Allopurinol Attenuates Oxidative Stress and Cardiac Fibrosis in ...

RESEARCH

Allopurinol Attenuates Oxidative Stress and Cardiac Fibrosis in Angiotensin II-Induced Cardiac Diastolic Dysfunction Nan Jia,1,2 Peixin Dong,3 Ying Ye,1 Cheng Qian2 & Qiuyan Dai2 1 Ruijin Hospital, Shanghai Institute of Hypertension, Shanghai Jiao Tong University Medical School, Shanghai, China 2 Department of Cardiology, Shanghai Jiao Tong University Affiliated First People’s Hospital, Shanghai, China 3 Hospital and Institute of Obstetrics and Gynecology, Fudan University Shanghai Medical College, Shanghai, China

Keywords Allopurinol; Diastolic dysfunction; Fibrosis; Oxidative stress; TGF-β1. Correspondence Nan Jia, M.D., Ph.D., Ruijin Hospital, Shanghai Institute of Hypertension, Shanghai Jiao Tong University Medical School, China 200025. Tel.: +86-21-6324-1377; Fax: +86-21-6324-3749; E-mail: [email protected]

doi: 10.1111/j.1755-5922.2010.00243.x

SUMMARY Aims: Oxidative stress and fibrosis is implicated in cardiac remodeling and failure. We tested whether allopurinol could decrease myocardial oxidative stress and attenuate cardiac fibrosis and left ventricular diastolic dysfunction in angiotensin II (AngII)-induced hypertensive mice. Methodology: We used 8-week-old male C57BL/6J mice, in which angiotensin II was subcutaneously infused for 4 weeks to mimic cardiac remodeling and fibrosis. They were treated with either normal saline or allopurinol in daily doses, which did not lower blood pressure. Results: Allopurinol improved diastolic dysfunction in angiotensin II-induced hypertensive mice, which was associated with the amelioration of cardiac fibrosis. However, allopurinol showed no effect on the increased systolic blood pressure by angiotensin II infusion. The ratio of reduced glutathione (GSH) to oxidized glutathione (GSSG) [GSH/GSSG] was decreased and malondialdehyde levels were increased in the hearts of AngII-treated mice. Allopurinol also inhibited both the decrease in the GSH/GSSG ratio and the increase in malondialdehyde levels in the heart. Infusion of AngII-induced upregulation of transfer growth factor (TGF)-β1, Smad3 expression and downregulation of Smad7 expression. Treatment with allopurinol reduced cardiac levels of TGF-β1, Smad3, and increased Smad7 expression. Conclusions: These results suggest that allopurinol prevents pathological remodeling of the heart in AngII-induced hypertensive mice. The antioxidative effect of allopurinol contributes to the regression of AngII-induced cardiac diastolic dysfunction. These effects of allopurinol to prevent cardiac fibrosis are mediated at least partly through modulation of the TGF-β1/Smad signaling pathway.

Introduction Hypertension significantly contributes to cardiovascular morbidity and mortality by causing substantial structural and functional adaptations, including left ventricular diastolic dysfunction. Nearly 50% of all patients with chronic heart failure have diastolic dysfunction with high morbidity and mortality rates. Diastolic heart failure (DHF) is a significant healthcare problem. Diastolic dysfunction may well precede development of left ventricular hypertrophy in hypertension and possibly is characteristic of an important pathophysiologic link between hypertension and heart failure with preserved ejection fraction [1]. No specific therapeutic regimen has shown to benefit patients who have heart failure with preserved ejection fraction, and thus there is a need to understand the potential mechanisms primarily responsible for this clinical syndrome. On the other hand, there are few studies that provide any guidance or instruction in the treatment of this patient population. The pathophysiology and treatment of DHF is

c 2010 Blackwell Publishing Ltd

poorly understood. The angiotensin II-induced hypertensive mice has been used as a model for investigating the characteristics of myocardial hypertrophy, the transition to heart failure, and has been proposed as a model for studying DHF, because it has been established that early in the course of hypertension heart failure occurs, whereas ejection fraction (EF) remains preserved [2]. Oxidative stress is an important contributor to pathological remodeling in the failing heart [3]. Allopurinol is a xanthine oxidase (XO) inhibitor that blocks the superoxide production generated in the XO system. Recent reports indicate that chronic treatment with allopurinol in rodent models of postinfarction HF prolongs survival, improves contractile function and attenuates left ventricular (LV) remodeling [4]. These benefits occurred together with suppression of the enhanced XO activity, superoxide generation, and oxidative protein modifications seen in HF. Although the benefits of allopurinol are thought to be secondary to XO inhibition, other mechanisms may also be operative such as allopurinol-mediated hydroxyl radical scavenging and suppression of uric acid levels

