(Allium fistulosum) and Proposal of Breeding Scheme for - J-Stage

Breeding Science 56 : 321–326 (2006)

Considerable Heterogeneity in Commercial F1 Varieties of Bunching Onion (Allium fistulosum) and Proposal of Breeding Scheme for Conferring Variety Traceability Using SSR Markers Hikaru Tsukazaki*1), Hiroyuki Fukuoka1), Yeon-Sang Song1,2), Ken-ichiro Yamashita1), Tadayuki Wako1) and Akio Kojima1) 1)

2)

National Institute of Vegetable and Tea Science (NIVTS), National Agriculture and Food Research Organization (NARO), 360 AnoKusawa, Tsu, Mie 514-2392, Japan Present address: Mokpo Experiment Station, National Institute of Crop Science, RDA, 293-5 Chungchun Chunggye, Muan, Chonnam 534-830, Korea

DNA markers are powerful tools for verifying the varietal identity and genetic homogeneity of F1 hybrid seeds. F1 varieties are becoming increasingly prevalent in bunching onion (Allium fistulosum L.) production in Japan because of the high uniformity of agronomic traits. However, bunching onion is an allogamous crop and suffers from severe inbreeding depression when selfed. It is considered that not only open-pollinated varieties but also the parental lines of F1 hybrids should maintain a certain degree of average heterozygosity and hence genetic heterogeneity. In the present study, the genetic homogeneity of eight bunching onion varieties, including six F1 hybrids, was evaluated using 14 SSR markers. Two or more polymorphic alleles were detected at all of the SSR loci examined in each variety. The number of alleles detected in the eight varieties ranged from 3 to 7 among the 14 SSR loci, and the polymorphism information content from 0.41 to 0.76. All the varieties examined displayed very low degrees of uniformity at all of these polymorphic loci. Based on these results, it may be impossible to determine an appropriate genotypic identity for any of the existing bunching onion varieties. To facilitate and enhance the accuracy of variety identification, we proposed here an “SSR-tagged breeding” scheme in which the plants homozygous at a few SSR loci would be selected out of a foundation seed field. This scheme may enable to achieve efficient variety identification and purity determination of F1 seeds not only in bunching onion but also in any allogamous crops exhibiting severe inbreeding depression. Key Words: Allium fistulosum, bunching onion, genetic homogeneity, simple sequence repeat, SSR-tagged breeding, traceability.

Introduction To determine the quality of hybrid seeds, seed companies maintain quality control programs that monitor seeds from harvest to purchase (McDonald 1998). Traditionally, grow-out test or morphological comparison of seedlings has been conducted to check the genetic purity of hybrid seeds. However, since these tests are time-consuming and require a large area, a seed purity test based on molecular markers should be developed. These markers are also useful for variety identification and hence for the protection of breeders’ rights. Methods including isozyme (Tanksley and Jones 1981), restriction fragment length polymorphism (RFLP) (Livneh et al. 1990) and random amplified polymorphic DNA Communicated by R. Ohsawa Received January 4, 2006. Accepted May 16, 2006. *Corresponding author (e-mail: [email protected])

(RAPD) analysis (Hashizume et al. 1993, Ballester and de Vicente 1998, Crockett et al. 2000, 2002) have all been used to test hybrid purity. Although isozyme analysis is simple and easy, it does not enable to effectively detect polymorphisms between closely related genotypes (Crockett et al. 2000). Although the RFLP method is highly reliable, it displays the limitations of most routine commercial testing; specifically, being time-consuming, labor-intensive and requiring complex procedures. In comparison, PCR-based techniques are simple, fast and easily automated. Because of its remarkable simplicity and rapidity, the RAPD technique is currently widely used for detecting DNA polymorphisms. However, RAPD method is associated with some problems as well, including the low reproducibility of some bands, and uncertainty in the homology of some fragments co-migrating in gel electrophoresis experiments (Klaas and Friesen 2002). In contrast, simple sequence repeats (SSRs), also called microsatellites or simple tandem repeats (STRs), are very useful because of

