Jul 30, 1996 - using a Quick Capture (Data Translation Inc. Marlboro M A ) frame grabber board and NIH ... from zippy.nimh.nih.gov or on floppy disk from NTIS, 5285. Port Royal Rd. ..... We were able to recover trans- formants of gk7-135 in ...
Copyright 0 3997 by the Genetics Society of America
Alanine-Scanning Mutagenesisof Protein Phosphatase Type 1 in the Yeast Saccharomyces cerhsiae Stefanie H. Baker,"" Debra L. Frederick,+Andrew Bloeched and Kelly Tatchellt *Department of Microbiology, North Carolina State University, Raleigh, North Carolina 27695 and tDepartment of Biochemistry and Molecular Biology, Louisiana State University Medical Center, Shreveport, Louisiana 71130 Manuscript received July 30, 1996 Accepted for publication November 18, 1996
ABSTRACT Protein phosphatase type 1, encoded by GLC7 in Saccharomyces cerwisiae, is an essential serine/threonine phosphatase implicated in the regulation of a diverse array of physiological functions. We constructed and examined 20 mutant alleles of GLC7 in which codons encoding clusters of charged residues werechangedto alanine codons. Three of 20 mutant alleles alter residues in theactive site of the phosphatase and are unable to rescue the lethality of a glc7::LEU2 disruption. The17 allelesthat support growth confer a range of mutant traits including cell cycle arrest, 2-deoxyglucose resistance, altered levels of glycogen, sensitivity to highsalt, and sporulation defects. For some traits, such as 2deoxyglucose resistance and cell cycle arrest, the mutated residues map to specific regions of the protein whereas the mutated residues in glycogen-deficient mutants and sporulation-defective mutantsare more widely distributed over the protein surface. Many mutants have complex phenotypes, each displaying a diverse range of defects.Thewiderangeofphenotypesidentifiedfromthecollectionof mutant alleles is consistent with the hypothesis that Glc7p-binding proteins,which are thought to regulate the specificity of Glc7p, have overlapping binding sites on the surfaceof Glc7p. This could account for the high level of sequence conservation found among type 1 protein phosphatases from different species.
P
ROTEIN phosphatase type 1 (PPl) is an abundant phosphoserine/threonine phosphatase that participates in physiological pathways ranging from glycogen regulation and muscle contractility to ion channel regulation and cellcycle control (BOILEN and STAL MANS 1992; SHENOLIKAR 1994). The enzyme is highly conserved, exhibiting over 80% amino acid identity between yeast and mammals. Conservation extends to the functional level where the enzyme has a role in glycogen biosynthesis in mammals and the budding yeast Saccharomyces cermisiae and cell cycle control in mammals, Drosophila, Aspergillus, Schizosaccharomyces pombe and S. cmeuisiae. Additional physiological roles for yeast PP1 in sporulation and glucose repression are implied from the phenotypes conferred by mutations in glc7, the gene encoding PPI in budding yeast. PPI exhibits little substrate specificity in vitro. It has beenproposedthat specificity is in partdictated by regulatory subunits that target the catalytic subunit to its site of activityand/or regulate its substrate specificity ( COHEN and COHEN 1989). The paradigm for this regulatory mechanism is the glycogen-binding subunit from skeletal muscle. Phosphorylation of this subunit in response to insulin induces its association with PP1 (DENT et al. 1990). Thecomplex has increased activity toward Corresponding author: Kelly Tatchell, Department of Biochemistry and Molecular Biology, 1501 KingsHighway, I.SU Medical Center, Shreveport, LA 71 130. E-mail: ktatchamail-sh.lsumc.edu 'Present address: Department of Biological Sciences, Clemson University, Clemson, SC 29634. Genrt~rs145: 615-626 (March, 199f)
glycogen synthase and phosphorylase kinase and reduced activity toward phosphorylase. Another example is in the fission yeast S. pombe where the association of the product of sds22+ with PP1 increases phosphatase activity towardCdc2-phosphorylated histone H1 and reduces activity toward glycogen phosphorylase (STONE et al. 1993). The regulatory subunit paradigm extends to budding yeastaswell. Gaclp, a Glc7p-binding subunit, is reet al. 1992; quired for glycogen biosynthesis (FRANGOIS et al. 1994), while another Glc7pbinding proSTUART tein, Reglp, is required for glucose repression (Tu and CARLSON 1995). Theprotein products of alleles of glc7 exhibiting specific defects in glycogen accumulation (glc7-1) and glucose repression (glc7-Tl52K) are unable to efficiently bind the glycogen and glucose represet al. 1994; sion-specific subunits, respectively (STUART TU andCARLSON 1995). The correlationbetween allelespecific defects in GLC7 and the null phenotypes of mutants in the Glc7p regulatory subunit genes provides strong evidence that regulatory subunits play a role in regulating phosphatase specificity i n vivo. In addition to Gaclp and Reglp,a growing number of Glc7p-binding proteins have been identified in S. cereuisiae. These include a homologue of S. pombe Sds22, called Egplp or Sds22p (HISAMOTO et al. 1995; ~ ~ A C K E L V IetE al. 1995); GlcBp, aprotein similar to mammalian inhibitor 2 (CANNON et al. 1994; TUNGet al. 1995); Regzp, required in combination with Reglp forgrowth (FREDERICK and TATCHELL1996);and Giplp, aproteinrequiredfor