Cardiovascular Therapeutics 30 (2012) 117–123

117

N. Jia et al.

Allopurinol Attenuates Oxidative Stress and Cardiac Fibrosis

and concomitant inflammatory activation [5]. However, it has remained unknown whether allopurinol improves diastolic dysfunction in AngII-induced cardiac hypertrophy. In this study, we have investigated the effects of allopurinol on myocardial oxidative stress and cardiac fibrosis in the LV myocardium. We also examined the expression of TGF-β1 and Smad, which have pivotal roles in the development of AngII-induced cardiac fibrosis.

Materials and Methods Animals and Treatment In our study, all animal protocols were approved by our Institutional Animal Care and Use Committee. Eight-week-old male C57BL/6J wild-type mice (n = 44) were purchased and given standard laboratory chow and tap water ad libitum. The mice were randomly divided into four groups and were treated over a 4-week period. Each of the four groups received the following treatment: oral normal saline and saline pump (control; n = 11), oral allopurinol (Allo; 30 mg/kg per day of body weight; E. Merck, Darmstadt, Germany) and saline pump (Allo; n = 11), oral normal saline and angiotensin II (AngII; 2 mg/kg per minute) pump (AngII; n = 11), and oral allopurinol (Allo; 30 mg/kg per day of body weight) and AII (2 mg/kg per minute) pump (AngII+Allo n = 11). The mice were anesthetized with 0.01 mL/g of a mixture of ketamine and xylazine prior to subcutaneous placement of a miniosmotic pump (Alzet model 2004, DURECT Corporation, Cupertino, USA). The mice were fed either normal saline or allopurinol daily by means of gavage.

Blood Pressure and Heart Rate Systolic blood pressure (SBP) and heart rate (HR) measurements were made at the end of the study using a tail-cuff system (Visitech Systems, Apex, NC, USA). A minimum of five preliminary cycles were performed before collecting 10 measurements for each mouse.

Echocardiographic Analysis Transthoracic echocardiography was performed at the end of the study using an EUB 8000 echocardiographic instrument (HitachiMedico, Tokyo, Japan). Mice were anaesthetized with pentobarbiturate (70 mg/kg, i.p.). End-diastolic left ventricular internal diameter (LVDd), end-systolic left ventricular internal diameter (LVDs) and left ventricular posterior wall thickness (PW) were measured. To estimate the cardiac systolic function, percentage fractional shortening (FS%) was calculated as follows: FS% = ((LVDd − LVDs)/LVDd) × 100. The left lateral position was used to obtain an optimal Doppler image quality. The LV inflow tract was interrogated from the apical four-chamber view with the sample volume at the tips of the mitral leaflets. The E wave velocity (E/A) ratio and isovolumic relaxation time (IRT) were measured as estimates of the cardiac diastolic function.

118


Histomorphological Investigations For histological analysis, hearts were fixed with 10% formalin by perfusion fixation. Fixed hearts were embedded in paraffin, sectioned at 4 μm and stained with Masson’s trichrome (MT) to enable investigation of the overall morphology and fibrosis. The myocyte cross-sectional area (CSA) was determined in 50 cells per animal from the left ventricular lateral-mid free wall (including epicardial and endocardial portions), which were chosen at random. The collagen fraction was calculated as the ratio of the sum of the total area of interstitial fibrosis to the sum of the total connective tissue area plus the myocyte area in the entire visual field of the section. Approximately 40 arterial cross-sections were examined in each heart [6].