322

Tsukazaki, Fukuoka, Song, Yamashita, Wako and Kojima

their codominant mode of inheritance, higher reliability over RAPDs and abundance in genomes (Jones et al. 1997). SSRs are used for linkage map construction, marker-assisted selection, diversity studies and genomic synteny analysis. Moreover, SSR markers can also be applied to variety identification (Bredemeijer et al. 1998, Meesang et al. 2001, Rajora and Rahman 2003). In the genus Allium, Fischer and Bachmann (2000) first reported the isolation of SSRs from bulb onion (A. cepa L. Common onion group). In a previous study, we isolated a large number of SSRs from a genomic library of bunching onion (A. fistulosum L., Song et al. 2004), some of which were used for constructing a linkage map (Ohara et al. 2005). More recently, hundreds of expressed sequence tag (EST)-derived SSR markers have been developed from an analysis of a bulb onion cDNA library (Kuhl et al. 2004, Martin et al. 2005). Bunching onion is considered to have originated in northwestern China and is mainly cultivated in East Asian countries, particularly in Japan, China and Korea (Kumazawa and Katsumata 1965, Ford-Lloyd and Armstrong 1993). In Japan, bunching onion accounts for the fourth highest annual output among vegetables, following tomato, strawberry and cucumber (MAFF 2005). Bunching onion is a typical allogamous crop arising from protandry, resulting in a high rate of outcrossing (Ford-Lloyd and Armstrong 1993). It is self-compatible, but suffers from severe inbreeding depression when self-pollinated. Open-pollinated (OP) varieties of bunching onion exhibit very high degrees of genetic heterogeneity (Haishima et al. 1993). Parental lines of F1 hybrids may also maintain a certain degree of genetic heterogeneity. The objective of the present study was to determine whether the SSR markers can be applied to F1 purity test in bunching onion by investigating the level of genetic uniformity of commercial F1 varieties. Furthermore, a breeding scheme was proposed to confer traceability that would allow for easy identification and/or seed purity determination of varieties using SSR markers.

Materials and Methods Plant materials Eight varieties of bunching onion (6 F1 varieties, 1 OP variety, ‘Yoshikura’ and 1 landrace, ‘Ojima’) and one acces-

sion of A. altaicum Pall., JP138870, which is the closest species and is considered to be the wild progenitor of A. fistulosum (Friesen et al. 1999), were used (Table 1). Seeds were sown in 200-cell plug trays (one seed per plug), and the seedlings were transplanted to the field at seven weeks after sowing. All the eight varieties belonged to “Senju”, the most popular varietal group of bunching onion in Japan. The A. altaicum accession was introduced from Almaty Botanical Garden, Kazakhstan, in 1997, and propagated by open-pollination at NIVTS. DNA extraction and PCR amplification Total DNA was extracted from 0.1 g of fresh leaf tissues from 3-month-old plant (randomly selected 33 plants/ variety) using a Nucleon PhytoPure kit (Amersham Biosciences, NJ, USA). To remove the polysaccharides, the DNA solution was purified with a resin. Fourteen SSR markers were used for DNA fingerprinting (Table 2). These SSR loci were highly polymorphic among nine bunching onion varieties (Song et al. 2004). The details of the PCR conditions and acrylamide gel electrophoresis of the PCR products were described previously by Song et al. (2004). Evaluation of genetic uniformity The degree of DNA polymorphism at each SSR locus was evaluated, based on the polymorphic information content (PIC). The PIC value was calculated for each SSR locus according to the formula (Anderson et al. 1993); k

2

Pi , PIC = 1 − i ∑ =1

where k is the total number of alleles detected for a locus and Pi is the frequency of the ith allele in the set of eight bunching onion varieties, 33 plants each, investigated. For evaluating the genetic homogeneity, the number of alleles, the number of genotypes determined and the proportion of plants exhibiting the prevailing genotype (Pr%) were calculated for each variety. When more than 5% of the individuals in a variety carried any other alleles than the prevailing one, the locus was defined as polymorphic in the variety. For each variety, the frequency of heterogeneous loci was represented by the proportion of polymorphic loci (Pl) among the 14 SSR loci investigated.

Table 1. Plant materials used Species A. fistulosum

A. altaicum

Varieties

Type

Seed company (Genebank)

Fuyuougi 2 Natsubasyo Natsuougi 2 Shuitsu White Tower Yuzan Yoshikura Ojima JP138870

F1 F1 F1 F1 F1 F1 OP landrace

Sakata Seed Kaneko Seed Sakata Seed Musashino Seed Takii Seed Tokita Seed Musashino Seed NIAS NIAS

Accession No.

