Blackwell Science, LtdOxford, UKMMIMolecular Microbiology0950-382XBlackwell Publishing Ltd, 2004? 2004521159168Original ArticleEvasion of AMA-1 immune responses by P. falciparumJ. Healer et al .
Molecular Microbiology (2004) 52(1), 159–168
doi:10.1111/j.1365-2958.2003.03974.x
Allelic polymorphisms in apical membrane antigen-1 are responsible for evasion of antibody-mediated inhibition in Plasmodium falciparum Julie Healer,1 Vince Murphy,2 Anthony N. Hodder,1 Rosella Masciantonio,2 Alan W. Gemmill,3 Robin F. Anders,2 Alan F. Cowman1* and Adrian Batchelor1† 1 The Walter and Eliza Hall Institute of Medical Research, 1G Royal Parade, Parkville, Melbourne, 3050, Australia. 2 Cooperative Research Centre for Vaccine Technology and Department of Biochemistry, La Trobe University, Bundoora, Australia. 3 Department of Clinical and Health Psychology, Austin and Repatriation Medical Centre, Heidleberg Heights 3081, Australia. Summary Apical membrane antigen-1 (AMA-1) is a target of antibodies that inhibit invasion of Plasmodium falciparum into human erythrocytes and is a candidate for inclusion in a malaria vaccine. We have identified a line of P. falciparum (W2mef) less susceptible to anti-AMA1 antibodies raised to the protein from a heterologous parasite line (3D7). We have constructed transgenic P. falciparum expressing heterologous AMA-1 alleles. In vitro invasion assays show that these transgenic parasites differ from parental lines in susceptibility to inhibitory antibodies, providing direct evidence that sequence polymorphisms within AMA-1 are responsible for evasion of immune responses that inhibit parasite invasion. We also generated a parasite line that would express a chimeric AMA-1 protein, in which highly polymorphic residues within domain 1 were exchanged. Inhibition assays suggest that these residues are not sufficient for inhibition by invasionblocking antibodies. This study is the first to use P. falciparum allelic exchange to examine the relationship between genetic diversity and susceptibility to protective antibodies. The findings have important implications for the development of an AMA-1-based malaria vaccine. Accepted 11 December, 2003. *For correspondence. E-mail cowman @wehi.edu.au; Tel. (+61) 3 9345 2555; Fax (+61) 3 9347 0852 or E-mail
[email protected]; Tel. (+61) 3 9479 2802; Fax (+61) 3 9479 2467. †Present address: School of Pharmacy, University of Maryland, Baltimore, MD 21201, USA.
© 2004 Blackwell Publishing Ltd
Introduction Plasmodium falciparum infection is a continuing global problem with 40% of the world’s population at risk. There are at least 300 million cases of acute malaria annually, causing over 2 million deaths (Sachs and Malaney, 2002). Potential vaccines are being targeted to various stages of the life cycle including the erythrocytic stage of this parasite. Antibodies that bind to the surface of extracellular merozoites can inhibit parasite growth, making these antigens attractive candidates for inclusion in malaria vaccines (Hodder et al., 2001; Kennedy et al., 2002; Kocken et al., 2002). Apical membrane antigen 1 (AMA-1) is a candidate for inclusion in a vaccine against P. falciparum (Anders et al., 1998; Kocken et al., 2002). This molecule, common to all Plasmodium species and found in other apicomplexan parasites, is an essential component of the invasion process (Hehl et al., 2000; Triglia et al., 2000). A definitive role for AMA-1 has not yet been identified, but a putative function is as a parasite ligand for attachment to host erythrocytes, suggested by the findings that monovalent antibody fragments (Thomas et al., 1984) and peptide mimotopes of AMA-1 (Li et al., 2002) inhibit merozoite invasion and that erythrocytes adhere in a speciesspecific manner to AMA-1 domains expressed on COS cells (Fraser et al., 2001). Studies in various animal models demonstrating high levels of protection have validated AMA-1 as a malaria vaccine candidate (Deans et al., 1988; Collins et al., 1994; Anders et al., 1998; Stowers et al., 2002). AMA-1 is a type I integral membrane protein with three domains defined by eight intramolecular disulphide bonds (Hodder et al., 1996). AMA-1 is localized in the micronemes of the apical complex (Healer et al., 2002) and is proteolytically processed before translocation to the merozoite surface prior to merozoite invasion (Peterson et al., 1989; Narum and Thomas, 1994). The protein appears to be shed from the merozoite surface into the medium during invasion after cleavage by a serine protease (Howell et al., 2003). Although AMA-1 sequence conservation is high across Plasmodium species (Marshall et al., 1989; Peterson et al., 1990; Waters et al., 1990; Cheng and Saul, 1994; Kocken et al., 2000), there is significant sequence variation among AMA-1 alleles of P. falciparum (Kocken et al.,
160 J. Healer et al. (Fig. 1A). There were 26 amino acid differences between the 3D7 and W2mef AMA-1 sequences. The domain structure of AMA-1 was classified as described previously (Hodder et al., 1996); 12 of the 26 polymorphic residues were identified within domain I; four within domain II and six within domain III (Fig. 1A and B). The remaining four amino acid differences were found within the N-terminal proregion and cytoplasmic tail (not shown). Examination of polymorphisms within the ectodomain (amino acids 97–
187 E
A
K E
225 N
I
H
L 200,
F
L
N
D
242, 243
197
D
Y
201
Domain I
K
E
K
206, 207
D
Y
2 3
E I S S 1
E 6
K K
4
300
5
cleavage site
308
Q
330
E
S
332 N
P
I
439 282
K
N
I
H
M
11
451
12
K
496 13
7
I
M
8
10
9
R 14
I
2000; Polley and Conway, 2001; Cortes et al., 2003). Polymorphisms occur non-randomly throughout the coding region, primarily within the ectodomain. The strong bias towards polymorphisms that result in changed amino acid residues indicate that AMA-1 is under diversifying selection resulting from immune pressure (Escalante et al., 2001; Polley and Conway, 2001; Cortes et al., 2003). Studies show that AMA-1 is immunogenic in malariaexposed individuals (Peterson et al., 1989; Thomas et al., 1994; Lal et al., 1996; Riley et al., 2000), and naturally acquired antibodies to AMA-1 can inhibit merozoite invasion in vitro (Hodder et al., 2001). The effect of AMA-1 diversity on inhibitory antibody function has been examined previously by testing different P. falciparum strains in in vitro invasion inhibition assays using antibodies raised against recombinant 3D7 AMA-1. These antibodies were potent inhibitors of the homologous and closely related D10 strains, but were less effective against HB3, which has more polymorphic residues (Hodder et al., 2001; Kennedy et al., 2002). Here, we demonstrate greatly reduced levels of antibody-mediated inhibition of merozoite invasion using anti3D7 AMA-1 antibodies against a heterologous line, W2mef. We have constructed a series of transgenic P. falciparum parasites and demonstrate conclusively that sequence heterogeneity within AMA-1 allows escape from inhibitory antibodies. This has important implications for the design of AMA-1-based vaccines against P. falciparum.