S. H. Baker et al.
616
sporulation (Tu et al. 1996). A number of genes have also been identifiedwhose products interactwith Glc7p in the two hybrid system (Tu et al. 1996): X35, involved invesicle trafficking (NELSONet al. 1996); REDI, required for synaptonemal complex formation (ROCKM I 1 L and ROEDER 1988, 1990); GIP2, exhibiting sequence similarity to Gaclp; S U I , required for cortical cytoskeleton formation (HOLTZMAN et al. 1993); and several other genes of unknown function. Although an in vivo association betweenmanyof these potential binding proteins and Glc7p has not been proven, the possibility provides a mechanism to control the activity of Glc7p toward substrates involved in a wide range of cellular processes. If Glc7p has numerous roles in vivo, it should be possible to identify glc7mutant alleles with a wide range of phenotypes. To identify additional glc7 alleles, we created and analyzed 20 "charged to alanine" alleles that result in changes of clusters of charged residues to alanines. In addition, three nonsense mutations were created that result in Glc7 proteins with COOH-terminal deletions. The crystal structure of mammalian pP1 (EGLOFFet al. 1995; GOLDBERG et al. 1995) has allowed us to determine the location of each mutation in the three-dimensional structure of PP1. This information allows us to identify sites on the surface of Glc7p that could lie at the interface between Glc7p and specific regulatory proteins. M A T E W S AND METHODS Strains and genetic techniques: The glc7 mutant strains (Table 1) are congenic to strain JC482 (MATa ura?-52 leu2 h i d ) (CANNON and TAI'CHEIL198'7). Those haploid strains listed in Table 1 are MATa except for 71-11, which is MATa. Diploid strain SB78 (MATa/MATa uru3-52/ura3-52 trpl-l/ trpl-1 lsu2/leu2 GLC7/glc7::IEU2) was used as the recipient for transformation. The glc7::LEU2 and trpl-1 markers from strain CY969 (a gift from KIM ARNDT) were introduced into the JC482 background by seven serial backcrosses. Rich media YPD, YPA, and YPEG contained 1% yeast extract, 2% peptone and 2% glucose, 2% potassium acetate or 2% ethanol 3% glycerol, respectively. Synthetic media contained 0.67% yeast nitrogen base and 2% glucose supplemented with amino acids. Plate media contained 2% agar. Yeast cultures were grown at 30" in YPD unless otherwise stated. Tetrad analysis was performed as described (ROSE et ul. 1990). Cell densities were determined with a hemacytometer. Yeast cells were transformed by the method of Gwrz and ScHIEs'rl. (GIETLet al. 1992). Sporulation efficiency wasassayed on plates and in liquid culture. To determine thesporulation efficiency in liquid culture, 5 ml cultures were grown overnight in YF'D at 30°, the cells were pelleted and washed once with water and then resuspended in 5 ml ofWA. The cultures were incubated at 30" for 3-5 days and the number of asci containing three or four spores in each culture was counted using a hemocytometer. Thepercentage sporulation was reported as the ratio of asci containing three or four spores to the total number of cells (>300 cells per assay). Assay of sporulation efficiency was also tested by growing strains on solid media containing 1% potassium acetate. The percentage sporulation efficiency was determined after incubation for 4 and 6 days at 24". Glycogenand glucoserepressionassays: To qualitatively determine glycogen accumulation, cells were grown on WD
or synthetic media and stained with iodine vapor. Quantitative st glycogen assays were performed as described by FRANCOIS al. (1987). Glucose repression was assayed by growth on sucrose in the presence of 2-deoxyglucose, which prevents wildtype yeast strains from fermenting sucrose. Yeast strains were streaked on 2-deoxyglucose plates [2% peptone, 1% yeast extract, 2 % sucrose, and 200 bg/ml of 2-deoxyglucose (Sigma)] andgrown at 30"under anaerobic conditions rlsing GasPaks (BBL) (Tu and CARLSON 1994). Moleculartechniques and oligonucleotide-directed mutagenesis: Escherichia coli strain DH5aF' was used for recombinant DNA manipulations except where stated. To construct recombinant plasmids, DNA restriction fragments were purified from agarose gels using the Geneclean I1 