Seed production year

JP25445 JP138870

1997 1999 1998 2001 1998 1998 2000 1998 2000

Proposal of breeding scheme for conferring variety traceability

323

Table 2. Primer sequences of 14 SSR markers used Markers AFS039 AFS096 AFS099 AFS104 AFS105 AFS110 AFS111 AFS123 AFS131 AFS142 AFS145 AFS146 AFS149 AFS152 1) 2) 3)

Forward and reverse primer sequences (5′-3′)

Motif

cgggtaataacggatatcataaaca (at)8 cagttgttacatgtggtatcagagc ccaagtattgggtggtcaaagtaca (ac)12a(ct)3 tcacaagagagtgtgtgtgtgtgtg atgcccctcattaataacaacatgac (ac)13(at)8 ttaatcgcattgacaaagtttattt actcaaggaaacacgtatgccact (ac)7 tcgcccttttagattcatttcc actttcgttgcaaacatttacacacac (ac)3aa(ac)10 gtggagtttacttccccaaatgaag ttttgaagttttgccctttttatcc (gt)3ata(tg)9 tcatgacaccatgtgtctctatgtct tgtttaatggactttcaatgcctgt (tg)8 gcattaaaatgaagaaatcccgaag tctccagatttttcctaagctct (tg)9tc(ta)9 tgggatttacatcgcaacat caacaaatcagagagaaacagatga (ac)8 actgtatatttatgtatcactccatgtaaa tgagagaattaatattattggaggcctat (ac)11(at)5gt(ta)8 ataaaatgacaaccaacccatgtta acccttgggataagtggtttattga (ac)9 ggtcatgagtaattcaccgaacatt attcagatgactcacaggaatgacc (ac)10aa(taa)4 ggagaaggcctggtcctatgtaag aaccaattgattacctctcatctgc (ac)11(at)7 tgcggaccttccatagtctgtataa tttcgaacttttgactttcatcgtc (ac)8 acaaggatgagttgtcatgttgtga

Origin 2)

3)

1)

1)

1)

1)

1)

1)

2)

2)

3)

Fig. 1. Example of polymorphism among 24 plants, each from four varieties of bunching onion, detected at a SSR locus AFS131. PCR products were separated on 5% denatured polyacrylamide gels. Asterisks indicate the prevailing genotype in each variety. Table 3. Polymorphisms of 14 SSR loci among eight bunching onion varieties

3)

Locus

No. of alleles

PIC

Locus

No. of alleles

PIC

AFS039 AFS096 AFS099 AFS104 AFS105 AFS110 AFS111

5 5 5 3 5 3 4

0.57 0.66 0.57 0.64 0.66 0.54 0.47

AFS123 AFS131 AFS142 AFS145 AFS146 AFS149 AFS152

7 3 5 3 4 5 3

0.62 0.60 0.76 0.41 0.54 0.68 0.54

Mean

4.3

0.59

3)

3)

Song et al. (2004). Ohara et al. (2005). Developed in this study.

Results All the SSR primer sets used amplified one or two bands in each plant, revealing polymorphism and genetic heterogeneity in each variety (Fig. 1). Within the eight bunching onion varieties, the PIC values of the SSR markers ranged from 0.41 to 0.76 among the 14 loci with an average value of 0.59 (Table 3). The number of alleles detected at each locus varied among the varieties and SSR loci, ranging from 3 to 7 among the eight varieties with an average value of 4.3 (Table 3). A. altaicum-specific alleles were detected at three loci (AFS096, 146 and 149; data not shown). The number of alleles within each variety at each locus ranged from 2 to 7 with an average value of 3.1 (Table 4). The number of genotypes within each variety ranged from 1 to 15 with an average value of 4.1. In the landrace ‘Ojima’, 7 alleles were detected and thereby 15 genotypes were found at the AFS123 locus. The Pr% values averaged over the 14 SSR loci ranged from 45 to 73 in the eight varieties, with an average value of 58. Even though the F1 varieties were found to be highly heterogeneous, the landrace ‘Ojima’ and the OP

variety, ‘Yoshikura’, were still more heterogeneous. The average Pr% scores showed that three of the F1 varieties, ‘Yuzan’, ’Natsubasho’ and ’White Tower’, were as heterogeneous as the OP variety, the landrace variety and even the A. altaicum accession studied (Table 4). Among the 112 loci (8 varieties × 14 SSRs) studied, only 4 loci were found to be genetically uniform in at least one variety. ‘Natsuougi 2’ at the AFS104 and AFS145 loci and ‘Shuitsu’ at the AFS105 and AFS110 loci were highly homogeneous. Of them, ‘Natsuougi 2’ at AFS145 was highly homozygous, whereas heterozygous at other loci. However, the other loci in these varieties were polymorphic, as was the case for most of the SSR loci studied in the bunching onion varieties, including the F1 varieties. As a result, the Pl value was very high (86 or 100%) in all the varieties investigated (Table 4).