K
15
485
16
K R
E
512
Domain III
K
T
N
R
404, 405
503
Domain II
membrane
Results Invasion-inhibitory antibodies against 3D7 AMA-1 do not block erythrocyte invasion of W2mef parasites It has been shown previously that invasion of erythrocytes by merozoites for three different strains of P. falciparum was inhibited in a concentration-dependent manner by antibodies raised against refolded recombinant 3D7 AMA1B (Hodder et al., 2001). We tested the same anti-3D7 AMA-1 antibodies for inhibition of merozoite invasion of the heterologous line W2mef. In three independent assays, the antibodies (500 mg ml-1, purified IgG) inhibited the homologous 3D7 line very efficiently with an average inhibition of 76.3% compared with controls. In contrast, inhibition of W2mef invasion was significantly lower at only 20.7%.
Allelic differences between W2mef and 3D7 are found predominantly within domain I To determine whether polymorphisms in AMA-1 could account for the reduced inhibitory activity of the anti-3D7 antibodies, we sequenced the W2mef AMA-1 gene
B S
1
pro
Domain 1
97
Domain 2
302
320
418
Domain 3
443
Tm C -tail
547
622
Fig. 1. PfAMA-1 structure and amino acid sequence in 3D7 and W2mef. A. Schematic diagram of the domain structure of AMA-1 indicating the position of the amino acid differences between 3D7 and W2mef. The insertion of the W2mef sequence into the 3D7 AMA-1 sequence for the transfected line 3D7/p3D7cW2m is shown with the amino acid positions coloured red. The amino acid changes resulting from this are indicated as open red circles. The amino acid differences between 3D7 and W2mef are shown, and the residue is shown in solid red. The cysteine residues and linkages are shown in blue. The protease cleavage site is shown in green. This figure is an adapted version from Hodder et al. (1996) with permission from the publisher. B. Predicted domain structure of PfAMA-1 (Hodder et al., 1996). S, signal sequence; pro, proregion, proteolytic processing removes this portion from the mature protein (Howell et al., 2001); domains I, II and III are composed of six, four and six cysteine residues, respectively, forming intradomain disulphide linkages. The line underneath shows the positions of structurally important amino acid residues, with cysteines marked in red. Domain I/II boundary falls between C302 and C320, domain II/III boundary between C418 and C443. 97 is the position of the cleavage site between Pro-domain and ectodomain. 547 is the carboxy-terminal end of the ectodomain at the parasite membrane. © 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 159–168
Evasion of AMA-1 immune responses by P. falciparum A
In order to assess whether the low level of invasion inhibition of W2mef parasites by antibodies against 3D7 AMA1 resulted from amino acid polymorphisms, we constructed two plasmids containing full-length AMA-1 genes from the two strains to express the transgene in P. falciparum (plasmids p3D7 and pW2m) (Fig. 2A). We also constructed a plasmid designed to express a chimeric AMA-1 protein consisting of 3D7 sequence from the start codon to K177, W2mef sequence from D178 to P260, then 3D7 sequence from R261 until the stop codon (Fig. 1A). This construct would be used to assess whether the polymorphisms in the hypervariable region between the first and third cysteine residues of domain I were sufficient to confer resistance to the inhibitory effect of antibodies on erythrocyte invasion. These plasmids were transfected into 3D7 and W2mef parasites, generating the transgenic parasite lines 3D7/p3D7, 3D7/pW2m, 3D7/ p3D7cW2m and W2mef/p3D7. Southern blot analysis of MfeI-digested genomic DNA from 3D7, W2mef and the transgenic parasite lines 3D7/ p3D7, 3D7/pW2m, 3D7/p3D7cW2m and W2mef/p3D7 showed that the transfected parasite lines contained the © 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 159–168
M
Probe 3.7 Kb
M
M W2mef AMA1 8.7 Kb AMA1
M
M p3D7
hDHFR
0.9 Kb
9.1 Kb
pW2m
M
7 3D 7/ p 3D W2 m 7/ p3 D W 2m 7cW ef 2m W 2m ef /p 3D 7
C
3D
B
3D 3D 7 7 3D /p3D 7 3D /pW 7 7 2 W /p3 m 2m D7 W ef cW 2m 2m ef /p 3D 7
p3D7cW2m
u d u d u d u d u d
249 167
9.1 8.2 3.7
96 82
7 3D 7/ p 3D 3D 7/ 7 pW 3D 2m 7/ W p3D 2m 7 c W ef W2 2m m ef /p 3D 7
D
7 3D 7/ p 3D 3D 7/ 7 p 3D W2 m 7/ W p3D 2m 7 cW e W 2m 2m f ef /p 3D 7
0.9
3D
83 -
83 -
66 -
66 a-3D7 AMA1
Introduction of the heterologous AMA-1 gene into two strains of P. falciparum
M
M
3D7 AMA1
3D
547) revealed that most of the 10 radical amino acid differences between the two alleles were located within domain I (positions 200, 207, 225, 242 and 282), two were located within domain II (332 and 404) and another two within domain III (451 and 485) (Fig. 2). Four of these substitutions were found at positions five residues from a disulphide bond (242, 332, 404 and 485), and a further four were within 10 residues of a disulphide bond (207, 225, 282 and 451); however, it is unlikely that this is statistically significant. As anti-AMA-1 3D7 antibodies substantially inhibit merozoite invasion of D10 and HB3 parasite strains (Hodder et al., 2001), it was of interest to compare the AMA-1 sequence of W2mef with 3D7, D10 and HB3 to identify amino acid residues that may account for the ability of W2mef parasites to escape inhibition with anti-AMA-1 3D7 antibodies. Within domain I, there are only five residues that are identical in 3D7, D10 and HB3 but different in W2mef (residues 187, 197, 200, 207 and 243). Comparative analysis of available AMA-1 sequences revealed that four of the five ‘unique’ amino acids were highly polymorphic in the parasite population, with positions 200 and 197 having a possible four and seven alternative amino acid residues respectively. Additionally, at positions 187 and 243, three alternative amino acids have been found among different AMA-1 protein sequences. This contrasts with the dimorphism observed at the great majority of polymorphic sites in AMA-1.