Assay of Oxidative Stress LV homogenates were used for assay. The tissue level of total glutathione (reduced glutathione/oxidized glutathione [GSH/GSSG]) in the LV was determined by the glutathione reductase and 5, 5V-dithiobis-(2-nitrobenzoic acid) recycling assay. The amount of GSSG was determined by Griffith’s method. The activity of glutathione peroxidase (GPx) was determined by using hydrogen peroxide as the substrate, and the rate of disappearance of NADPH was recorded spectrophotometrically (340 nm) at 37◦ C. The lipid peroxide content of the LV was determined by estimation of malondialdehyde (MDA) contents. Myocardial tissues were homogenized in phosphate-buffered saline (pH 7.4) containing butylated hydroxytoluene (4 mmol/L). MDA was determined using the Bioxytech MDA assay kit (BIOXYTECH MDA-586, Oxis International, Portland, OR).

RNA Extraction and Real-Time Quantitative Reverse Transcription–Polymerase Chain Reaction RNA was isolated according to the TRIZOL protocol (Gibco Life Technologies, Gaithersburg, MD, USA). The RNA was dissolved in diethylpyrocarbonatetreated water, quantified spectrophotometrically at 260 nm and stored at −80◦ C. Reverse transcription–polymerase chain reaction (RT-PCR) of left atrial samples of mice was performed according to the Omniscript Reverse Transcription Handbook (Qiagen, Hilden, Germany). The mouse primers and probes used for quantification of TGF-β1, Smad3, Smad7 and glyceraldehyde-3-phosphatedehydrogenase (GAPDH), as an internal control, were designed according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA, USA). The following primers were used: TGFβ1 forward primer GCTAATGGTGGACCGCAACAACG, TGFβ1 reverse primer CTTGCTGTACTGTGTGTCCAGGC; Smad3 forward primer GGGCCTACTGTCCAATGTCAA, Smad3 reverse primer CGCACACCTCTCCCAATGT; Smad7 forward primer CTGACGCGGGAAGTGGAT, Smad7 reverse primer TGGCGGACTTGATGAAGATG; GAPDH forward primer GCCCATCACCATCTTCCAG, GAPDH reverse primer TGAGCCCTTCCACAATGCC. Real-time quantitative RT-PCR was performed with an ABI PRISM7700 Sequence Detection System (Applied Biosystems) by the relative standard curve


N. Jia et al.


method. The target amount was determined from the relative standard curves constructed with serial dilutions of control total RNA.

Statistics Data are presented as the mean ± SEM. Comparisons between groups were made by one-way anova, followed by Fischer’s least significance post hoc test or Student’s unpaired t-test. P < 0.05 was considered significant.

Results Systolic Blood Pressure and HR The effects of treatment on SBP and HR are summarized in Table 1. Angiotensin II treatment increased SBP in mice and allopurinol treatment did not reduce the AngII-induced increase in SBP. There were no significant differences in HR between the four groups.

Cardiac Function and Remodeling To investigate cardiac function, we performed echocardiographic examinations; results are given in Table 2. Left ventricular hypertrophy (LVH), as determined by PW, was clearly induced by AngII treatment of mice. This AngII-induced LVH was clearly inhibited by allopurinol treatment of mice. The end-diastolic LV diameter and LVDs did not differ between any of the groups. Left ventricular systolic function was measured as FS%. The values for normal FS% in mice were consistent with those in previous reports [7] and there were no significant differences in FS% between the four groups. However, the E/A ratio was reduced and c-IRT was prolonged in the AngII group, indicating that there was some evidence of diastolic dysfunction after angiotensin II administration. Finally, the data show that allpurinol treatment did improve the diastolic dysfunction caused by administration of angiotensin II. Left ventricular weight/bodyweight (LVW/BW) ratios are given in Table 1. Angiotensin II treatment of mice increased the LVW/BW

Table 1 Bodyweight, systolic blood pressure, heart rate, left ventricular weight: bodyweight ratio, myocyte cross-sectional area

Bodyweight (g) Before At 4 weeks SBP (mmHg) HR (b.p.m.) LVW/BW (mg/g) Myocyte CSA (μm2 )

Table 2 Echocardiographic measurements

PW (mm) LVDd (mm) LVDs (mm) FS% E/A ratio c-IRT (msec)