Discussion Although bunching onion is self-compatible, it is protandrous and usually insect-pollinated, exhibiting a high

324


Table 4. No. of alleles, genotypes, proportion of plants exhibiting the prevailing genotype (Pr%) and proportion of polymorphic loci (Pl) using 14 SSR markers in bunching onion Species A. fistulosum

Variety Fuyuougi 2 (F1) Natsubasyo (F1) Natsuougi 2 (F1) Shuitsu (F1) White Tower (F1) Yuzan (F1) (Mean of 6 F1 varieties) Yoshikura (OP) Ojima (landrace) (Mean of 8 varieties)

A. altaicum

JP138870 Mean

No. of alleles

No. of genotypes

Pr%

Max.

Min.

Avg.

Max.

min.

Avg.

Max.

Min.

Avg.

4 5 4 4 6 4

2 2 2 2 2 2

2.7 3.1 2.9 2.9 3.3 3.1

6 7 5 5 7 5

2 2 1 1 2 2

3.4 4.5 3.4 3.2 3.4 4.1

97 84 100 100 88 70

23 39 45 31 27 30

63 56 70 73 56 49

Pl 100 100 86 86 100 100

4.5

2

3.0

5.8

1.7

3.7

90

32

61

95

5 7

2 2

3.2 3.6

9 15

2 2

5.1 5.6

88 80

28 18

50 45

100 100

4.9

2

3.1

7.4

1.8

4.1

88

30

58

96

6

2

3.4

7

2

4.6

82

27

49

100

5.0

2

3.1

7.3

1.8

4.1

88

30

57

97

rate of outcrossing (Kumazawa and Katsumata 1965, FordLloyd and Armstrong 1993). Therefore, it is considered that the landraces and OP varieties of bunching onion maintain high levels of heterozygosity and heterogeneity. It was previously reported that very high degrees of genetic heterogeneity occurred within landrace varieties of bunching onion (Haishima et al. 1993) and bulb onion (Rouamba et al. 2001) based on an isozyme study. We used SSR markers for the evaluation of the degree of genetic heterogeneity. The number of alleles and the PIC value at each SSR locus showed that SSRs were highly polymorphic (Table 3). A high degree of heterogeneity was also found even in the commercial F1 varieties (Fig. 1 and Table 4). In the present study, the Pr% value, instead of the degree of heterozygosity (He, Nei 1973), was used for the evaluation of the degree of heterogeneity, since F1 varieties can be highly homogeneous, even though completely heterozygous. If an F1 variety is produced by crossing two pure lines, the variety should be homogeneous at all the loci, regardless of homozygosity or heterozygosity for the locus. In the present study, however, more than two genotypes were found at significant frequencies at most of the loci in each variety. Not only OP or landrace varieties but also F1 varieties showed very high Pl values (Table 4). It was, therefore, considered that most of, if not all, the parental lines of existing F1 varieties of the bunching onion were not genetically uniform. In F1 seed production of bulb onion, parental lines are usually maintained by open-pollination of lines selfed only two or three times to avoid inbreeding depression (Jakše et al. 2005). It is considered that the same procedure could be applied to bunching onion breeding. In addition, some F1 hybrid seeds may be produced by a three-way cross or double cross in order to decrease the cost of seed production. The present results have revealed how closely bunching onion breeders paid attention to avoid inbreeding depression, and demonstrated that it is impossible to determine an appropriate genotypic identity for any existing bunching onion variety.