161
a-W2mef AMA1
Fig. 2. Generation of transgenic P. falciparum lines expressing PfAMA-1. A. Restriction map of gDNA and plasmids for expression of PfAMA1 alleles. The hybridization probe is shown as a black line and extends beyond the MfeI site (M). The restriction map for both the 3D7 (top, coding region shown as a large open rectangle) and W2mef (middle, coding region shown as a large grey rectangle) AMA-1 genes and surrounding sequence is shown. The promoter region of AMA-1 used in the plasmid constructs (bottom) is shown as an open rectangle with the start of transcription as an arrow. Transfection plasmids, p3D7, pW2m and p3D7cW2m were constructed by inserting AMA-1 (3D7, open; W2mef, grey; 3D7/W2mef chimera, open with W2mef chimeric region in grey) between the PfAMA-1 promoter (small open rectangle) and the P. berghei terminator (PbDT3¢, small black rectangle). M, MfeI restriction site. The fragment sizes are shown in kbp. B. Southern blot of gDNA digested with MfeI showing endogenous AMA-1 and plasmids. The 1150 bp probe crosses the MfeI site, and a region extends 5¢ resulting in less hybridization of this region. C. Episomal and genomic forms of AMA-1 are transcribed in transfected parasites. RT-PCR products (249 bp fragments) were generated from schizont cDNA. These were digested with PsiI. 3D7 and W2mef AMA-1 show an RFLP. U corresponds to undigested, whereas d lanes were digested with PsiI. Size of DNA fragments is shown as kbp. D. The processed form of AMA-1 shows a small size polymorphism between isolates. Western blot of schizonts from parental and transfected parasites probed with either rabbit anti-refolded 3D7 AMA-1 antibodies (a-3D7 AMA-1) or rabbit anti-refolded W2mef AMA-1 antibodies (a-W2mef AMA-1). The upper arrow denotes the processed form of the 3D7 AMA-1 protein and the lower arrow the W2mef form. Sizes of the full-length protein (83 kDa) and processed form (66 kDa) are shown.
162 J. Healer et al. plasmids bearing the introduced AMA-1 gene as episomes (Fig. 2B). The W2mef and 3D7 AMA-1 genomic and episomal genes could be distinguished by an MfeI restriction enzyme site that is absent from the W2mef AMA-1 gene (Fig. 2B). The presence of a 0.9 kb band in 3D7/3D7, 3D7/p3D7cW2m and W2mef/p3D7 indicated that the episomal plasmid in these transfectants contained the AMA-1 gene. Similarly, in 3D7/pW2m genomic DNA, a hybridizing fragment of 9.1 kb corresponded to the linearized plasmid. These results are consistent with each transfected parasite line carrying the relevant plasmid as an episome. Transgenic AMA-1 genes are expressed in transfected parasite lines Reverse transcriptase polymerase chain reaction (RTPCR) was used to determine whether both the endogenous AMA-1 gene and the episomal copy were transcribed in different transfected parasite lines (Fig. 2C). The region of AMA-1 encoding amino acids 178–260 was amplified from cDNA, and the expected 249 bp product was obtained in both parental and transfected parasite lines. Digestion of the RT-PCR products with PsiI allowed differentiation between wild-type 3D7 AMA-1 transcripts (two bands of 96 and 82 bp) and W2mef cDNA (167 and 82 bp). Four PsiI bands were present in the transfected parasite lines 3D7/pW2m, 3D7/p3D7cW2m and W2mef/ p3D7, confirming that transcription of both allelic forms had occurred in these parasites (Fig. 2C). Potential contamination of the cDNA with genomic DNA was ruled out by running control PCRs without reverse transcriptase (not shown). The identification of transcripts from the different AMA-1 genes demonstrated that both endogenous and transgenic AMA-1 genes are transcribed in transfected parasite lines. In order to analyse expression of the AMA-1 protein in transfected parasites, we raised antibodies against refolded recombinant 3D7 and W2mef AMA-1 that recognized both AMA-1 proteins in Western blots (Fig. 2D). The appearance of a faint (unidentified) band at a higher Mr in some parasite lines was consistent with a previous study using anti-PfAMA-1 antiserum (Coley et al., 2001). There was a small size polymorphism between the processed (66 kDa) fragments of the different AMA-1 proteins, as predicted from Mr values, with the W2mef form being slightly smaller than the 3D7 form (Fig. 2D, see arrows). The W2mef product is easily identified, as the processed form runs as a visible doublet. In transfected parasites, only one form of AMA-1 was detected by each antiserum. Equal numbers of schizont stages were loaded for each parasite line, and the equivalent levels of reactivity observed with the 3D7 and W2mef anti-AMA-1 antibodies suggested that each expressed approximately equivalent
levels of total AMA-1 protein (Fig. 2D). Interestingly, the episomal allele appears to be preferentially expressed at the protein level. This was observed for 3D7 parasites transfected with a plasmid encoding the W2mef AMA-1 gene (3D7/pW2m) that only expresses the W2mef form of AMA-1; likewise, in W2mef parasites transfected with a plasmid containing the 3D7 gene (W2mef/p3D7), only the 3D7 AMA-1 protein was detected. This suggests that there may be interference with expression of the endogenous AMA-1 protein by the transfected plasmid. Nevertheless, these results show that the AMA-1 protein encoded by the introduced episomal plasmid is expressed in transfected parasites. Polymorphisms in the AMA-1 protein are responsible for differences in antibody-mediated parasite growth inhibition The generation of parasite lines that are isogenic, except for expression of distinct AMA-1 proteins, allowed direct assessment of the contribution of polymorphisms to their susceptibility to inhibition with anti-AMA-1 antibodies (Fig. 3). A control 3D7 parasite line, transfected with a plasmid containing the homologous 3D7 AMA-1 gene (3D7/p3D7), was included in the experiments to rule out any effect of gene copy number on differences in antibody-mediated growth inhibition. As described above, there was a significant difference in the susceptibility of 3D7 and W2mef wild-type parasites to anti-3D7 AMA-1 antibodies; however, the average level of 3D7 parasite inhibition was lower than that reported previously (Hodder et al., 2001), with a mean inhibition of 59% compared with 76% using 500 mg ml-1 IgG. This variation was assumed to result from the use of different batches of rabbit antisera in the two studies. Importantly, invasion of both parental 3D7 and 3D7 parasites containing episomal copies of the 3D7 AMA-1 gene (3D7/p3D7) was inhibited to a similar level in a dose-dependent manner by antibodies against the 3D7 AMA-1 allelic type. Therefore, there was no effect of homologous transgenic AMA-1 expression on the level of inhibition by the AMA-1 antibodies. The control parasite line W2mef/pW2mef was not included as it had already been shown that plasmid copy number did not affect susceptibility to antibodies for 3D7. Invasion by 3D7 parasites expressing W2mef AMA-1 (3D7/pW2m) was significantly higher than invasion by parental 3D7 in the presence of antibodies against 3D7 AMA-1 (P < 0.005) suggesting that polymorphisms in the W2mef AMA-1 protein are responsible for escape from inhibition (Fig. 3A). 3D7/pW2m parasites were able to invade erythrocytes as well as W2mef wild-type parasites. In contrast, W2mef parasites expressing 3D7 AMA-1 (W2mef/p3D7) were as susceptible to the effects of anti3D7 AMA-1 antibodies as the parental 3D7 parasites at © 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 159–168
Evasion of AMA-1 immune responses by P. falciparum
% inhibition of invasion
A 100 90 80 70 60 50 40 30 20 10 0
a-3D7 AMA1 3D7 W2MEF W2mef/p3D7 3D7/p3D7 3D7/pW2m 3D7/p3D7cW2m
0.125
0.25 0.5 Ab conc. (mg/ml)
% inhibition of invasion
B 100 90 80 70 60 50 40 30 20 10 0
a-W2mef AMA1 3D7 W2MEF W2mef/p3D7 3D7/p3D7 3D7/pW2m 3D7/p3D7cW2m
0.125
% inhibition of invasion
C 100 90 80 70 60 50 40 30 20 10 0
0.25 0.5 Ab conc. (mg/ml)
a-3D7+W2mef AMA1
W2mef/p3D7 3D7/pW2m 3D7/p3D7cW2m
0.125
0.25 0.5 Ab conc. (mg/ml)
Fig. 3. Inhibition of merozoite invasion of parasite lines by rabbit antiAMA-1 antibodies. Parasites were incubated with different concentrations of antibodies raised against recombinant refolded 3D7 AMA-1 (A), W2mef AMA-1 (B) or a combination of both these antibodies (C). Data represent the mean percentage inhibition of invasion from three independent assays.
