM MgCl2 and 200 mM KCl using 10:1 molar ratios of non-labelled versus radiolabelled transcripts. Samples were denatured at 80°C for 10 min and annealed over a period of 60 min down to 27°C before further purifying the double stranded products on non-denaturing 8% (w/v) polyacrylamide gels.
A dsDNA substrate was prepared from two partially complementary oligodesoxynucleotides 35- and 39 nucleotides long, with primary sequences as shown in Fig. IC. Radioactive labelling of the 39mer (20pmoles) was achieved with T4 polynucleotide kinase (20 U) and 40 ,tCi (-y-32P) ATP (5000 Ci/mmole) in 60 mM Tris-HCl pH 8, 10 mM MgCl2, 15 mM 3-mercaptoethanol and 0.3 ,uM ATP in a final volume of 25 ,ul. Purification of the radiolabelled oligodesoxynucleotide as well as annealing of the two DNA strands were as described above.
RNA helicase assay A standard RNA helicase assay (20 /41) contained 10 fmoles dsRNA combined with 4 Ag T.brucei mitochondrial protein in 5 mM Hepes pH 7.5, 100 mM KCI, 2.5 mM MgCl2, 2 mM DTT, 2 mM ATP, 10 U RNasin, 1 /ig BSA and 5 /sg tRNA. Incubation was done at 27°C, the optimal growth temperature of procyclic stage trypanosomes, for 60 min and reactions were stopped by adding SDS and Na2EDTA pH 8 to final concentrations of 0.4% (w/v) and 4 mM respectively. (Note: RNAII was estimated to be in a 10-50 fold molar excess over endogenous gA6-14 RNA). Samples were separated by nondenaturing PAGE on 8-10% (w/v) gels (acrylamide bisacrylamide = 19:1) followed by autoradiography. Initially an electrophoresis temperature of 4°C was chosen but separations at room temperature were found to be of equal quality. Signals on non-saturated autoradiographs were quantitated by densitometry (Howtek Scanmaster 3, pdi software version 2.2).
Immunoblotting Twenty micrograms of either T. brucei whole cell extracts or T.brucei mitochondrial extracts were separated on 10% (w/v) SDS-polyacrylamide gels and electroblotted onto polyvinylidene difluoride membranes (PVDF, BioRad). Blots were probed with different primary antibodies directed against (i) cyanobacterial heat shock protein 60, hsp60, (Biomol, 1: 1000 dilution) or the E.coli equivalent groEL [(18), 1:1000 dilution], (ii) yeast nucleolar protein 1, NOP1, [(19), 1:500 dilution] or (iii) T.brucei a-tubulin, [(20), 1:5 dilution]. Detection was based on the activation of a chemiluminescent substrate by either alkalinephosphatase- (Stratagene) or horseradish peroxidase-linked (Amersham) secondary antibodies following the manufacturer's directions. Free energy calculations Helix stabilities were calculated using the MFOLD subroutine of the GCG software package based on a free energy minimisation algorithm (21, 22). Calculations were done for a temperature of 27°C.