In general, the agronomic traits of F1 varieties are more uniform than those of OP and landrace varieties. We confirmed that the bunching onion F1 varieties tended to be more genetically uniform than the OP and landrace varieties (Table 4). However, since bunching onion breeding takes many years (usually 1–2 years per generation) and bunching onion shows severe inbreeding depression, it is very difficult to produce pure lines of bunching onion. Moreover, the F1 purity test, based on grow-out test or morphological comparison of bunching onion seedlings, is time-consuming and requires a large area because of the extremely slow growth of the plants. We, therefore, proposed here a “SSR-tagged breeding” scheme to enhance the rapidity, ease and accuracy of variety identification and F1 purity test in bunching onion (Fig. 2). This scheme consists of the following four steps; 1. Selection of a small number of highly polymorphic SSR loci that are not tightly linked to each other. Selection of the prevailing allele at each locus, since the parental lines of the F1 hybrids must carry different alleles at each selected locus. 2. Selection of the plants in a foundation seed field that are homozygous for the prevailing allele at all the SSR loci selected. 3. Harvest of foundation seeds from the plants selected. For F1 breeding, one parental line should be homozygous at each selected SSR locus, and the other should be homozygous for another allele. 4. Production of stock seeds and then marketing of seeds. OP varieties should be homozygous and uniform at the selected SSR loci, and F1 varieties should be uniformly heterozygous. OP varieties and the parental lines of the F1 varieties developed by this scheme should not exhibit significant inbreeding depression, since most of the loci can maintain their original heterogeneity. Varieties developed using this scheme can be efficiently identified by examining individuals for the desired genotypes at a few SSR loci. In addition, the purity of F1 seeds

Proposal of breeding scheme for conferring variety traceability

325

Fig. 2. The “SSR-tagged breeding” scheme to achieve variety identification and F1 purity test in bunching onion. In bunching onion breeding, most of the F1 seeds are produced by using the cytoplasmic male sterility (CMS) system as in bulb onion. In this case, the top and the bottom loci are selected and genetically fixed into a genotype denoted by a white circle for the seed parent and black circle for the pollen parent. These two parental lines are crossed to produce F1 hybrid seeds, which are heterozygous and homogeneous at the selected loci but heterogeneous at many others. For F1 purity test or variety identification, these selected loci can be used.

can be rapidly and accurately evaluated, based on the degree of uniformity at the selected SSR loci. This scheme can be applied to any allogamous crops in which inbreeding depression is as severe as in bunching onion. Our “SSR-tagged breeding” scheme could be useful for protecting breeder’s rights and also for conferring variety traceability in such crops.

Acknowledgements We are grateful to Ms. K. Tanaka and Ms. M. Ikeyama for their skillful technical assistance in DNA extraction and PCR amplification. This work was supported by the Postdoctoral Fellowship for Foreign Researchers (PB 01110), Japan Society for the Promotion of Science granted to YS Song, and by the project titled: “Integrated Research Program for Functionality and Safety of Food Toward an Establishment of Healthy Diet” (I-206), Ministry of Agriculture, Forestry and Fisheries, Japan.

Literature Cited Anderson, J.A., G.A. Churchill, J.E. Autrique, S.D. Tanksley and M.E. Sorrells (1993) Optimizing parental selection for genetic linkage maps. Genome 36: 181–186. Ballester, J. and M.C. de Vicente (1998) Determination of F1 hybrid seed purity in pepper using PCR-based markers. Euphytica 103: 223–226. Bredemeijer, G.M.M., P. Arens, D. Wouters, D. Visser and B. Vosman (1998) The use of semi-automated fluorescent microsatellite

analysis for tomato cultivar identification. Theor. Appl. Genet. 97: 584–590. Crockett, P.A., P.L. Bhalla, C.K. Lee and M.B. Singh (2000) RAPD analysis of seed purity in a commercial hybrid cabbage (Brassica oleracea var. capitata) cultivar. Genome 43: 317–321. Crockett, P.A., M.B. Singh, C.K. Lee and P.L. Bhalla (2002) Genetic purity analysis of hybrid broccoli (Brassica oleracea var. italica) seeds using RAPD PCR. Aust. J. Agric. Res. 53: 51–54. Fischer, D. and K. Bachmann (2000) Onion microsatellites for germplasm analysis and their use in assessing intra- and interspecific relatedness within the subgenus Rhizirideum. Theor. Appl. Genet. 101: 153–164. Ford-Lloyd, B.V. and S.J. Armstrong (1993) Welsh onion Allium fistulosum L. In “Genetic Improvement of Vegetable Crops” Kalloo, G. and B.O. Bergh (eds.), Pergamon Press, London. p. 51–58. Friesen, N., S. Pollner, K. Bachmann and F.R. Blattner (1999) RAPDs and non-coding chloroplast DNA reveal a single origin of the cultivated Allium fistulosum from A. altaicum (Alliaceae). Am. J. of Bot. 86: 554–562. Haishima, M., J. Kato and H. Ikehashi (1993) Isozyme polymorphism in native cultivars of Japanese bunching onion (Allium fistulosum L.). Jpn. J. Breed. 43: 537–547. Hashizume, T., T. Sato and M. Hirai (1993) Determination of genetic purity of hybrid seed in watermelon (Citrullus lanatus) and tomato (Lycopersicon esculentum) using randon amplified polymorphic DNA (RAPD). Jpn. J. Breed. 43: 367–375. Jakše, J., W. Martin, J. McCallum and M.J. Havey (2005) Single nucleotide polymorphisms, indels, and simple sequence repeats for onion cultivar identification. J. Amer. Hort. Sci. 130: 912–917. Jones, C.J., K.J. Edwards, S. Castaglione, M.O. Winfield, F. Sala et al. (1997) Reproducibility testing of RAPD, AFLP and SSR