the highest antibody concentration of 0.5 mg ml-1 (P = 0.3 for difference in inhibition). The W2mef/p3D7 transfectants expressing 3D7 AMA-1 were inhibited significantly more than wild-type W2mef (P < 0.05). In the reciprocal experiment, antibodies raised against refolded recombinant W2mef AMA-1 (Fig. 3B) had a very high inhibitory activity against W2mef (88%), whereas invasion of 3D7 parasites was much less affected (23%). At the highest antibody concentration, the mean percentage inhibition of invasion of W2mef parasites expressing 3D7 AMA-1 (W2mef/ p3D7) was 42%, a level significantly less than that seen against W2mef parental parasites (P < 0.0005) but comparable to the inhibition seen with 3D7 and 3D7/p3D7 parasites (P > 0.1 and 0.4 respectively). In contrast, 3D7 parasites expressing W2mef AMA-1 (3D7/pW2m) were more susceptible to invasion inhibition by anti-W2mef AMA-1 antibodies (P < 0.0005). The parasites W2mef/ p3D7 and 3D7/pW2m were inhibited to the same high © 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 159–168
163
level when incubated with a combination of antibodies against 3D7 and W2mef AMA-1 (Fig. 3C), and statistical analysis confirmed that there was no significant difference (P = 0.6). These results show that amino acid polymorphisms encoded in the W2mef AMA-1 protein are responsible for the low inhibition of invasion of W2mef by 3D7 anti-AMA-1 antibodies. Comparison of the 3D7, D10 and HB3 AMA-1 sequences with that of W2mef identified five ‘unique’ amino acids in domain I of W2mef (residues 187, 197, 200, 207 and 243). To determine whether these were responsible for the low level of invasion inhibition observed in W2mef with anti-3D7 antibodies, we derived the 3D7/p3D7cW2m parasite line that should express a chimeric AMA-1 protein (Fig. 2). RT-PCR and restriction fragment length polymorphism (RFLP) mapping confirmed that the transcript from this chimeric AMA-1 gene on the p3D7cW2m episome was transcribed (Fig. 2C). The protein expressed from the episomal AMA-1 gene would consist primarily of 3D7 AMA-1 into which has been inserted the W2mef sequence from amino acids 178–260 that includes the five ‘unique’ polymorphisms. With anti3D7 AMA-1 antibodies, inhibition of 3D7/p3D7cW2m, expressing the chimeric AMA-1 protein, was high and not significantly different from that of 3D7 (P = 0.2). Similarly, inhibition of 3D7/p3D7cW2m by anti-W2mef AMA-1 antibodies was low and not significantly different from that of 3D7, 3D7/p3D7 or W2mef/p3D7 (P = 0.2, 0.6 and 0.8 respectively). These data suggest that the introduction of mutations in 3D7 AMA-1 within the highly polymorphic region of domain I was insufficient to confer resistance to antibody-mediated inhibition of invasion. Discussion AMA-1 is a leading candidate for development as a malaria vaccine targeting the blood stages of P. falciparum. Critical appraisal of how parasite genetic diversity affects immune protection offered by such vaccines is of paramount importance to their design and delivery. This study addresses how genetic diversity within AMA-1 affects the susceptibility of parasites to invasion-inhibitory antibodies. Using a transfection approach to create isogenic parasite lines that differ only by expression of different AMA-1 alleles, we have shown conclusively that differences in antibody-mediated inhibition of merozoite invasion result from polymorphisms within this gene, confirming previous studies using different laboratory isolates (Hodder et al., 2001; Kennedy et al., 2002). The antibodies used in this study, which were raised against a refolded recombinant 3D7 AMA-1 preparation being developed for vaccination trials, have previously been shown efficiently to block invasion of the parental 3D7 and heterologous D10 strains (Hodder et al., 2001).