RESULTS Mitochondrial extracts from T.brucei contain RNA helicase activity In order to test whether T.brucei mitochondria contain RNA helicase activity we prepared low salt, detergent extracts of purified T.brucei mitochondria (11). A potential RNA unwinding activity of these extracts was monitored in a displacement reaction of a radioactively labelled RNA strand from a double stranded RNA substrate, separated on non-denaturing polyacrylamide gels (23, 24). Two different dsRNA substrates were used throughout this
4052 Nucleic Acids Research, 1994, Vol. 22, No. 20 (A) RNA I ("Nor-editing' substrate, 25bp, AG 027 -43.1 kcal/mole) 5'-(N)20 CCCCCCUCGA GG3UCGGU AUCGAUA.GC UUGAUAUCG-3'
3' - CUGCCA UAAG ACUAUAGCU UAAGGACGUC (N) 62 -5'
(B) RNA 1/ (RNA editing substrate, 48bp, AG 027 -52.5 kcal/mole)
5' - (N) 60 UGUUUAGUWU UGUAUUUGAU UUUUGWAGU UAUUUG UUGUUGAAAU kAUUA MAGMA= GACAG U u 3 'vj -fDU
UU
U
UGUU ATUGGAGUUA IAGAAUAAGAU
A GACUA
CG-3'
UCAA
UIU
AUAUACUU AAGCGGG-5'
(C) DNA substrate (25bp, AG 027 -43.1 kcal/mole) 5' -CCTCAC ATAAGTTGk TATW-3' =AG 3'TATTCGA'CT ASAGCTTA.G GACGTCGGG-5'
Figure 1. Structures of RNA helicase substrates. (A) RNA I, the standard 'non-editing' substrate. (B) RNA II, the 'RNA editing' substrate: the upper strand mimics the 3' end of the fully edited Tbrucei ATPase 6 mRNA and the lower strand is guide RNA gA6-14. (C) a synthetic double stranded DNA molecule. Gibbs free energies (AG') were calculated for a temperature of 27°C which is the optimal temperature for procyclic stage trypanosomes and was used as the incubation temperature for the unwinding reaction. In all three cases (A to C) the lower strand of the ds nucleic acid molecule was radioactively labelled. Double helical regions are boxed and base pairs are abbreviated by bp.
study: Firstly, a 25 base-pair (bp) duplex structure (AG027 = -43 kcal/mole), termed RNAI, with 5' single stranded (ss) extensions 73- and 34 nucleotides long (Fig. lA). The second molecule, RNAII, was the annealing product of a specific T.brucei guide RNA, gA6-14 (15), hybridised to the fully edited 3' end of its cognate mRNA. The resulting helix is 48 bp in length and has a free energy (AG027) of -53 kcal/mole (Fig. LB). The substrate mimics a dsRNA molecule which potentially forms upon complete editing of the 3' most editing domain of T.brucei ATPase 6 (A6) mRNA (15, 17). Addition of only small quantities (0.5 -1.0 itg) of mitochondrial protein extract to 10 fmoles of RNAI was able to initiate unwinding of the 25 bp helical structure (Fig. 2). At approximately 8-10 IAg extract the reaction reached a level of 55-60% unwinding which could not be increased upon adding additional protein. Unwinding of the same amount of RNAII started with as little as 0.2 Itg mitochondrial protein and reached completion (95 % displacement), at only 1.0 ig extract (Fig. 3). This difference is even more dramatic if one considers the increased length of the duplex (48 bp vs. 25 bp) as well as the higher predicted thermodynamic stability of RNAII (-53 kcal/mole vs. -43 kcal/mole). Unwinding activities of different independent extract preparations were estimated to vary in a range of + 10%, however, the difference between the two dsRNA substrates was not affected by this variation. Kinetic analysis of the helicase activity A time course of the unwinding of the RNAI substrate in the presence of 4 ,ug extract showed a steady increase of the displacement reaction over time with half the input dsRNA unwound at approximately 40 min at 27°C. Complete displacement was achieved at >90 min and no spontaneous unwinding was found over the same period without the addition of extract (Fig. 4). Similar to the extract titration experiment shown above, the RNAII molecule behaved as a much better
A
mt
extract
I
oc
- ds
-
Ss
~~~~~~U---
/ B
i2~~~~~~~~~ r2
protein
conc./ug
Figure 2. Extract titration of RNAI. Unwinding was tested over a period of 30 min with 10 fmoles RNAI and increasing amounts of mitochondrial (mt.) extract (0.5, 1, 2, 4, 6, 8, 10, 12.5, 15 and 20 Ag from left to right). Panel A shows the autoradiograph of the experiment and its quantification is presented in panel B. The electrophoretic mobility of the double stranded input molecule is annotated with 'ds' and 'ss' stands for single stranded. A control sample ('mock') was treated identically throughout the entire experiment with no mt. extract added. A heat denatured sample (95'C) of the input RNAI molecule is shown on the right.
Nucleic Acids Research, 1994, Vol. 22, No. 20 4053 A
A
Mt. extract
time/mmn
c?C
4
t*.
14f
0 -.Mmmmm..
