Page 1. random pairs unitary pseudogene and protein-coding ortholog. â1.0. â0.5. 0.0. 0.5. 1.0 pearson correlation coeficient.
Additional file 1 Validation work for eIF4A3, PDI, Hsp70, and PP2A. Supplementary Figure Legends. Figure S1. Knockdown of eIF4A3 did not affect cell viability ...
A Detected superdomains and cooperative domains in DIP data by APMM. Table I: .... The domain names are labeled by the same color as in the Pfam domain ...
If the person decides to seek professional help, the first aider should encourage them to take a support person to their appointment. 1. As far as possible, the first ...
Additional file 1: Gene expression profiling analysis. ... Su AI, Wiltshire T, Batalov S, Lapp H, Ching KA, Block D, Zhang J, Soden R, Hayakawa M, Kreiman G, ...
Additional file 4. Control of the ... YFPC fragment) and on the top (fusions with the YFPN fragment), together with a âplastidâ-CFP marker. The co- transformation ...
Homo sapiens transmembrane 4 L six family member 1 (TM4SF1), mRNA. [NM_014220]. 1.486. SCAMP5. Homo sapiens secretory carrier membrane protein 5 ...
the University of New South Wales. 4 Gender ... discussed by BHR and LK and by 14 interviews new ... free coded to identify different or emergent themes or.
Sydney, NSW Department of. Health. 3. Booth ML ... Sydney, NSW Ministry of Health. 8. Hardy LL, King L, ... Get skilled: Get active. A K-6 resource to support.
We call Figure S1C. PCA-position profile. ..... Figure S5. Correlation ... International Conference on Genome Informatics 2003, 14:84-93. 5. Cheng Y, Miura RM, ...
Intervention delivery via Aboriginal Community Controlled Health Services compared ... services. 36%of all urban consults,. 23% rural, 15% remote. Composite.
One input file with the extension 'snpe' for p-values is required. ... In the above file, column 1 is the marker name, column 2 is the chromosome number, column 3.
Organisational aspects (password availability, access to computers). 3. What could be done ... connection, passwords, usability of the website. 2. What could be ...
the Upper Kapuas. Lakes System. Peat. Fauna Flora International,. Macquarie Bank http://karbon- redd.blogspot.com/2009/08/redd-projects- in-indonesia.html. 2.
modules have also been published on the Drupal project website when we consider .... A query builder that allows users to create flexible and dynamic views of ...
Page 1. Additional file 3: Table S3.
server's memory requirements below 2 GB (see methods). A disadvantage of .... time for a complete oligo library from several weeks to several hours on our dedicated. MySQL server .... downstream tools for their custom needs. Some example ...
Healthy Ontario website. 15. Physical Activity ... Heart and Stroke Foundation of Ontario website. 23. Walk This Way. 1. ... Promotion (CWHP) Project. 6. Ontario ...
2. List of genes that are predominantly expressed in mammalian testicular cells considered for the analysis: DAZL,. Vim, Sycp1, PUM2, Tex101, DPPA3, PRM2, ...
Additional file 8 | Bisulfate converted primers used in HRM. Genes. Forward. Reverse. Annealing (oC) Marker (Kb)*. FUCA1. TCGGTGTTAGGTTAGTGCGTAG.
Additional file 8 | Bisulfate converted primers used in HRM Genes FUCA1 PCDHAC1 RUFY3
Forward TCGGTGTTAGGTTAGTGCGTAG GCGTTAGCGAGGTGGGTAGTT TGAAAAGGGTAGATGTCGTATTGA TTGTTAAAGTGTAGGACGGGGTT TXNDC16 G * Distance to genetic marker either for RJF or WL allele