164 J. Healer et al. Our observation that these antibodies do not efficiently inhibit invasion of the W2mef strain of P. falciparum had two possible explanations. First, polymorphisms between W2mef and 3D7 AMA-1 may prevent binding of inhibitory antibodies lowering the level of inhibition. Secondly, W2mef could invade erythrocytes via a mechanism whereby AMA-1 antibodies could not exert significant effect. Invasion of erythrocytes by P. falciparum is possible via a range of ligand–receptor interactions, with different strains varying in their capacity to use different host receptors (Hadley et al., 1987; Dolan et al., 1994). We reasoned that the second possibility was unlikely as it is not possible to disrupt AMA-1 in P. falciparum (Triglia et al., 2000) including W2mef (data not shown). Expression of 3D7 AMA-1 in W2mef allowed us to test the first possibility, and the sensitivity of this transgenic line to 3D7 anti-AMA-1 antibodies showed that sequence polymorphism is responsible for differences in antibody-mediated inhibition of invasion. Importantly, we found that growth of W2mef parasites was strongly inhibited by antibodies raised against refolded W2mef AMA-1, confirming that AMA-1 is functional and being targeted in these parasites. This suggests that a vaccine composed of two or more divergent AMA1 alleles may overcome the problem of genetic diversity. A recently published study has tested this hypothesis. Rabbits immunized with a combination of refolded 3D7 and FVO AMA-1 proteins produced high-titre antibody responses, which inhibited invasion of both parasite strains (Kennedy et al., 2002). Our finding that invasion of transfected parasite lines was successfully inhibited by a combination of the two antibody preparations lends some support to this strategy. However, it is possible that the widespread heterogeneity observed in field isolates could mean that a vaccine based on two or even three divergent AMA-1 alleles may not be sufficient to confer immunity to malaria on a global basis. The finding that domain I haplotypes in Papua New Guinea and Nigeria showed little overlap (Cortes et al., 2003) also indicates that an AMA1-based vaccine may have to be regionally tailored. There is the possibility that delivery of an AMA-1-based vaccine in areas of high endemicity where recombination between alleles is frequent may induce a greater selection pressure on AMA-1 to diversify, limiting the lifespan of a singleallele vaccine. On a more encouraging note, however, our data from the parasite line expressing a chimeric domain I region suggest that substantial changes in this sequence at least can be accommodated without significantly changing the antibody susceptibility profile. More in vitro correlation of protection studies exploring the susceptibility of field isolates to AMA-1 antibodies is required to address these fundamental issues. Several studies have analysed genetic diversity within this protein from field and laboratory isolates (Thomas
et al., 1990; Marshall et al., 1995; Oliveira et al., 1996; Kocken et al., 2000; Escalante et al., 2001; Polley and Conway, 2001; Cortes et al., 2003), and neutrality testing has predicted that sites in domain I (Cortes et al., 2003) and domain III (Polley and Conway, 2001; Polley et al., 2003) are targets of naturally acquired protective immune responses in humans. Sequencing of the W2mef AMA-1 revealed differences from the 3D7 sequence at a number of sites, a high proportion of which were in domain I, consistent with findings from previous studies (Kocken et al., 2000; Polley and Conway, 2001; Cortes et al., 2003). Comparison of the W2mef sequence with that of HB3, a strain less susceptible to inhibitory anti-3D7 AMA1 antibodies than 3D7 (Hodder et al., 2001), but more so than W2mef, revealed a similar number of polymorphic sites to W2mef. This suggests that it is not the number of polymorphisms per se, but the nature of the changes that is important in determining sensitivity to invasion-inhibitory antibodies. This was consistent with previous data in which a similar difference in the level of invasion inhibition against HB3 parasites was obtained when tested with sera raised against either 3D7 or FVO AMA-1. There are 25 residue differences between HB3 and 3D7 and 23 differences between 3D7 and FVO sequences (Kennedy et al., 2002). In addition, neither serum in that study was able efficiently to block invasion of M24 parasites, despite the presence of fewer differences between FVO and M24 than between FVO and HB3. Also, in common with earlier results (Coley et al., 2001), sera against 3D7 was more inhibitory against D10 than 3D7 itself, indicating that a slight degree of heterogeneity may increase rather than decrease the affinity of antibodies binding to important residues. Further studies analysing binding affinities of the antibodies for each allele would be informative in assessing how residue changes affect epitope structure. In an attempt to determine whether the protective epitopes of AMA-1 were within the highly polymorphic region of domain I, we developed a transgenic parasite line that should express a chimeric AMA-1 protein composed predominantly of the 3D7 sequence, but with W2mef sequence from residues 178 to 260. This area included nine polymorphic sites, with five residues that are different from 3D7, D10 and HB3. It was possible to show that the chimeric gene was transcribed in the 3D7/ p3D7cW2m transgenic parasites and, from analyses of the other transfected parasite lines, it would be expected that the protein would be highly expressed. However, because of the similarity between endogenous AMA-1 and the chimeric protein, it was not possible to prove conclusively that the transgene was expressed at the protein level. In order to confirm this, it will be necessary to insert these mutations into the endogenous AMA-1 gene using allelic replacement (Triglia et al., 1998; Reed et al., 2000a). Obtaining an allelic replacement can be problem© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 159–168
Evasion of AMA-1 immune responses by P. falciparum atic as it is not possible to control the cross-over point for recombination, and mutations may not be incorporated into the expressed gene as designed. The demonstration that the episomally encoded AMA-1 gene shows dominance in expression over the endogenous protein in effect creates an allelic replacement and was an important advantage of the strategy used in this study. It was interesting that the transfected parasites that should express the chimeric AMA-1 protein were fully susceptible to the inhibitory effects of anti-3D7 AMA-1 antibodies. This suggests that the highly polymorphic region between the first and fourth cysteines of domain I is not sufficient as a target for binding of antibodies for substantial inhibition of merozoite invasion. This result was fully consistent with a recent study that used antigenically active tryptic peptide fragments from domain I of Plasmodium chabaudi AMA1 to immunize mice. Despite the production of high-titre antibody responses, no protection resulted (Salvatore et al., 2002). This region may form part of a conformational epitope, and changes in this sequence alone may not be sufficient to confer resistance to protective antibodies. As yet, only the structure of domain III has been resolved (Nair et al., 2002), and it remains unclear how the different domains interact. Inhibitory antibodies raised against AMA-1 all target reduction-sensitive epitopes (Kocken et al., 2000; Hodder et al., 2001), and attempts to induce protection in animals immunized with single or multiple independent domains have been unsuccessful (P. E. Crewther, A. N. Hodder and R. F. Anders, unpublished data). Thus, it seems highly probable that protective epitopes are formed by distal parts of the protein folding together and that mutations in distal regions affect overall epitope structure. By a process of elimination (where the residue was the same as D10), we found a further nine positions within the ectodomain that may be important targets of inhibitory antibodies. Three of these were in domain I (282, 300 and 308), three within domain II (332, 404 and 405) and three within domain III (451, 485 and 512). Notably, both domain I and domain III polymorphisms cluster at sites that have been predicted as those under strongest balancing selection (Polley et al., 2003). The importance of domain III epitopes was established by a study that found that human antibodies affinity purified against refolded 3D7 domain III inhibited 3D7 parasite invasion (Nair et al., 2002). Furthermore, HB3 was less inhibited than 3D7 in that study, confirming that mutations within domain III have significant impact on protective immune responses to AMA-1. Further evidence highlighting the importance of domain III epitopes in protective immunity was provided recently in a study that used synthetic peptides representing the semi-conserved loop structure within domain III as immunogens to raise monoclonal antibodies. A very high level of parasite growth inhibition (95%) was observed © 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 159–168