-ds -
M z:
ds
-ss
B A6.. .. :.
j .,.- i..m
A,""
v
- gA6-74
80
-
U
60 -
B -
S
3
60-
_-
_
IU
/
0: . 0
a 30 0 1ww 0
/
20 -
M._, _
to 90 .!
U
40-
C
120-
'U
20
40
60
80
1 00
timel/m in I
2
I
4
6
8
protein
10
1 2
conc.lug
Figure 3. Extract titration of RNAII. The experiment was performed with 0.2, 0.5, 1, 2, 4 and 10 Ag mitochondrial protein (left to right) using 10 fmoles of RNAII. Incubation was at 27°C for 60 min. Annotations are as in the legend to Fig. 2. The released guide RNA from the input dsRNAII molecule is marked as gA6-14.
substrate. Unwinding was detectable within 90 sec of the addition of mitochondrial protein (4 ,ug) and was completed in around 20 min at 27°C (Fig. 5). Under those conditions 50% unwinding was achieved roughly 6 - 8 times faster for RNAII when compared to RNAI.
Specificity of the unwinding reaction The exclusive unwinding specificity for dsRNA was demonstrated by testing a double stranded DNA molecule as a substrate. Two complementary single stranded DNA molecules were annealed resulting in a 25 bp duplex structure (AG027 = -43 kcal/mole) with 5' single stranded extensions 14- and 10 nt long (see Fig. IC). Using identical assay conditions as for the two RNA duplex molecules, the DNA substrate could not be unwound by the mitochondrial protein extract thereby excluding a promiscuous DNA helicase as the active enzyme (data not shown). Heat denaturation (5 min at 95°C) of the mitochondrial extract (Fig. 6A) or preincubation with proteinase K (data not shown) completely abolished the helicase activity and indicated that the catalytic activity was mediated by a polypeptide. Furthermore, in line with results from previously characterised RNA helicases (25, 26), unwinding was dependent on the presence of magnesium cations and ATP. The chelation of Mg2+ or the omission of the nucleoside triphosphate from the incubation mix led to a total
Figure 4. Time course of RNAI duplex unwinding. Unwinding reactions were carried out as described in the Materials and Methods section with 10 fmoles RNAI and 4,ug mitochondrial protein for times between 1-90 min. Panel A shows the autoradiograph of the experiment which was quantified as shown in panel B.
inhibition of the reaction (Fig. 6A). This also indicated that the intra-vesicular ATP concentration was not sufficient to stimulate the reaction. ATP could be replaced by any of the three other standard ribonucleoside triphosphates as well as all four standard dNTPs (Fig. 6A). A comparison of the concentration dependence of that effect demonstrated that GTP was the most effective nucleotide cofactor. At a concentration of 0.2 mM, GTP was 10-40 times more effective in stimulating unwinding when compared to ATP, CTP or UTP (Fig. 6B). At 2 mM this difference was still apparent, although less pronounced and interestingly, at that concentration, ATP was approximately 30% less active than GTP. A similar trend was found for the four desoxyribonucleoside triphosphates. At concentrations of 2 mM, all four dNTP's were capable to stimulate the displacement reaction to a similar degree. However, at a 10-fold lower concentration, dGTP was 5-30 times more effective in promoting helix unwinding when compared to dATP, dCTP and dTTP (Fig. 6B). RNA unwinding and ATP hydrolysis RNA helicases not only require binding but also nucleotide cofactor hydrolysis for the unwinding reaction (3). In line with this criterion, the substitution of ATP with the non-hydrolysable derivative adenosine-5'-(3, -y-methylene triphosphate (AMP-PCP), resulted in a complete blockage of helix unwinding. AMP had the same effect and in both cases the input substrate accumulated as high molecular weight complexes in the wells of the gel (Fig.