Control

Allo

AngII

AngII + Allo

0.47 ± 0.04 3.13 ± 0.16 1.53 ± 0.15 51.61 ± 1.41 2.647 ± 0.152 0.12 ± 0.01

0.46 ± 0.05 3.11 ± 0.17 1.48 ± 0.16 51.81 ± 1.33 2.629 ± 0.212 0.12 ± 0.02

0.89 ± 0.09∗ 3.07 ± 0.13 1.49 ± 0.13 51.72 ± 1.42 2.207 ± 0.153∗ 0.16 ± 0.02∗

0.68 ± 0.07∗† 3.05 ± 0.16 1.47 ± 0.12 52.51 ± 1.22 2.573±0.437† 0.11 ± 0.03†

Values are the mean ± SEM (n = 11 in each group). ∗ P < 0.05 compared with the control and the allopurinol (Allo) group; † P < 0.05 compared with the angiotensin (Ang) II group. PW, posterior wall thickness; LVDd, enddiastolic left ventricular internal diameter; LVDs, end-systolic left ventricular internal diameter; E/A ratio, E wave velocity ratio; FS%, percentage fractional shortening; c-IRT, cardiac isovolumic relaxation time.

ratio. The AngII-induced increase in the LVW/BW ratio was significantly inhibited by Allopurinol treatment. In addition, AngII treatment increased myocyte CSA in mice and, allopurinol treatment did not reduce this AngII-induced increase (Table 1).

Cardiac Fibrosis Representative photomicrographs of the heart are shown in Figure 1. Interstitial fibrosis was significantly increased after AngII treatment in mice and treatment with allopurinol almost completely abolished the AngII-induced increase in interstitial fibrosis.

Myocardial Oxidative Stress The GSH/GSSG ratio was decreased and MDA levels were increased after AngII treatment in mice, indicative of increased myocardial oxidative stress (Figure 2A, B). However, both the GSH content and the activity of GPx remained unchanged in these hearts (Figure 2C, D). Treatment of mice with allopurinol inhibited both the decrease in the GSH/GSSG ratio and the increase in MDA levels in the heart. Treatment with allopurinol did not affect myocardial GSH content or GPx activity.

Control

Allo

AngII

AngII + Allo

Expression of TGF-β1, Smad3, and Smad7 mRNA

27.5 ± 0.5 30.7 ± 0.6 108.7 ± 2.3 550 ± 17 3.0 ± 0.3 167.7 ± 7.3

27.7± 0.7 29.3 ± 0.7 110.2 ± 3.5 557 ± 15 3.1 ± 0.2 165.6 ± 9.5

27.6 ± 0.7 28.9 ± 0.5 139.7 ± 1.6∗ 568 ± 16 4.2 ± 0.1∗ 210.8 ± 10.2∗

27.4 ± 0.6 29.8 ± 0.4 140.1 ± 2.6∗ 559 ± 25 3.8 ± 0.2∗† 208.1 ± 8.6∗†

To investigate whether AngII treatment stimulates the signaling cascade leading to cardiac fibrosis, we investigated mRNA levels of TGF-β1, Smad3 and Smad7 in the heart. The results are shown in Figure 3. Following AngII treatment of mice, TGF-β1 and Smad3 mRNA levels in the heart were significantly upregulated, and Smad7 mRNA level was significantly downregulated. Treatment of mice with allopurinol completely prevented the AngII-induced changes in expression of TGF-β1, Smad3, and Smad7 mRNA.

Values are the mean ± SEM (n = 11 in each group). ∗ P < 0.05 compared with the control and the allopurinol (Allo) group; † P < 0.05 compared with the angiotensin (Ang) II group. SBP, systolic blood pressure; HR, heart rate; LVW/BW, left ventricular weight: bodyweight ratio; CSA, cross-sectional area.


Discussion The present study demonstrated that allopurinol can improve cardiac diastolic dysfunction and remodeling in angiotensin


119


N. Jia et al.

Figure 1 Left ventricular interstitial fibrosis in mice. (A) Representative images of the myocardium with interstitial fibrosis stained with Masson trichrome stain. (B) Bar graph showing the quantified interstitial fibrotic area (%). Values are the mean ± SEM. (n = 11) ∗ P < 0.05 compared with control and allopurinol (Allo); † P < 0.05 compared with angiotensin (Ang) II.