165
with a single monoclonal antibody (DV5) against one parasite strain, K1 (Mueller et al., 2003). Testing this monoclonal antibody in invasion inhibition assays against heterogeneous strains would be informative. The observation that the endogenous AMA-1 protein was not detectable in transfected parasites suggested that episomal AMA-1 expression was dominant. Although endogenous AMA-1 transcripts were detected, the experiments were not quantitative, and it is possible that the level of transcript from endogenous AMA-1 was much less than that transcribed from the episomal gene. This is likely to result in some way from the episomal plasmid copy number. If the level of transcript from the episomal gene is also greater, perhaps this form is preferentially translated. In a previous study in which PcAMA-1 was expressed in P. falciparum, there was no apparent downregulation of the endogenous gene product (Triglia et al., 2000). In that case, the PcAMA-1 gene cassette was integrated into the PfAMA-1 promoter region creating a reconstitution of the endogenous gene downstream. It was impossible to generate an allelic substitution of the PfAMA-1 gene, as parasites expressing PcAMA-1 only were unable fully to complement PfAMA-1 function. In conclusion, we have confirmed with functional allelic replacement of AMA-1 domains that diversity within AMA1 sequences accounts for major differences in susceptibility of different P. falciparum strains to growth-inhibitory antibodies. We showed that polymorphisms within a subsection of the hypervariable region of domain I alone were insufficient to confer resistance to inhibitory antibodies, suggesting that protective epitopes are formed from other parts of the protein. This strategy will undoubtedly provide a powerful tool with which to map protective epitopes (O’Donnell et al., 2001). The availability of transfectant parasites such as those described will be an invaluable resource to test human immune responses to AMA-1, particularly in postvaccination studies (O’Donnell et al., 2000). Experimental procedures Parasites, nucleic acids and DNA constructs Plasmodium falciparum clone 3D7 was obtained from D. Walliker at Edinburgh University. W2mef was obtained from CDC, Atlanta, GA, USA. Transfection plasmids, p3D7, pW2m and p3D7cW2m were constructed by inserting AMA-1 between the PfAMA-1 promoter and the Plasmodium berghei terminator PbDT3¢. Insertion of the human dhfr gene (Fidock and Wellems, 1997) in all plasmids allowed drug selection of transfectant parasites. Parasites were transfected as described previously (Reed et al., 2000b). Genomic DNA was extracted from parasites as described previously (Triglia and Cowman, 1994). The full-length 3D7 and W2mef AMA1 genes were generated by PCR and cloned into the plasmids. The plasmid containing the chimeric 3D7/W2mef AMA-
166 J. Healer et al. 1 gene was constructed by digesting p3D7 with NcoI–PacI and inserting the PCR product generated as follows: 3D7 AMA-1 from amino acids 109–184 with oligonucleotides (i) CGAACCCGCACCACAAGAACAAA and AGGAAAAGCA AAACCTCCATC, W2mef AMA-1 from amino acids 178–260 using oligonucleotides GATGGAGGTTTTGCTTTTCCT and AGGACCATTATTTTCTTGAGCTGC; 3D7 AMA-1 from amino acids 253–420 using oligonucleotides GCAGCTCAAGA AAATAATGGTCCT and (ii) GTAGTAGCAATGTATGATGAATT. The separate fragments were sewn together using oligonucleotides (i) and (ii) to generate a chimeric fragment.
Preparation of recombinant AMA-1 ectodomains, antisera and immunoblots Construction of the 3D7 AMA-1 hexa-his tag expression plasmid has been described previously (Hodder et al., 2001). The W2mef AMA-1 expression plasmid was made in an identical manner. Rabbit anti-AMA-1 sera were generated against high-performance liquid chromatography (HPLC)-purified refolded fusion protein comprising amino acids 25–546 of the 3D7 AMA-1 sequence with an N-terminal hexa-his tag. The primary immunization of 200 mg of protein in Montanide ISA720 was intramuscular, the second and third were subcutaneous. Antisera were purified on a Protein-G Sepharose column (Pharmacia), dialysed against phosphate-buffered saline (PBS), diluted to 5 mg ml-1 and sterilized by filtration. Proteins were extracted from schizont preparations and separated on 10% SDS–PAGE, transferred to nitrocellulose membranes (Schleicher and Schuell) and probed with protein-G-purified anti-3D7 or -W2mef AMA-1 antibodies at a 1:1000 dilution (final concentration 5 mg ml-1) and developed with an enhanced chemiluminescence (ECL) kit (Amersham Pharmacia Biotech).
Reverse-transcriptase PCR RNA was extracted from saponin-lysed (0.15% w/v) late trophozoite-stage parasites using the Rneasy kit (Qiagen). RTPCR was performed using the One-step RT-PCR kit (Qiagen) using the AMA-1-specific oligos GATGGAGGTTTTG CTTTTCCT and AGGACCATTATTTTCTTGAGCTGC, which amplified a 249 bp product in both 3D7 and W2mef strains. Differentiation between alleles was possible because of the presence of an RFLP when digested with PsiI. The chimeric 3D7/W2mef AMA-1 transcript had the W2mef RFLP pattern, allowing detection of transgenic and endogenous transcripts from this parasite line.
Invasion inhibition assays Assays followed a protocol modified from that described by Kocken et al. (2000). Parasites were synchronized twice with 5% sorbitol at 4 h intervals and then grown to trophozoite stage. Haematocrits and parasitaemia were adjusted to 2% and 0.5% respectively. Hypoxanthine-free RPMI was used for assays. Parasites were cultured with antibody diluted in PBS or PBS only in duplicate wells of 96-well flat-bottomed plates. [3H]-hypoxanthine (Amersham Pharmacia) diluted in
hypoxanthine-free RPMI was added to each well (1 mCi per well) and incubated for 18 h. Parasites were freeze–thawed before harvesting onto glassfibre filters and quantified using a scintillation counter. Percentage invasion inhibition was calculated as (mean c.p.m. control wells–mean c.p.m. test wells)/mean c.p.m. (control wells). Assays were performed on three independent occasions.
Statistical analysis Inhibition data were tested for normality using quantile–quantile plots followed by Kolmogorov–Smirnov tests for goodness-of-fit (Sokal and Rohlf, 1995). Data were then subjected to two-way analysis of variance (ANOVA) with parasite line and antibody concentration fitted as between subject factors, followed by sets of multiple pairwise comparisons using Fisher’s Least Significant Difference (LSD) procedure to control the experiment-wise type I error rate.
Acknowledgements We thank the Red Cross Blood Service (Melbourne, Australia) for red cells and serum. This work was supported by the NHMRC of Australia and the Wellcome Trust. We thank Brendan Crabb for critical reading of the manuscript, and Marian Cravino for preparation of figures. J.H. was funded by a Fellowship from the Wellcome Trust. A.B. was supported by a David Symes Fellowship. A.F.C. is a Howard Hughes International Scholar.