4054 Nucleic Acids Research, 1994, Vol. 22, No. 20 &
time/mi
--
ds
l --gA6-14
1. A
B *
--
., ,,. ':
'-mmum
I
ZA
-?C, !-'
m
-fl
-tl
.E
3t c I
a
ATP
GTP
C
-1;
CTP
-i
E: urp
2 L. j '.
I
-j-i 2
F
An-
Figure 5. Time course of RNAII duplex unwinding. Reaction times were varied between 1-45 min using the standard helicase assay conditions. Four micrograms mitochondrial protein extract were used to unwind 10 fmoles RNAII. Please note the appearance of two additional annealing products, with higher electrophoretic mobility than the top band, marked as 'ds'. These molecules even appeared after gel purifying product 'ds' (see Materials and Methods section), indicating an equilibrium between the various forms. The most likely explanation for these different forms are alternative foldings of the single stranded overhangs of the ds annealing product. Clearly, all three molecules could be unwound by the RNA helicase activity as indicated by the disappearance of the different bands upon increasing incubation times. Annotations are as in the legends to Fig. 2 and 3.
7). In contrast, 2 mM ADP was capable to promote helix unwinding, indistinguishable from the effect mediated by the triphosphate (Fig. 7).
Testing the mitochondrial location of the helicase activity Because RNA helicase activities have been localised in the nucleus as well as the cytoplasm (3, and references therein), it was important to determine whether our mitochondrial vesicle preparations were essentially free of contaminating polypeptides from either of these two cell compartments. The absence of nuclear contamination was monitored in an immunoblot analysis using an antibody directed against the highly conserved yeast nucleolar protein NOP1 (19). As anticipated, the antibody was able to cross-react with two polypeptides (35-40 kD) in T.brucei whole cell extracts but failed to identify the same proteins in mitochondrial extracts (data not shown). In contrast, antibodies directed against the mitochondrial matrix protein hsp60 (18, 27), resulted in positive signals in both preparations and additionally demonstrated the enrichment of the polypeptide in the mitochondrial extract (data not shown). Cytosolic contaminants
NT
P/mMA
dATP
dGTP
B dCTP
-S
:3 dTTP
c
{::
~~~~~~~~~~~2 dNTP/mAo
Figure 6. Requirements for RNA helicase activity. (A) Reaction mixtures with 10 fmoles RNAII and 4 Ag mitochondrial extract were incubated at 270C for 60 min. Standard unwinding conditions contained 2 mM ATP and 2.5 mM MgCI2. Lanes -ATP and -Mg2+ show reactions set up without ATP or lacking magnesium cations (incubation was performed in the presence of 10 mM Na2EDTA pH 8). ATP (2 mM) was substituted by the same concentration of either GTP, CTP, UTP or dATP, dGTP, dCTP and dTTP as indicated. A control reaction lacking the mitochondrial extract is shown in lane 'mock' and 'ss' shows the electrophoretic mobility of gA6-14. In lane 'de' the mitochondrial extract was heat denatured (5 min at 95°C) prior to the addition to the unwinding mix and '950C' annotates a heat denatured sample of the input RNAII molecule. (B) Quantitation of the NTP/dNTP (upper panel/lower panel) requirement of the unwinding reaction. The release of gA6-14 from the annealed RNAII input molecule was quantitated by densitometry and plotted as a function of the NTP/dNTP concentrations. Annotations are as in the legends on the right. Note: the lower intensity of the signal in the lane 'mock' relative to the same signal in figure 5 is due to a shorter exposure time.
calculated by assaying for the presence of cytosolic ribosomal RNAs and were usually c 10% (11). Lasdy, at our standard assay conditions, the addition of high S100 whole cell protein quantities (20 ,tg) were not able to initiate unwinding, whereas 0.5 ,^g of the mitochondrial extract was sufficient to completely unwind the input duplex RNA (data not shown). were
Nucleic Acids Research, 1994, Vol. 22, No. 20 4055 c
i * Ci' cj AZk -Q. 'o,
e 4. v .. .. --wlS~
-~
~
A. k'Q
'O., t
v l | ~~~~~
-ds n,
I
::
_
_
-gA6-14
Figure 7. RNA dependent NTPase activity. Standard reactions were set up with RNAII as a substrate using 2 mM concentrations of either ATP, ADP, AMP or AMP-PCP. Annotations are as in the legends to Fig. 2 and Fig. 3. Please note the appearance of high molecular weight complexes within the wells of the gel (arrow) in those cases where RNAII could not be unwound. Note: the higher intensity of the signal in the lane 'mock' relative to the same signal in figure 3 is due to a longer exposure time.