II-induced hypertensive mice. These beneficial effects of allopurinol were independent of blood pressure decrease and were associated with attenuating oxidative stress and fibrosis. These findings suggest the potential involvement of TGF-β1, Smad3, and Smad7 in regulation of the following process. An increase in the level of oxidative stress is implicated in the pathogenesis of heart failure [8], and fibrosis is thought to play an important role in the progression of cardiovascular diseases [2]. Treatments that reduce the levels of oxidative stress or fibrosis have thus been found to improve hemodynamic function in patients with advanced heart failure as well as in animal models of this condition [9]. Allopurinol ameliorated increases in afterload and reductions in myocardial contractility during evolving heart failure, thereby preserving ventricular–vascular coupling [10]. In recent murine and rat heart failure studies, investigators have demonstrated reduction of reactive oxygen species production and decreased myocardial dysfunction following allopurinol treatment [11,12]. Importantly, in addition to the beneficial effect of the drug on left ventricular contractile function, allopurinol treatment also attenuated left ventricular cavity dilation and reduced myocardial hypertrophy and intestinal fibrosis [4,13]. Although no previous data are available regarding the effect of allopurinol on diastolic dysfunction and cardiac remodeling in angiotensin II-induced hypertensive mice, our findings that allopurinol has cardioprotective effects on left ventricular function are consistent with these results in other murine models of cardiac failure. Previous studies reported reduction of oxidative stress and cardiac fibrosis was independent of blood pressure changes. In this study, oxidative stress and fibrosis but not blood pressure is attenuated by allopurinol in angiotensin II-induced

120


hypertensive mice. Our findings highlight the complexities in relation of hypertension to cardiac remodeling and suggest that hypertension may involve mechanisms other than oxidative stress [14,15]. Oxidative stress is an important contributor to pathological remodeling in the failing heart [16]. Oxidative stress plays a critical role in cell growth, stress responses, and programmed cell death, processes intimately involved in the progression of pathological myocardial remodeling [17]. However, the precise role of oxidative stress in the improvement of DHF, by allopurinol, is not defined. Therefore, in the present work, we examined the effect of allopurinol on cardiac oxidative stress in angiotensin II-induced hypertensive mice with DHF. Oxidative stress in the myocardium reflects a shift in the balance between GSH and GSSG, and excessive production of reactive oxygen species (ROS) induces a reduction of the GSH/GSSG ratio [18]. Both GSH and GPx have been shown to be important cellular antioxidants, protecting cells from the damaging effects of oxidation products such as lipid peroxidation [19]. MDA is an end-product in the lipid peroxidation chain reaction and is frequently used as a marker for ROS production [20]. In the present study, both the GSH content and GPx activity were unaltered in the heart of AngII treatment, suggesting that antioxidant capacity remained preserved. Treatment with allopurinol attenuated the decrease in the GSH/GSSG ratio and the increase in MDA levels in the heart, whereas myocardial GSH content and GPx activity were not affected by this drug. These data suggest that the antioxidative effect of allopurinol was brought by reducing XO-derived generation of ROS in the heart. Transforming growth factor-β1 (TGF-β1) is a powerful initiator for the synthesis of collagens and other major extracellular matrix


N. Jia et al.


Figure 2 The reduced glutathione (GSH)/oxidized glutathione (GSSG) ratio, GSH content, and the activity of glutathione peroxidase in the left ventricle of mice. (A) The GSH/GSSG ratio. (B) Myocardial malondialdehyde levels. Results are expressed as nmol/mg of protein. (C) Myocardial GSH content.