Kit (Bio 101) following the manufacturer's instructions. The boiling lysis miniprep procedure from MANIA-rIS (MANIATIS el nl. 1989) was used for isolating plasmid DNA from E. coli. Large scale preparations were done using the Qiagen Maxi Prep Kit (Qiagen). DNA sequence analysis was carried out using the manufacturer'sinstructions with the Sequenase 2.0kit (United States Biochemical). Immunoblot analysis of Haepitopetagged Glc'7p was performed as described elsewhere ( S I L T A R T PL (zl. 1994) using the ECL detection system (Amersharn). Oligonucleotide-directed mutagenesis on pBSSK+PPl was performed using the Muta-Gene Phagemid in vilro Mutagenesis Kit Version 2 (BioRad). pBSSK+PPl contains the NidIIIXhoI fragment of GLC7in the HindIII-XhoIsites of pBIuescript SK+.The oligonucleotides listed in Table 2 were used to cow struct the alanine-scanning mutant alleles. The preliminary identification of the mutant alleles was made by the loss or addition of a restriction endonuclease site or by sequence analysis. The sequenceof the entire GLC7 gene from each of the mutant alleles was subsequently determined. With the exception of gk7-13?, the only nucleotide differences were introduced by the mutagenesis. glc7-133 also included a mutation resultingin the substitution of alanine forglutamine 298. Each alanine-scanning mutant allele was transferred into pNC160-PP1, a TRPI-CEN shuttle vector containing the XhoI fragment of GLC7 cloned into the SnlI site of pNC160, by replacing restriction fragments of pNCl6O-PP1with fragments o f pBSSK+PPl plasmids containing the mutations. In some mutants (glr7-101, glr7-102, gk7-108, glc7-109,$7111,gk7-126, glc7-128, $7-133, glc729Y, gk7-295") a hemagglutinin epitope (Ha-rag) recognized by the nwnoclonal antibody 12CA5 (WII.SON et ccl. 1984) was introducedintothe GLC7coding sequence at thesecond amino acid residue. The introduction of the Ha-tag at this position of Glc7p does not appear to affect the hnction oftheresulting protein (SL~TTOK el al. 1991; SI'CIART st nl. 1994; HIsAMcYrO st d . 1995). To construct the Ha-tagged mutant alleles, the Ha epitope-tagged gene was introduced into pNC16Oby cloning the HindIIISnll fragment ofYCp50-Ha-GLC7 (SUTTONet al. 1991) into pNC1GO and restriction fragmentsfrom pNC160-Ha-GI,C7 were recombined with restriction fragments from each of' the mutant alleles. To assay the phenotype of strains carrying each alaninescanning allele, pNC160-GLC7 plasmids were transformed into a GZ,C7/gk7::LE;U2 heterozygous diploid (strain SB78). The dominance of each mutant allele was determined by examining Trp+ transformants for growth rate, glycogen accumulation, 2-deoxyglucose resistance and resistance to 1 M NaCI. Mutant traits were recessive except for a partial gly?Ogen deficiency observed in transformants carrying gk7-126, glc7-128 or glc7-2W. To examine haploid phenotypes, Trp' transformants were sporulated and subjected to tetrad analysis. Trp' Leu' meiotic progeny identify haploid strains carrying t h e glr7::UU2 gene disruption and the alanine-scannillg allele. Tetrad analysis was performed on at least two transformant.? from every transformation. The haploid strains
617
Protein Phosphatase Type 1 in Yeast
TABLE 1 Phenotypes of gZc7 mutants
Allele
Amino acid replacement
GLC7 D9A glc7-121 D7A, GLC E17Aglc7-122 R14A, D13A, glc7-123 K22A R19A, Yes glc7-125 R42A K40A, gk7-101 E55A E53A, Cglc Yes glc7-102 E76A R95A, glc7-126 D94A, SB245 gk7-127 SB214 Yes KllOA, K112A R121A, E125A glc7-128 SB177 D137A, E138A glc7-129 71-11 K149A, D153A glc7-131 D165A, E166A, K167A SB216 glc7-132 R186A, R187A, R190A, Q298K glc7-133 SB219 D193A, D196A glc7-134 D207A, D209A, K21OA, D211A glc7-135 SB186 E217A, D219A glc7-106 D229A, R233A glc7-136 SB189 E255A glc 7-108 Yes glc7-109 R260A K259A, glc7-111 E286A D285A, glc7-295" A295-312 glc7-299" A299-312 18 glc7-305" A305-312 12 glc Yes 7-1 R73C
Identical in mammals" Phenotypeh strain SB231 No No SB233 No SB234 SB229
Yes Yes Yes Yes No Yes Yes Yes No Yes
SB90 SB207 SB211 SB255' SBl45 SB83
SB2592-DG'
Diploid
SB236
SB246 SB251' SB240 SB106 SB262
-glc t glc tglc Lethal spo, kglc, 2-DG' Lethal ts, cs, -glc SPO, CS, 2-DG', t g l c -glc Dominant lethal?