References Anders, R.F., Crewther, P.E., Edwards, S., Margetts, M., Matthew, M.L., Pollock, B., and Pye, D. (1998) Immunisation with recombinant AMA-1 protects mice against infection with Plasmodium chabaudi. Vaccine 16: 240–247. Cheng, Q., and Saul, A. (1994) Sequence analysis of the apical membrane antigen 1 (AMA-1) of Plasmodium vivax. Mol Biochem Parasitol 65: 183–187. Coley, A.M., Campanale, N.V., Casey, J.L., Hodder, A.N., Crewther, P.E., Anders, R.F., et al. (2001) Rapid and precise epitope mapping of monoclonal antibodies against Plasmodium falciparum AMA1 by combined phage display of fragments and random peptides. Protein Eng 14: 691– 698. Collins, W.E., Pye, D., Crewther, P.E., Vandenberg, K.L., Galland, G.G., Sulzer, A.J., et al. (1994) Protective immunity induced in squirrel monkeys with recombinant apical membrane antigen-1 of Plasmodium fragile. Am J Trop Med Hyg 51: 711–719. Cortes, A., Mellombo, M., Mueller, I., Benet, A., Reeder, J.C., and Anders, R.F. (2003) Geographical structure of diversity and differences between symptomatic and asymptomatic infections for Plasmodium falciparum vaccine candidate AMA1. Infect Immun 71: 1416–1426. Cowman, A.F., Baldi, D.L., Healer, J., Mills, K.E., O’Donnell, R.A., Reed, M.B., et al. (2000) Functional analysis of proteins involved in Plasmodium falciparum merozoite invasion of red blood cells. FEBS Lett 476: 84–88. © 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 159–168
Evasion of AMA-1 immune responses by P. falciparum Deans, J.A., Knight, A.M., Jean, W.C., Waters, A.P., Cohen, S., and Mitchell, G.H. (1988) Vaccination trials in rhesus monkeys with a minor, invariant, Plasmodium knowlesi 66 kD merozoite antigen. Parasite Immunol 10: 535–552. Dolan, S.A., Proctor, J.L., Alling, D.W., Okubo, Y., Wellems, T.E., and Miller, L.H. (1994) Glycophorin B as an EBA-175 independent Plasmodium falciparum receptor of human erythrocytes. Mol Biochem Parasitol 64: 55–63. Escalante, A.A., Grebert, H.M., Chaiyaroj, S.C., Magris, M., Biswas, S., Nahlen, B.L., and Lal, A.A. (2001) Polymorphism in the gene encoding the apical membrane antigen1 (AMA-1) of Plasmodium falciparum. X. Asembo Bay Cohort Project. Mol Biochem Parasitol 113: 279–287. Fidock, D.A., and Wellems, T.E. (1997) Transformation with human dihydrofolate reductase renders malaria parasites insensitive to WR99210 but does not affect the intrinsic activity of proguanil. Proc Natl Acad Sci USA 94: 10931– 10936. Fraser, T.S., Kappe, S.H., Narum, D.L., VanBuskirk, K.M., and Adams, J.H. (2001) Erythrocyte-binding activity of Plasmodium yoelii apical membrane antigen-1 expressed on the surface of transfected COS-7 cells. Mol Biochem Parasitol 117: 49–59. Hadley, T.J., Klotz, F.W., Pasvol, G., Haynes, J.D., and McGinniss, M.H. (1987) Falciparum malaria parasites invade erythrocytes that lack glycophorin A and B (MkMk). Strain differences indicate receptor heterogeneity and two pathways for invasion. J Clin Invest 80: 1190–1193. Healer, J., Crawford, S., Ralph, S., McFadden, G., and Cowman, A.F. (2002) Independent translocation of two micronemal proteins in developing Plasmodium falciparum merozoites. Infect Immun 70: 5751–5758. Hehl, A.B., Lekutis, C., Grigg, M.E., Bradley, P.J., Dubremetz, J.F., Ortega-Barria, E., and Boothroyd, J.C. (2000) Toxoplasma gondii homologue of Plasmodium apical membrane antigen 1 is involved in invasion of host cells. Infect Immun 68: 7078–7086. Hodder, A.N., Crewther, P.E., Mattew, M.L.S.M., Reid, G.E., Moritz, R.L., Simpson, R.J., and Anders, R.F. (1996) The disulphide bond structure of Plasmodium apical membrane antigen-1. J Biol Chem 271: 29446–29452. Hodder, A.N., Crewther, P.E., and Anders, R.F. (2001) Specificity of the protective antibody response to apical membrane antigen 1. Infect Immun 69: 3286–3294. Howell, S.A., Withers-Martinez, C., Kocken, C.H., Thomas, A.W., and Blackman, M.J. (2001) Proteolytic processing and primary structure of Plasmodium falciparum apical membrane antigen-1. J Biol Chem 276: 31311–31320. Howell, S.A., Wells, I., Fleck, S.L., Kettleborough, C., Collins, C.R., and Blackman, M.J. (2003) A single malaria merozoite serine protease mediates shedding of multiple surface proteins by juxtamembrane cleavage. J Biol Chem 278: 23890–23898. Kennedy, M.C., Wang, J., Zhang, Y., Miles, A.P., Chitsaz, F., Saul, A., et al. (2002) In vitro studies with recombinant Plasmodium falciparum apical membrane antigen 1 (AMA1). Production and activity of an AMA1 vaccine and generation of a multiallelic response. Infect Immun 70: 6948–6960. Kocken, C.H., Narum, D.L., Massougbodji, A., Ayivi, B., Dubbeld, M.A., van der Wel, A., et al. (2000) Molecular char© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 159–168
167
acterisation of Plasmodium reichenowi apical membrane antigen-1 (AMA-1), comparison with P. falciparum AMA-1, and antibody-mediated inhibition of red cell invasion. Mol Biochem Parasitol 109: 147–156. Kocken, C.H., Withers-Martinez, C., Dubbeld, M.A., van der Wel, A., Hackett, F., Blackman, M.J., and Thomas, A.W. (2002) High level expression of the malaria blood-stage vaccine candidate Plasmodium falciparum apical membrane antigen 1 and induction of antibodies that inhibit erythrocyte invasion. Infect Immun 70: 4471–4476. Lal, A.A., Hughes, M.A., Oliveira, D.A., Nelson, C., Bloland, P.B., Oloo, A.J., et al. (1996) Identification of T-cell determinants in natural immune responses to the Plasmodium falciparum apical membrane antigen (AMA-1) in an adult population exposed to malaria. Infect Immun 64: 1054– 1059. Li, F., Dluzewski, A., Coley, A.M., Thomas, A., Tilley, L., Anders, R.F., and Foley, M. (2002) Phage-displayed peptides bind to the malarial protein apical membrane antigen1 and inhibit the merozoite invasion of host erythrocytes. J Biol Chem 277: 50303–50310. Marshall, V.M., Peterson, M.G., Lew, A.M., and Kemp, D.J. (1989) Structure of the apical membrane antigen I (AMA1) of Plasmodium chabaudi. Mol Biochem Parasitol 37: 281–284. Marshall, V.M., Zhang, L.