Results are expressed as μmol/mg of protein. (D) Myocardial GPx activity. Results are expressed as mU/mL/mg of protein. Values are the mean ± SEM (n = 11). ∗ P < 0.05 compared with control and allopurinol (Allo); † P < 0.05 compared with angiotensin (Ang) II.

components in many organ systems [21]. Evidence supports that TGF-β1, produced mainly by cardiac fibroblast and myofibroblast in the heart, contributes to the development of cardiac fibrosis and hypertrophy [22]. It has been shown that the expression of TGF-β1 mRNA is increased in the left ventricular myocardium of patients with idiopathic hypertrophic cardiomyopathy or dilated cardiomyopathy and in animals after myocardial infarction [23]. Downregulation of the TGF-β1 expression suppressed myocardial fibrosis [24]. Accordingly, selective antagonism of TGF-β was also found to be associated with a regression of diastolic dysfunction [25]. The TGF-β1 signaling can be transmitted through the Smad protein family. Three groups of Smads have been identified. The receptor-regulated Smads and common mediator Smad transduce the TGF-β1 signaling to cell nucleus. Smad 7, an inhibitory Smad, can form a stable binding complex with the activated TGF-β1 receptor. This binding prevents the receptor activation of R-Smads [26]. It has been shown that the reduced Smad 7 expression contributes to the development of cardiac fibrosis in rats after myocardial infarction. TGF-β favors fibrosis through the binding to

its receptor and activation of the Smad3 signaling pathway, which sequentially enhances matrix protein and TIMP expression [27]. Smad3 loss prevents interstitial fibrosis in the noninfarcted myocardium and attenuates cardiac remodeling. The TGF-β1/Smad3 pathway is activated in healing infarcts and may regulate cellular events critical for the fibrotic responses. In agreement with these results, in the present study mice with AngII-induced cardiac diastolic dysfunction not only expressed high levels of cardiac TGF-β1 and Smad3, but also exhibited decreased levels of cardiac Smad7. Allopurinol treatment downregulated TGF-β1 and Smad3 expression as well as upregulated Smad7 expression in AngII-treated mice. These effects were associated with a significant lowering of cardiac fibrosis. In conclusion, allopurinol prevents pathological remodeling of the heart in AngII-induced hypertensive mice. The antioxidative effect of allopurinol contributes to the regression of AngII-induced cardiac diastolic dysfunction. It is possible that the effect of allopurinol to prevent cardiac fibrosis is mediated, in part, via the TGF-β1/Smad pathway.



121

N. Jia et al.


Figure 3 Quantification of the expression of transfer growth factor (TGF)β1 (A), Smad3 (B) and Smad7 (C) mRNA in left ventricular myocardium determined real-time reverse transcription–polymerase chain reaction. The mRNA levels were normalized against densitometric values obtained for GAPDH. Values are given in arbitrary units (values obtained for left ventricu-

Conflict of Interest

lar hypertrophy were designated as 1.0 and remaining values were adjusted accordingly). Representative images of RT-PCR assay were shown in (D). Values are the mean ± SEM (n = 11). ∗ P < 0.05 compared with control and allopurinol (Allo); † P < 0.05 compared with angiotensin (Ang) II.

myocardial infarction: A new action for an old drug? Circulation 2004;110:2175–2179.

The authors have no conflict of interest.

5. Shi Y, Evans JE, Rock KL. Molecular identification of a danger signal that alerts the immune system to dying cells. Nature 2003;425:516–521. 6. Numaguchi K, Egashira K, Takemoto M, Kadokami T, Shimokawa H, Sueishi

References 1. Zile MR, Brutsaert DL. New concepts in diastolic dysfunction and diastolic heart failure. Part I: Diagnosis, prognosis, and measurements of diastolic function. Circulation 2002;105:1387–1393. 2. Matsui Y, Jia N, Okamoto H, et al. Role of osteopontin in cardiac fibrosis and remodeling in angiotensin II-induced cardiac hypertrophy. Hypertension 2004;43:1195–1201. 3. Sawyer DB, Siwik DA, Xiao L, Pimentel DR, Singh K, Colucci WS. Role of oxidative stress in myocardial hypertrophy and failure. J Mol Cell Cardiol 2002;34:379–388. 4. Engberding N, Spiekermann S, Schaefer A, et al. Allopurinol attenuates left ventricular remodeling and dysfunction after experimental

122


K, Takeshita A. Chronic inhibition of nitric oxide synthesis causes coronary microvascular remodeling in rats. Hypertension 1995;26:957–962. 7. Sam F, Xie Z, Ooi H, Kerstetter DL, Colucci WS, Singh M, Singh K. Mice lacking osteopontin exhibit increased left ventricular dilation and reduced fibrosis after aldosterone infusion. Am J Hypertens 2004;17:188–193. 8. Dhalla AK, Hill MF, Singal PK. Role of oxidative stress in transition of hypertrophy to heart failure. J Am Coll Cardiol 1996;28:506–514. 9. Oudit GY, Trivieri MG, Khaper N, et al. Taurine supplementation reduces oxidative stress and improves cardiovascular function in an iron overload murine model. Circulation 2004;109:1877–1885. 10. Amado LC, Saliaris AP, Raju SV, et al. Xanthine oxidase inhibition ameliorates cardiovascular dysfunction in dogs with pacing-induced heart failure. J Mol Cell Cardiol 2005;39:531–536.