326


markers in plants by a network of European laboratories. Mol. Breed. 3: 381–390. Klaas, M. and N. Friesen (2002) VIII. Molecular markers in Allium. In “Allium crop science: Recent advances” Rabinowitch,H.D. and L.Currah (eds.), CABI international, Wallingford, Oxon. p. 159–185. Kuhl, J.C., F. Cheung, Q. Yuan, W. Martin, Y. Zewdie, J. MaCallum, A.Catanach, P. Rutherford, K.C. Sink, M. Jenderk, J.P. Prince, C.D. Town and M.J. Havey (2004) A unique set of 11,008 onion expressed sequence tags reveals expressed sequence and genomic differences between the monocot orders Asparagales and Poales. Plant Cell 16: 114–125. Kumazawa, S. and H. Katsumata (1965) Negi (Japanese bunching onion). In “Sosai-engei kakuron (Vegetable crops)” Kumazawa, S. (ed.), Yokendo press, Tokyo (in Japanese), p. 280–289. Livneh, O., Y. Nagler, Y. Tal, S.B. Harush, Y. Gafni, J.S. Beckmann and I. Sela (1990) RFLP analysis of a hybrid cultivar of pepper (Capsicum annuum) and its use in distinguishing between parental lines and in hybrid identification. Seed Sci. and Tech. 18: 209–214. MAFF (2005) Nousanbutsu-Sanshutsugaku no Jun-I (The ranking of vegetables for annual output in Japan). In “Pocket Nourinsuisan Toukei, 2005” (in Japanese). http://www.tdb.maff.go.jp/ toukei/toukei Martin, W.J., J. McCallum, M. Shigyo, J. Jakše, J.C. Kuhl, N. Yamane, M. Pither-Joyce, A.F. Gökçe, K.C. Sink, C.D. Town and M.J. Havey (2005) Genetic mapping of expressed sequences in onion and in silico comparisons with rice show scant colinearity.

Mol. Gen. Genomics 274: 197–204. McDonald, M.B. (1998) Seed quality assessment. Seed Sci. Res. 8: 265–275. Meesang, N., S.L. Ranamukhaarachchi, M.J. Petersen and S.B. Andersen (2001) Soybean cultivar identification and genetic purity analysis using microsatellite DNA markers. Seed Sci. and Tech. 29: 637–645. Nei, M. (1973) Analysis of gene diversity in subdivided populations Proc. Natl. Acad. Sci. USA 70: 3321–3323. Ohara, T., Y.S. Song, H. Tsukazaki, T. Wako, T. Nunome and A. Kojima (2005) Construction of a genetic linkage map of Japanese bunching onion (Allium fistulosum) based on AFLP and SSR markers. Euphytica 144: 255–263. Rajora, O.P. and M.H. Rahman (2003) Microsatellite DNA and RAPD fingerprinting, identification and genetic relationships of hybrid poplar (Populus × canadensis) cultivars. Theor. Appl. Genet. 106: 470–477. Rouamba, A., M. Sandmeier, A. Sarr and A. Ricroch (2001) Allozyme variation within and among populations of onion (Allium cepa L.) from West Africa. Theor. Appli. Genet. 103: 855–861. Song, Y.S., K. Suwabe, T. Wako, T. Ohara, T. Nunome and A. Kojima (2004) Development of microsatellite markers in Japanese bunching onion (Allium fistulosum L.). Breed. Sci. 54: 361– 365. Tanksley, S.D. and R.A. Jones (1981) Application of alcohol dehydrogenase allozymes in testing the genetic purity of F1 hybrids of tomato. HortSci. 16: 179–181.