DISCUSSION Using a RNA unwinding assay based on the different electrophoretic mobility of single stranded versus double stranded RNA molecules (23, 24) we were able to demonstrate the presence of RNA helicase activity in detergent extracts of T.brucei mitochondria. The catalytic activity is heat labile and could also be destroyed by a preincubation of the protein extract with proteinase K. This indicates that the reaction is very likely mediated by a polypeptide, although we cannot rule out that more than one enzyme might account for the observed activity. In line with characteristic features of RNA helicases from other systems the unwinding reaction requires millimolar concentrations of ATP as well as magnesium cations. ATP can be replaced by any of the three other standard nucleoside triphosphates and also by the four standard desoxynucleoside triphosphates. This is not surprising since helicases have been found to be promiscuous with respect to their nucleoside triphosphate requirement (25, 26, 28). The unwinding activity not only required binding but also hydrolysis of the nucleoside triphosphates. Interestingly, ADP was capable of promoting unwinding to the same extent as ATP. This might indicate either that the enzyme does not distinguish between the hydrolysis of a 'y- or,B-phosphate group or that a disproportionation reaction (2ADP -ATP + AMP) provides the necessary nucleoside triphosphate under these conditions. Surprisingly, helicase activity was stimulated the most by GTP and dGTP. This might reflect a higher binding constant of the enzyme for these two triphosphates although differences in the intra-organellar concentrations and thus availability of the four nucleoside triphosphates might be the determining factor within the mitochondria. Currently, we can only speculate as to the function of the unwinding activity. Since it was clearly of mitochondrial origin and specific for exclusively double stranded RNA substrates
(DNA helices could not be unwound) any mitochondrially located biochemical reaction that requires RNA unwinding is a likely candidate. A participation during protein biosynthesis has to be considered in line with the finding that the archetype RNA helicase, eIF-4A, is a translation initiation factor (3, 24). Although mitochondrial protein biosynthesis in trypanosomatids is not well studied, based on the available antibiotic inhibition data, the likelihood for it being a eukaryotic type of translation seems to be rather low (29) and therefore a specific involvement of the helicase activity during translation initiation does not seem very probable. An involvement in ribosomal RNA processing and/or ribosome biogenesis is more likely, similar to the assumed function of the E. coli SrmB protein (30) or the SUV3-1 gene product in yeast (31). We have not tested whether DNA/RNA hybrid molecules can be unwound but feel that a participation during priming steps of mini- and/or maxicircle transcription should, per se, not be excluded (32, 33). An involvement in splicing-type reactions (34, 35) can be excluded since cis-splicing seems to be totally absent in kinetoplastid organisms and trans-splicing has been shown to occur only outside of the mitochondrial organelle (36). Similarly, modification/unwinding type of activities, as described by Bass and Weintraub (37, 38), can be ruled out as they do not require nucleotide co-factors and magnesium cations. Lastly, an involvement in kRNA editing has to be considered. The reaction presumably uses guide RNAs, as templates, which are thereby engaged in base-pairing interactions with the mRNA molecules. Upon completion of the editing reaction, gRNAs and the complementary mRNA regions form double stranded intermolecular hybrids 30-45 bp in length. The thermodynamic stabilities of these helices are in a range of > -50 kcal/mole which makes it very unlikely that unwinding is diffusionally controlled. A further argument for an active unwinding of the gRNA/mRNA duplex structures comes from the observation that RNA editing proceeds with a 3' to 5' directionality (6). As a consequence, a 3' editing domain must be completed first before the next gRNA molecule can hybridise to its target region. Thus, the unwinding and release of a downstream gRNA is a required step for the association of the next upstream gRNA molecule. We have tested a gRNA/edited mRNA hybrid molecule (RNAII) in our unwinding assay. Interestingly, this 48 bp helix was a much better helicase substrate when compared to RNAI, a 'non-editing' 