SB195
GLC Yes SB237 SB248
Haploid strain
NaCI", SB113
SB244 SB247 SB254 SB253
+glc, spo fglc t glc Lethal t glc
SB258
-
glc
No, residues altered in the allele are not identical to those in mammalian PPI; yes, residues are identical. "GLC, hyperaccumulation of glycogen; -glc, very low glycogen; tglc, reduced glycogen; spo, sporulation deficient; NaCI", unable to grow on 0.9 M NaCl; 2-DG', resistant to Zdeoxyglucose; ts, reduced growth rate at 37"; cs, reduced growth at 11". The glc7 allele in these strains was tagged with the Ha epitope. with each of the glc7 mutant alleles are listed in Table 1. Diploid strains containing a particular glc7 allele were constructed by mating MATa and MATa haploids and isolating zygotes. Microscopy and flow cytometxy Immunofluorescence microscopy was performed as described (MCMILLANand TATCHELL 1994). Cells were viewed and images acquired using an Olympus AX70 microscope (Olympus, Lake Success, Ny) equipped with epifluorescent and Nomarski optics. Images were acquired with a I/IElOOO SIT camera (DAGE-MTI Inc., Michigan City, IN), digitized with a DSP2000 (DAGE-MIT Inc.) digital signal processor and transferred to the computer using a Quick Capture (Data Translation Inc. Marlboro M A ) frame grabber board and NIH Zmuge, version 1.60 software. Image analysis was performed on a Macintosh Centris 650 computer using the public domain NIH Image program (written byWAYNE RASBAND atthe U.S. NationalInstitutes of Health and available from the Internet by anonymous FTP from zippy.nimh.nih.gov or on floppy disk from NTIS, 5285 Port Royal Rd., Springfield, VA 22161, part number PB93504868). Composite figures were assembled with Adobe Photoshop v 2.5 (Mountain View, CA). For flow cytometry cells were grown to 10' cells per ml in liquid YPD medium, harvested by centrifugation, and resuspended in 0.5X volume of H20. Cells were sonicated for 20 sec to disruptcell aggregates, ethanol was added to 70% (vol/ vol) and cells were stored overnight at 4". Cells were harvested by centrifugation, washed once in10 mM Tris pH 7.4, 15 mM NaCl, resuspended in 1/10 volume of the same buffer containing RNAase A at 0.1 mg/mL, and incubatedat 37" for 1.5 hr. Cells were harvested by centrifugation, resuspended
in phosphate-buffered saline at a cell density of 1 X 106/ml, and propidiumiodide (Sigma)was added to a final concentration of40 pg/ml. Flow cytometry was performedatthe LSUMC Flow Cytometry Facility using a FACSvantage (Becton-Dickinson, Mountain View, C A ) with an excitation wavelength of 488 nm and monitoringemission in the f12 channel. Data were collected in the four-parameter list mode at20,000 cells/run. Channels were calibrated with haploid and diploid cells both in log phase and arrested in G1 by nutrient starvation. RESULTS
Mutant alleles of GLC7 have proven valuable in identifylng physiological pathways that require Glc7p and the requisite regulatory subunits. For example, glc7-1 and glc7-Tl52K have specific defects in glycogen synthesis (FENGet al. 1991; FRANCOIS et al. 1992; CANNON et al. 1994) and glucose repression (Tu and CARLSON 1994), respectively. The product ofglc7-1is defective in its association with Gaclp (STUARTet al. 1994) while the product of glc7-Tl52Kis defective in its interaction with Reglp but not with Gaclp (TU and CARLSON 1995). The correspondence between phenotype and biochemical activity provides strong evidence that the binding proteins have a physiological role in regulating the specificity of Glc7p. To identify additional alleles of Glc7p that affect its specificity,we constructed 23 glc7mutant