N. Jia et al.

11. Hayashi K, Kimata H, Obata K, et al. Xanthine oxidase inhibition improves left ventricular dysfunction in dilated cardiomyopathic hamsters. J Card Fail 2008;14:238–244 ´ E, Weiss RG. 12. Naumova AV, Chacko VP, Ouwerkerk R, Stull L, Marban Xanthine oxidase inhibitors improve energetics and function after infarction in failing mouse hearts. Am J Physiol Heart Circ Physiol 2006;290:837–843. 13. Mellin V, Isabelle M, Oudot A, et al. Transient reduction in myocardial free oxygen radical levels is involved in the improved cardiac function and structure after long-term allopurinol treatment initiated in established chronic heart failure. Eur Heart J 2005;15:1544–1550. 14. Bendall JK, Cave AC, Heymes C, Gall N, Shah AM. Pivotal role of a gp91(phox)-containing NADPH oxidase in angiotensin II-induced cardiac hypertrophy in mice. Circulation 2002;105:293–296. 15. Touyz RM, Mercure C, He Y, et al. Angiotensin II-dependent chronic hypertension and cardiac hypertrophy are unaffected by gp91phox-containing NADPH oxidase. Hypertension 2005;45:530–537. 16. Kinugawa S, Tsutsui H, Hayashidani S, et al. Treatment with dimethylthiourea prevents left ventricular remodeling and failure after experimental myocardial infarction in mice: Role of oxidative stress. Circ Res 2000;87:392–398. 17. Ceconi C, Bernocchi P, Boraso A, Cargnoni A, Pepi P, Curello S, Ferrari R. New insights on myocardial pyridine nucleotides and thiol redox state in ischemia and reperfusion damage. Cardiovasc Res 2000;47:586–594. 18. Meister A. Glutathione deficiency produced by inhibition of its synthesis, and



its reversal; applications in research and therapy. Pharmacol Ther 1991;51: 155–194. 19. Ceconi C, Cargnoni A, Pasini E, Condorelli E, Curello S, Ferrari R. Evaluation of phospholipid peroxidation as malondialdehyde during myocardial ischemia and reperfusion injury. Am J Physiol 1991;260:1057–1061. 20. Khan R, Sheppard R. Fibrosis in heart disease: Understanding the role of transforming growth factor-beta in cardiomyopathy, valvular disease and arrhythmia. Immunology 2006;118:10–24. 21. Rosenkranz S. TGF-beta1 and angiotensin networking in cardiac remodeling. Cardiovasc Res 2004;63:423–432. 22. Wang B, Hao J, Jones SC, Yee MS, Roth JC, Dixon IM. Decreased Smad 7 expression contributes to cardiac fibrosis in the infarcted rat heart. Am J Physiol Heart Circ Physiol 2002;282:1685–1696. 23. Kawano H, Do YS, Kawano Y, Starnes V, Barr M, Law RE, Hsueh WA. Angiotensin II has multiple profibrotic effects in human cardiac fibroblasts. Circulation 2000;101:1130–1137. 24. Kuwahara F, Kai H, Tokuda K, Kai M, Takeshita A, Egashira K, Imaizumi T. Transforming growth factor-β function blocking prevents myocardial fibrosis and diastolic dysfunction in pressure-overloaded rats. Circulation 2002;106:130–135. 25. Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature 2003;425:577–584. 26. Verrecchia F, Pessah M, Atfi A, Mauviel A. Tumor necrosis factor-α inhibits transforming growth factor-β/Smad signaling in human dermal fibroblasts via AP-1 activation. J Biol Chem 2000;275:30226–30231.


123