25 bp stem structure. Although the 'editing-helix' was almost twice as long as RNAI and also thermodynamically more stable by -10 kcal/mole, unwinding was significantly faster (6-8 times) and also required less protein for the displacement reaction. This difference might simply be a consequence of the structural differences of the two substrates, for instance the length of the single stranded extensions or the G/U content but it could also reflect an enhanced specificity of the helicase activity for kRNA editing substrates. Whether the reaction is mediated simply by the binding of the enzyme to its substrate or the enzyme's participation in a larger complex, cannot be deduced from the experiments presented here. However, the addition of the non-hydrolysable ATP analogue AMP-PCP or AMP resulted in the accumulation of one or more large complexes that were not capable of entering the gel matrix (see Fig. 7). A similar result was obtained for the RNA unwinding activity of eIF-4A (24). Accumulation of high molecular weight RNPs was a result of inhibiting the disassembly of unwinding complexes by blocking NTP hydrolysis. Circumstantial support
4056 Nucleic Acids Research, 1994, Vol. 22, No. 20 for the helicase activity being a component of a large size complex comes from the finding that gRNAs within mitochondria are assembled in the form of ribonucleoprotein complexes (39-41, 11). Some of these complexes also contain pre-edited mRNAs and several enzymatic activities such as terminal uridylyltransferase and RNA ligase. If these complexes, as suggested, are related to the active editing machinery, termed the 'editosome' (42-44), it seems likely that a RNA helicase activity can be part of such a multicomponent complex. In conclusion, we have identified a RNA unwinding activity in mitochondrial extracts of Trypanosoma brucei. We propose that the different unwinding efficiency of the two tested RNA molecules reflects a defined substrate specificity of the helicase for RNA editing substrates and believe that this feature should be helpful for purifying and further characterising the enzyme.
ACKNOWLEDGEMENTS We wish to thank K.Stuart and G.Riley for communicating results prior to publication and J.Bhat for plasmid p56. A.Paul, B.Schmid, G.Norskau, H.H.Shu, A.Souza, J.K6ller, U.Miiller are thanked for helpful discussions and critical reading of the manuscript. We are grateful to M.Nador and R.Schroder for secretarial help. Antibodies were generously provided by E.C.Hurt (anti-NOP 1), T.Langer and W.Neupert (anti-groEL) and K.Gull (anti-oa-tubulin). This work was supported by the German ministry for research and technology (BMFT) and the German research foundation (DFG).
REFERENCES 1. Schmid, S.R. and Linder, P. (1992) Mol. Microbiol. 6, 283-291. 2. Gorbalenya, A.E. and Koonin, E.V. (1993) Current Opinion in Structural Biology 3, 419-429. 3. Fuller-Pace, F.V. and Lane, D.P. (1992). In RNA Helicases. Nucleic Acids and Molecular Biology, Vol. 6 eds.: Eckstein, F. and Lilley, D.M.J., pp. 159-173. 4. Hajduk, S.L., Harris, M.E. and Pollard, V.W. (1993) FASEBJ. 7,54-63. 5. Simpson, L. and Shaw, J. (1989) Cell 57, 355-366. 6. Maslov, D.A. and Simpson, L. (1992) Cell 70, 459-467. 7. Stuart, K., Gobright, E., Jenni, L., Milhausen, L.M., Thomashow, L. and Agabian, N. (1984) J. Parasitol. 70, 747-754. 8. Harris, M.E., Moore, D.R. and Hajduk, S.L. (1990) J. Biol. Chem. 265, 11368-11376. 9. Pennington, R.J. (1961) Biochem. J. 80, 649-654. 10. Koslowsky,D.J., G&inger,H.U., Morales,T.H., and Stuart,K. (1992) Nature, 356, 807-809. 11. G6ringer, H.U., Koslowsky, D.J., Morales, T.H. and Stuart, K. (1994) Proc. Natl. Acad. Sci. USA 91, 1776-1780. 12. Bradford, M.M. (1976) Anal. Biochem. 72, 248-254. 13. Maizels, R.M., Baxter, M.L., Robertson, B.D. and Sekirk, M.E. (1991). In Parasite antigens and parasite genes, a laboratory manual for molecular parasitology. p.4. 14. Cross, M., Giinzl, A., Palfi, Z. and Bindereif, A. (1991) Mol. Cell. Biol. 11, 5516-5526. 15. Koslowsky, D.J., Riley, G.R., Feagin, J.E. and Stuart, K. (1992) Mol. Cell. Biol. 12, 2043-2049. 16. Koslowsky, D.J., Bhat, G.J., Read, L.K. and Stuart, K. (1991) Cell 67, 537-546. 17. Bhat, G.J., Koslowsky, D.J., Feagin, J.E., Smiley, B.L. and Stuart, K. (1990) Cell 61, 885-894. 18. Hemmingsen, S.M., Woolford, C., van der Vies, S.M., Tilly, K., Dennis, D.T., Georgopoulus, C.P., Hendrix, R.W. and Ellis, R.J. (1988) Nature 333, 330-334. 19. Schimmang, T., Tollervey, D., Kern, H., Frank, R. and Hurt, E.C. (1989) EMBO J. 8, 4015-4024.