618
S. H. Baker et ul.
TABLE 2 In vitro mutagenesis glc7 allele
Amino acid replacement
Oligo sequence
glc 7-1 01 glc7-102 glc 7-1 06 glc 7-1 08 glc7-109 gk7-111 glc7-121 glc7-122 glc 7-123 glc 7-125 glc7-126 glc7-127 glc7-128 glc7-129 glc7-131 glc7-I32 glc 7-133 glc7-I34 GLC7-135
E53A, E55A TACTTTAATTGGGGCGGCTAAGGCTAGTAAAATGGGTTG E76A CGGGAATCCACCGTAGGCAAATAGACGTAGTAA E217A, D219A GAAAGAAACACCTCTTGCATTGGCACTCCAACCTACGAT TCTTTTACTAAAGAAGGCATAACCATCTTCCAC E255A K259A, R260A AAGTGTCACCAATTGTGCTGCACTAAAGAATTCATA D285A, E286A AGAACATAATAAACTTGCAGCAACACTCATCATTGC D7A,D9A TCTATCGATGATATTAGCAACGGCAACTGGTTGTGAGTC D13A, R14A, E17ATTTAGATCCTCTTACTGCCAATAATGCAGCGATGATATTATCAAC R19A, K22A AACTTGTTGACCAGGTGCAGATCCTGCTTACTTCCAATAATCT K40A, R42A CTTTATGAATATAGATGCGGCTGCCGAACATAAGTATCT D94A, R95A, K97A AGTCTCTAAGGATTGTGCACCAGCGGCGACATAATCACCCAA KllOA, K112A AAAGTTTTCTGGATACGCAATTGCGTAAGCCAGTAATAG R121A, E125A ATTAATGGAAGCACATGCATGGTTCCCTGCTAAAATGAAAAAGTT D137A, E138A ATAACGTCTCTTACATGCAGCATAAAACCCGTAAAT K149A, D153A TAAACAATTGAAACAAGCCGTGAAAGTTGCCCAAAGTTTGATATT D165A, E166A, K167A ATGCATACAGAAGATTGCCGCAGCAATAATTGCAGCAAT R186A, R187A, R190A GGGAATATCTGTTGGCGCCATCACCGCTGCGATCTGTTCCATACT D193A, D196A ACATAATAAGCCAACGGCGGGAATAGCTGTTGGCCTCATCAC D207A, D209A, ACTCCAACCTACGATAGCTGCAGCTGGAGCTGACCACAATAAGTC KZIOA, D211A gk7-136 TTGTTTCTGTAAAAATCGGTTCACTACAGCAGGACCAAAAGTGAA D229A, R233A glc7-305" CTTTCTACCCCCAGCTTACCTTGGTAGACT A305-312 &7-299" CCTTGGTAGACTTTTTAGGCTGGCTTTAAAAT A299-312 TTTTTGGGCTGGCTTTAAATTTGAAAAGAACA ~1~7-295" A295-312 -
Annealing site"
Detection"
236198 DdeI (- ) 824792 RsuI (-) 1253-1215 Sequence 1361-1329 Sequence 13761341 Sequence 14541419 Sequence 97-60 Sequence 122-78 ClUI ( - ) 1 37-96 Sequence 197-159 BgflI (-1 887-846 S U l I (-) 932-894 Sequence 971-937 Sequence 1010-975 BsoFI ( + ) 1055-1011 XmnI (-) 1097-1059 Sequence 1166-1122 BsoFI ( + ) 11841143 Sequence 1229-1 184BsoFI ( + ) 1295-1251 1483-1511 1461-1493 1449-1481
Sequence Sequence Sequence Sequence
* Sequence corresponds to published sequence of GLC7/disZSl (OHKURA et al. 1989),accession number M27070. In some cases a mutation was detected by the elimination (-) or creation (+) of a restriction enzyme site. In other cases
the only detection method was D N A sequence analysis.
alleles using site-specific mutagenesis. Twenty of the mutant alleles were clustered charged-to-alanine mutants in which clusters of charged residues were changed to alanine residues. The hypothesis behind this approach, first outlined by CUNNINGHAMand WELLS(1989), is that groups of charged residues are likely to lie on thesurface of the protein. The alteration of the residues may change interactionswith other macromolecules but will not likely disrupt thetertiary structure of the protein. This approach has been used successfully to study cAMP-dependent protein kinase (GIBBS and ZOLLER1991), actin (WERTMAN et al. 1992), and @tubulin (REIJO et al. 1994). We also constructed three nonsense alleles in which stop codons were placed near the COOH terminus, resulting in proteins with small COOH-terminal deletions. The location of each mutation in the primary sequence of Glc7p is presented in Table 1 and Figure 1. Each mutant allele on a low copyCEN-based plasmid (pNC16O) was transformed into a diploid strain heterozygous for lethal a glc7::LEU2 gene disruption. Tetrad dissection of these transformants was used to isolate haploid strains containing pNCl60-GLC7 plasmids as the sole functional copyofGLC7. These strains were characterized for changes in growth rate and for other traits observed in glc7 mutants. Our analysis of glc7 mutant alleles has been assisted