-X., Anders, R.F., and Coppel, R.L. (1995) Diversity of the vaccine candidate AMA-1 of Plasmodium falciparum. Mol Biochem Parasitol 77: 109–113. Mueller, M.S., Renard, A., Boato, F., Vogel, D., Naegeli, M., Zurbriggen, R., et al. (2003) Induction of parasite growthinhibitory antibodies by a virosomal formulation of a peptidomimetic of loop I from domain III of Plasmodium falciparum apical membrane antigen 1. Infect Immun 71: 4749–4758. Nair, M., Hinds, M.G., Coley, A.M., Hodder, A.N., Foley, M., Anders, R., and Norton, R.S. (2002) Structure of domain III of the blood-stage malaria vaccine candidate, Plasmodium falciparum apical membrane antigen 1 (AMA1). J Mol Biol 322: 741. Narum, D.L., and Thomas, A.W. (1994) Differential localization of full-length and processed forms of PF83/AMA-1 an apical membrane antigen of Plasmodium falciparum merozoites. Mol Biochem Parasitol 67: 59–68. O’Donnell, R.A., Saul, A., Cowman, A.F., and Crabb, B.S. (2000) Functional conservation of the malaria vaccine antigen MSP-119 across distantly related Plasmodium species. Nature Med 6: 91–95. O’Donnell, R.A., de Koning-Ward, T.F., Burt, R.A., Bockarie, M., Reeder, J.C., Cowman, A.F., and Crabb, B.S. (2001) Antibodies against merozoite surface protein (MSP)-1 (19) are a major component of the invasion-inhibitory response in individuals immune to malaria. J Exp Med 193: 1403– 1412. Oliveira, D.A., Udhayakumar, V., Bloland, P., Shi, Y.P., Nahlen, B.L., Oloo, A.J., et al. (1996) Genetic conservation of the Plasmodium falciparum apical membrane antigen-1 (AMA-1). Mol Biochem Parasitol 76: 333–336. Peterson, M.G., Marshall, V.M., Smythe, J.A., Crewther, P.E., Lew, A., Silva, A., et al. (1989) Integral membrane protein located in the apical complex of Plasmodium falciparum. Mol Cell Biol 9: 3151–3154.
168 J. Healer et al. Peterson, M.G., Nguyen-Dinh, P., Marshall, V.M., Elliott, J.F., Collins, W.E., Anders, R.F., and Kemp, D.J. (1990) Apical membrane antigen of Plasmodium fragile. Mol Biochem Parasitol 39: 279–284. Polley, S.D., and Conway, D.J. (2001) Strong diversifying selection on domains of the Plasmodium falciparum apical membrane antigen 1 gene. Genetics 158: 1505–1512. Polley, S.D., Chokejindachai, W., and Conway, D.J. (2003) Allele frequency-based analyses robustly map sequence sites under balancing selection in a malaria vaccine candidate antigen. Genetics 165: 555–561. Reed, M.B., Saliba, K.J., Caruana, S.R., Kirk, K., and Cowman, A.F. (2000a) Pgh1 modulates sensitivity and resistance to multiple antimalarials in Plasmodium falciparum. Nature 403: 906–909. Reed, M.B., Caruana, S.R., Batchelor, A.H., Thompson, J.K., Crabb, B.S., and Cowman, A.F. (2000b) Targeted disruption of an erythrocyte binding antigen in Plasmodium falciparum is associated with a switch toward a sialic acid independent pathway of invasion. Proc Natl Acad Sci USA 97: 7509–7514. Riley, E.M., Wagner, G.E., Ofori, M.F., Wheeler, J.G., Akanmori, B.D., Tetteh, K., et al. (2000) Lack of association between maternal antibody and protection of African infants from malaria infection. Infect Immun 68: 5856– 5863. Sachs, J., and Malaney, P. (2002) The economic and social burden of malaria. Nature 415: 680–685. Salvatore, D., Hodder, A.N., Zeng, W., Brown, L.E., Anders, R.F., and Jackson, D.C. (2002) Identification of antigenically active tryptic fragments of apical membrane antigen1 (AMA1) of Plasmodium chabaudi malaria: strategies for assembly of immunologically active peptides. Vaccine 20: 3477–3484. Sokal, R., and Rohlf, F. (1995) Biometry. New York: Freeman. Stowers, A.W., Kennedy, M.C., Keegan, B.P., Saul, A., Long, C.A., and Miller, L.H. (2002) Vaccination of monkeys with
recombinant Plasmodium falciparum apical membrane antigen 1 confers protection against blood-stage malaria. Infect Immun 70: 6961–6967. Thomas, A.W., Deans, J.A., Mitchell, G.H., Alderson, T., and Cohen, S. (1984) The Fab fragments of monoclonal IgG to a merozoite surface antigen inhibit Plasmodium knowlesi invasion of erythrocytes. Mol Biochem Parasitol 13: 187– 199. Thomas, A.W., Waters, A.P., and Carr, D. (1990) Analysis of variation in PF83, an erythrocytic merozoite vaccine candidate antigen of Plasmodium falciparum. Mol Biochem Parasitol 42: 285–288. Thomas, A.W., Trape, J.-F., Rogier, C., Goncalves, A., Rosario, V.E., and Narum, D.L. (1994) High prevalence of natural antibodies against Plasmodium falciparum 83kilodalton apical membrane antigen (PF83/AMA-1) as detected by capture-enzyme-linked immunosorbent assay using full-length baculovirus recombinant PF83AMA-1. Am J Trop Med Hyg 51: 730–740. Triglia, T., and Cowman, A.F. (1994) Primary structure and expression of the dihydropteroate synthetase gene of Plasmodium falciparum. Proc Natl Acad Sci USA 91: 7149– 7153. Triglia, T., Wang, P., Sims, P.F., Hyde, J.E., and Cowman, A.F. (1998) Allelic exchange at the endogenous genomic locus in Plasmodium falciparum proves the role of dihydropteroate synthase in sulfadoxine-resistant malaria. EMBO J 17: 3807–3815. Triglia, T., Healer, J., Caruana, S.R., Hodder, A.N., Anders, R.F., Crabb, B.S., and Cowman, A.F. (2000) Apical membrane antigen 1 plays a central role in erythrocyte invasion by Plasmodium species. Mol Microbiol 38: 706–718. Waters, A.P., Thomas, A.W., Deans, J.A., Mitchell, G.H., Hudson, D.E., Miller, L.H., et al. (1990) A merozoite receptor protein from Plasmodium knowlesi is highly conserved and distributed throughout Plasmodium. J Biol Chem 265: 17974–17979.
© 2004 Blackwell Publishing Ltd, Molecular Microbiology, 52, 159–168