20. Woods, A., Sherwin, T., Sasse, R., MacRae, T.H., Baines, A.J. and Gull, K. (1989) J. Cell Sci. 93, 491-500. 21. Devereux, J., Haeberli, P. and Smithies, 0. (1984) Nucl. Acids Res. 12, 387-395. 22. Zucker, M., Jaeger, J.A. and Turner, D.H. (1991) Nucl. Acids Res. 19, 2707-2714. 23. Hirling, H., Scheffner, M., Restle, T. and Stahl, H. (1989) Nature 339, 562-564. 24. Jaramillo, M., Dever, T.E., Merrick, W.C. and Sonenberg, N. (1991) Mol. Cell. Biol. 11, 5992-5997. 25. Shuman, S. (1992) Proc. Natl. Acad. Sci. USA 89, 10935-10939. 26. Lee, C.G. and Hurwitz, J. (1992) J. Biol. Chem. 267, 4398-4407. 27. Koll, H., Guiard, B., Rassow, J., Ostermann, J., Horwich, A.L., Neupert, W. and Hartl, F.-U. (1992) Cell 68, 1163-1175. 28. Claude, A., Arenas, J. and Hurwitz, J. (1991) J. Biol. Chem. 266, 10358-10367. 29. Spithill T. W., Shimer, S.P. and Hill, G. C. (1981) Mol. Biochem. Parasit. 2, 235-255. 30. Nishi, K., Morel-Devile, F., Hershey, J.W.B., Leighton, T. and Schnier, J. (1988) Nature 336, 496-498. 31. Stepien, P.P., Margossian, S.P., Landsman, D. and Butow, R.A. (1992) Proc. Natl. Acad. Sci. USA. 89, 6813-6817. 32. Ntambi, J.M., Shapiro, T.A., Ryan, K.A. and Englund, P.T. (1986) J. BioL Chem. 261, 11890-11895. 33. Rohrer, S.P., Michelotti, E.F., Torri, A.F. and Hajduk, S.L.(1987) Cell 49, 625-632. 34. Sdraphin, B., Simon, M., Boulet, A. and Faye, G.(1989) Nature 337, 84-87. 35. Ruby, S. and Abelson, J. (1991) TIG 7, 79-85. 36. Agabian, N. (1990) Cell 61, 1157-1160. 37. Bass, B.L. and Weintraub, H. (1987) Cell 48, 607-613. 38. Bass, B.L. and Weintraub, H. (1988) Cell 55, 1089-1098. 39. Pollard, V.W., Harris, M.E. and Hajduk, S.L. (1992) EMBO J. 11, 4429-4438. 40. Read, L.K., Goringer, H.U. and Stuart, K. (1994) Mol. Cell. Biol. 14, 2629-2639. 41. Peris, M., Frech, G.C., Simpson, A.M., Bringaud, F., Byrne, E., Bakker, A. and Simpson, L. (1994) EMBO J. 13, 1664-1672. 42. Stuart, K. (1989) Parasitology today 5, 5-8. 43. Benne, R. (1989) Biochim. Biophys. Acta 1007, 131-139. 44. Simpson, L. (1990) Science 250, 512-513.