by the crystal structure determination of human ( E c et al. 1995) and rabbit (GOLDBERG et al. 1995) PP1, which appeared after our collection of mutant alleles was constructed. Given the high level of sequence identity between yeast Glc7pand mammalian PP1, it is possible to directly model Glc7p using the coordinates of the mammalian homologues. The coordinates for amino acid residues 7-300 were determined from the X-ray diffraction data for therabbit enzyme. Within this region the yeast and rabbit enzymes are 87% identical. Among the 20 alaninescanningmutant alleles, 44 charged amino acid residues were changed to alanine. Only six ofthese residues are notidentical to the corresponding residues in the rabbit enzyme. This high level of identity provides strongjustification for directly modeling Glc7p with the rabbit enzyme. COOH-terminal truncations: The greatest divergence between type 1 protein phosphatases is in their COOH-termini (BARTONet al. 1994). The major PPI isoform in rabbit is 17 amino acid residues longer than Glc7p. Many isoforms of PP1 contain a cdc2 kinase consensus sequence, TPPR, near the COOH terminus. The threonine in this sequence is phosphorylated in vivo in S. pombe (YAMANO et al. 1994) and mammals (DOHADWALA et al. 1994) and is implicated as a site of negative regulation by cyclin-dependent protein kinase (YAMANO et al. 1994). This sequence is not conserved LOFF
RABBIT YEAST
1
1
-
I glc7-125
glc7-122 gIc7.123
rDllm
ICGDINGQYY ILLELEAPLK 51 50 ILLESAPIK LCGDIHGQYY
DLLRLFEYGG DLLRLFEYGG
m
101 100
glc7-i26
"=
-LETICLLLAY m
KIKYPENFFL LRGNHECASI NRIYGFYDEC KRRYNIKLWK LETICLLLAY U Y P E N F F I L-CAS1 NRIYGFYDEC KRRYNLKLQ. ~$7.127
RABBIT YEAST
151 150
201 200
251
ma
IAAImEKIF CCHGGLSPDL QsMEQIRRIM RPTDVPDQGL L A A L I B I F CMHGGLSPDL NSMEQLRRVM RPTDIPDVGL Qk7.132 glc7-133 glc7-134
E lm LCDLLWSDPD
m
I
m - m
KDVQGWGEND RGVSFTFGAEW A K F L H K H D LDLLCRAHQV LCDLLWS-IVGWS~RGVSFTFGPDFLQKQD MELICRAHQV gfc7-135
RABBIT YEAST 250
glc7- 129
glc7-128
m m
-FNcLP ,,T=DCFNCLP gIc7-131
RABBIT YEAST
I
FPPESNYLFL GDYVDRGKQS FPPESNYLFLGDYV-QS
gfc7-I02 gk7-lo1
RABELT YEAST
Type 1 in Yeast
MSDSEKLNLD SILGRLLEVQ GSRPGKNVQL TENEIRGLCL KSREIFLSQP M D S Q P W S NIIDRLLEVR GSKPGQQVDL EENEIRYLCSE S L F I K Q P gIc7-121
RABBIT YEAST
Phosphatase Protein
gIc7-106
lorllm
glc7-136
m
m
VEDGYEFFAK RQLVTLFSAP NYCGEFDNAG AMMSVDETLM CSFQILKPAD VEDGYLFFSSQLVTLFSAP NYCVEFDNAG AMMSVLLSLL CSFQ KP glc7-106 gk7-109
glc7.11 I
P glc7-295" @7-299"
RABBIT YEAST
301 300
KNKGKYGQLS GLNPGGRPIT PPRNSAKAKK KSLP AGGR KKK
L
330 A A 312 AA
gk7-305"
FIGUFT 1."Alanine-scanningandnonsense alleles of GLC7. Yeast Glc7p and rabbit PPla are aligned. The bars over the alignment of yeast Glc7p and rabbit P P l a correspond to the alpha helices and beta sheets present in the structure of PP1 (GOLDBERGrt al. 1995). The narrow bars below Glc7p mark theregions of Glc7p in which charged aminoacids were changed to alanine. Thelocation of each of the threeCOOHterminal nonsense mutations is marked by the vertical line.
in Glc7p. However, Glc7p does contain a tract of basic residues in the COOH terminus that is also found in many PP1 enzymes. The COOH termini of rabbit and human PPI were not resolved in the crystal structure, implying that the COOH-terminus has a high level of mobility. To investigate the role of the COOH terminus in Glc7p, we constructed aseries of ochre nonsense alleles that removed all or part of this region. The locations of these mutations are presented in Figure 1. The gk7305" product is missing the seven COOH-terminal residues, including the conserved basic amino acid tract; the gk7-299 product lacks the 14 COOH-terminal residues, which includes a highly conserved lysine residue (K300); and glc7-295" lacks the COOH-terminal 18 residues. These mutant alleles were tested in yeast for their ability to complement a glc7::UU2 gene disruption as described in MATERIALS AND METHODS. glc7-305" appears to be fully functional by the criteria used to examine the other mutants. Thus, theconserved lysine tract does not have an essential function. glc7-299 confers a partial glycogen deficiency (Figure 5A) but grows at wildtype rates. Haploid strains containing theglc7-295" deletion were not recovered, indicating that the largest deletion is not functional. To assess the stability of COOHterminal deletions, an Ha epitope was transferred to the NH2-terminus of glc7-299 and glc7-295", plasmids containing these epitope-tagged mutant alleles were transformed into strain SB78, and imlnunoblot analysis
619
was performed to assess protein levels. Glc7-299"p was expressed at normal levels but its mobilitywas increased relativeto the wild-type Ha-tagged Glc'ip, consistent with loss of 14 COOH-terminal residues (datanot shown). Ha-Glc'7-295"pcould not be detected by immunoblot analysis, indicating that the amino acid COOH terminal deletion probably reduces the stability of the protein. Lethal mutant alleles: In addition to gk7-295", three alanine-scanning mutant alleles failed to complement the growth defect of a glc7::LBU2 disruption. For one of these, glc7-135, diploid transformantswere never recovered in SB78, a diploid strain heterogygous for a glc7::IEU2 disruption, suggesting amino thethat acid substitutions in this mutant allele cause a dominant lethalphenotype. We were able to recover transformants of gk7-135 in a haploid strain that had a normal dosage of GLC7, suggesting that g1c7-135 is sensitive to gene dosage. The three lethal alanine-scanning mutant alleles each alter at least one amino acid residue predicted to be part of the conserved catalytic core of the enzyme (EGLOFFet al. 1995; GOLDBERG et al. 1995). D94 and D207, which are changed to alanine in glc7126 and $67-135, respectively, are buried in the core of PP1 and are thought to directly participate in catalysis. R121 and E125, altered in gk7-128, are also buried in the core of PP1 and directly flank other residues involved in catalysis (EGLOFFet al. 1995; GOLDBERG et al. 1995). Epitope-tagged versions of Glc7-126p and Gc17128p were not detected by immunoblot analysis, indicating that the mutations are likely to alter protein stability in addition to predicted changes in catalytic activity (data not shown). Yeast strain SB78 transformed with gk7-126, gk7-128 or gk7-295" contains slightly reduced levelsof glycogen, asassayed by iodine staining but shows no obvious growth defects. The reducedglycogen levels indicate that each of the lethal mutantalleles are at least partially dominant. Conditional mutant alleles: Haploid strains containing each of the viable alanine-scanning alleles were assayed for growth defects at ll", 15", 24", 30°, and 37" on YPD, YPGE, synthetic medium and YPD containing 0.9 M NaC1. Only three mutant alleles, glc7-129, glc7131, and glc7-109, caused growth defects. The locations of residues altered in the products of these alleles in the crystal structure ofPP1 arepresented in Figure 2D. gk7-129 confers slow growth at ll", 15" and 37" on all media tested, while glc7-131 confers slow growth only at 11" and 15" on all media tested. glc7-109 results in little or no growth on W D + 0.9 M NaCl at all temperatures. Microscopic examination of the glc7-109 strains revealed that thesalt sensitivitywas accompanied by cell lysis. To determine if the growth defects in the glc7-129 and glc7-131 mutants were associated with cell-cycle-specific defects, cultures of each strain were grown to log phase at 30" and were shifted to either 37" or 11". After incubationatthe nonpermissive temperature, cells
620
S. H. Baker et al.
FIGURE2.-Locations of amino acid residues altered in gk7 mutants that affect glycogen, 2-DG resistance, and viability. The location of amino acid residues altered by the glc7 alanine-scanning alleles are presented in three views of the space filling model of rabbit PP1. The residues altered in mutants that fail to accumulate glycogen are yellow, residues altered in mutants that hyperaccumulate glycogen are orange, and residues changed in mutants that are 2-DG resistant are red. Residues altered in temperature- orcold-sensitive mutants are green, andresidues altered in the NaC1-sensitive mutant glc7-109are blue. Surface residues altered in lethal glc7 alleles are black. Metal ions associated with the active site are magenta. Altered residues in glc7 alanine-scanning alleles that do not affect these traits are gray. A and D are views from an arbitrary "front" of the protein showing the metal ions in the active site. B and C are 180degree Yaxis rotations and 90-degree Xaxis rotations of A, respectively. Most residues altered in the glc7 mutants are identical in the rabbit enzyme; those residues that are not identical in glc7-123 (R19) and glc7-I21 (D7) are boxed. Modelling was performed on a Apple Macintosh computer using RasMo12.6 software (ROGER SAYLE,Glaxo Wellcome Medicines Research Centre).
were harvested, fixed and stained with propidium iodide for microscopic examination and flow cytometry. These results are presented in Figure 3. At ll", both glc7-129and glc7-131 mutants accumulate as large budded cells. After 24 hr, three-quarters of the cells have large buds. In contrast, less than one-half of the cells in the wild-type culture have large buds. Surprisingly, the nuclear morphology is different for gZc7-129 and glc7-131 cells grown at 11". The majority of large budded cells in glc7-129cultures contain a single nucleus at or in bud neck, while large budded glc7-131 mutant cells have a single nucleus positioned further from the bud neck (Figure 3C). Flow cytometry (Figure 2B) revealed that cells accumulate with a 2C DNA content. Thephenotype of glc7-129 cells is similar to that of glc7-Yl70
(HISAMOTO et al. 1994) and glc7-12 cells (MACKELVIE et al. 1995), which arrest in mitosis at their nonpermissive temperatures. The growth of glc7-129cells is also delayed at 37" and again cells accumulate with large buds (Figure 3). Flow cytometry revealed a slight increase in cells with a 2C DNA content, indicating a delay in G2 or M (Figure 3B). In contrast to the arrest phenotype of gZc7-129 at 1lo, large-budded cells are observed at 37" in which the nucleus is not at the bud neck. An example of this is shown in Figure 3C. Although the nuclear position in glc7-129mutants has not been quantitated,our preliminary observations suggest that Glc7p may have an additional role in nuclear migration. However, we have not observed any increase in binucleate cells, a phenotype
Protein Phosphatase Type 1 in Yeast
A genotype
temp ("C)
GLC7
11 11
gk7-I29 5% gk7-131
11
GLC7 gk7-129 91~7-131 GLC7
30 30 30
44% 49%
60%
37 37 37
44% 35% 35%
17% 15% 9% 9%
22%
20% 27% 5% 24% 29% 24% 27%
$lA,K glc7-I29 gic7-131
B
,~
70%
3%
02%
3%
15% 24%
5%
20%
6%
19%
37%
9% 4%
32%
5%
? I J f J ~ 1,112 'IAIK liv"\ ,o 0,
,o 0,
IC
x
characteristic of mutants defective in nuclear or spindle migration (PALMER et nl. 1992; ESHELr / 01. 1993; LI PI nl. 1993; CIARKand MEYER1994; MCMILLANand TATCHELL 1994; MuHUA d cd. 1994). Glucose derepression: TU and CARLSON (1994) identified an allele of glc7 (glc7-7'152K) that result. i n failure to repress invertase expression in the presence of glucose. This phenotype is similar to but milder than that of regI/l~~x2/snzImutants, whichwereoriginally identified by their constitutive glucose derepression phenotype (ENTIANand ZIMMERMANN1980; MATSUMOT0 d 01. 1983; NEICERORN and CARLSON 1987). Reglp interacts with the wild-typeGlc7p but fails to interact with Glc7"'.'"~ (Tu and CARLSON 1995). These data are consistent with the hypothesis that Reglp is a regulatory subunit of Glc7p that modulates its activity in glucose repression. To identify other glucosederepressed alleles, we plated the glc7 mutants on media containing 2deoxyglucose and sucrose. Glucosederepressed mutants will grow on this medium, overcoming the inhibitory effects of 2deoxyglucose (2-DG). Three alleles caused a 2-DGresistant phenotype: gk7-127, glc7131, and glc7-133 (Figure 4). Theglc7-131 allele (K149A, Dl53 A) alters residues that flank the alteration in gk7'1'152K. Inspection of the locations of changes encoded by the 2-DGresistant mutant alleles on the structure of PPI reveals clustering on one face of the protein. This is most clearly observed in the viewof PPI presented in Figure 2C. One interpretation of this result is that a single protein, possibly Reglp, binds to the region of Glc7p identified by the 2-DGresistant g k 7 alleles. Glycogen biosynthesis: GLC7 was first identified by the glycogendeficient phenotype conferred by glc7-I, which results in the substitution of a cysteine residue for arginine at amino acid residue 73 (CANNON et nl. 1994). glc7-1 mutants fail to accumulate glycogen, at least in part due to a defect in the dephosphorylation and activation of glycogen synthase (FENC et nl. 1991; FRANCOIS et nl. 1992). Changes inglycogen synthase that prevent its phosphorylation suppress the glycogen defect of glc7-1 (HARDY and ROACH1993), suggesting that Glc7p acts on glycogen synthase in vivo. Glc7-lp fails to interact with Gaclp (STUART et nl. 1994), a putative glycogenspecific regulatory subunit of Glc7p, implying that the R73A mutation in glc7-I disrupt. the interaction between Glc7p and Gaclp. Despite its severe glycogen defect, the gk7-I mutant grows normally under most conditions. To identify other glc7 mutant alleles defective in glycogen accumulation, we stained the collection of gk7mutants with iodine vapor (Figure 5A). Many of the mutants exhibited a partial defect in glycogen accumulation: the glc7-125, glc7-101, glc7-102, glc7-127, glc7-131, glc7-136, glc7-108, and glc7-111 mutants all accumulate less glycogen than wildtype but more than glc7-1. In contrast, three mutants, gk7-123, glc7-129 and glc7-132, accumulate very low levels of glycogen while two other mutants, gl~7-I09and gk7-121, routinely accumulate higher levels of glycogenthan the
(3688 46% 19%
1c
x
1c
2c
FIGUKE3.-Cxll cycle arrest of gki-129 and gk7-131. Cel morphology and nuclear distribution in gk-7-I29 and glr7-I3 mutantsareshown. G K 7 , dc7-129 and gk7-131 strains werc grown in WD to mid-log phase atSO",and aliquot5 were shiftec to 11" or 37" for 24 or 6 hr, respectively. C e l l were harvested fixed and stained with propidium iodide to visualizenuclea DNA. (A) The percentage ofunbudded cells, small budded cell (bud is
