Parasitol Res (2009) 105:1273–1281 DOI 10.1007/s00436-009-1548-0
ORIGINAL PAPER
Alterations of gene expression of RB pathway in Opisthorchis viverrini infection-induced cholangiocarcinoma Thidarut Boonmars & Zhiliang Wu & Sirintip Boonjaruspinyo & Somchai Pinlaor & Isao Nagano & Yuzo Takahashi & Butsara Kaewsamut & Puangrat Yongvanit
Received: 17 June 2009 / Accepted: 19 June 2009 / Published online: 7 July 2009 # Springer-Verlag 2009
Abstract Opisthorchiasis has the significant relationship with the high prevalence of cholangiocarcinoma (CCA; a bile duct cancer) in the endemic areas in Southeast Asia. To reveal the molecular mechanism of the tumorigenesis induced by Opisthorchis viverrini infection, the present study investigated the kinetic expression of RB pathway genes, including RB1, p16INK4, cyclin D1, and CDK4, during the development of opisthorchiasis-associated CCA in hamster model. The results of quantitative real-time polymerase chain reaction indicated that the expressions of RB1 and p16INK4 were down-regulated during the development of CCA induced by infection plus N-nitrosodimethylamine treatment in a time-dependent manner. On the other hand, the expressions of cyclin D1 and CDK4 were
up-regulated. The expression kinetics was corresponding to the pathological progression of the opisthorchiasisassociated CCA, revealed by histopathological observation. Moreover, the analysis of the expression of these genes in human opisthorchiasis-associated CCA cases showed the decreased expression of RB1 and p16INK4 in 50% and 82.7% cases and overexpression of cyclin D1 and CDK4 in half cases, respectively. The results suggested that RB pathway is likely involved in the tumorigenesis of opisthorchiasis-induced CCA and proposed the potential application of some of these genes as biomarkers in predispose and molecular therapy of the parasiteassociated cancer.
T. Boonmars : S. Boonjaruspinyo : S. Pinlaor Department of Parasitology, Khon Kaen University, Khon Kaen 40002, Thailand
Introduction
T. Boonmars : S. Boonjaruspinyo : S. Pinlaor : P. Yongvanit Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002, Thailand Z. Wu (*) : I. Nagano : Y. Takahashi Department of Parasitology, Graduate School of Medicine, Gifu University, Yanagido1-1, Gifu 501-1194, Japan e-mail:
[email protected] B. Kaewsamut Northeast Laboratory Animal Center, Khon Kaen University, Khon Kaen 40002, Thailand P. Yongvanit Department of Biochemistry, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002, Thailand
RB pathway is critical in controlling G1/S transition in the cell cycle. RB1, p16INK4, cyclin D1, and CDK4 are major components of the pathway. RB1 was the first tumor suppressor gene cloned when studying the genetic lesions in families with inherited retinoblastoma (Friend et al. 1986). This gene was at first discovered to be inactivated in cancers other than retinoblastoma (Harbour et al. 1988), and now, it is well-known that the RB pathway is inactivated in virtually every human cancer (Hahn and Weinberg 2002), for example in cholangiocarcinoma (CCA; Tannapfel et al. 2000; Kang et al. 2002; Karamitopoulou et al. 2008), esophageal cancer (Contu et al. 2007), breast cancer (Bosco et al. 2007), parathyroid adenoma (Cetani et al. 2004; Fernandez-Ranvier et al. 2009), and lymphoma (Chim et al. 2007). A definite relationship has been linked between Opisthorchis viverrini infection and CCA, that is, the infection can induce tumorigenesis of bile ducts, leading to the
1274
formation of CCA, as supported by the epidemiological investigation and animal experiments (Thamavit et al. 1993; WHO 1995; IARC 1994; Watanapa and Watanapa 2002). Although CCA is a rare primary malignant epithelial liver tumor in the world, the extremely high prevalence of CCA was observed in opisthorchiasis endemic areas, such as in Thailand, Laos, and Cambodia (Haswell-Elkins et al. 1992; IARC 1994). The studies using hamster animal model revealed that infection caused chronic inflammation infiltration, epithelial desquamation, epithelial and adenomatous hyperplasia, goblet cell metaplasia, periductal fibrosis, and granuloma formation (Sripa 2003). Moreover, in hamster models, O. viverrini infection or N-nitrosodimethylamine (NDMA) administration alone does not induce formation of CCA, but infection plus NDMA administration do cause the development of hamster CCA (Thamavit et al. 1987, 1993; Sripa 2003). The underlying mechanism of tumorigenesis of opisthorchiasis-associated CCA is still unknown. But recent study indicated that excretory and secretory (ES) products of O. viverrini were mitogenic activity, which induced the expression alterations of genes in fibroblasts, including many genes related to cell proliferation (Thuwajit et al. 2006). It has been confirmed that ES products have direct effect on promoting fibroblast cell proliferation in vitro (Sripa 2003; Thuwajit et al. 2004). Therefore, as a critical negative regulator of cell proliferation, RB pathway is proposed to be important in the CCA tumorigenesis caused by O. viverrini infection. Therefore, the purposes of the present study are to reveal the involvement of RB pathway in the tumorigenesis of CCA induced by O. viverrini infection and potential application of the pathway-related genes as biomarkers for the predisposition of the tumorigenesis, therapeutic and diagnostic researches. In the present study, we investigated the expression kinetics of RB pathway-related genes, RB1, p16INK4, cyclin D1, and CDK4, during the tumorigenesis in hamster model, the expression of these genes in opisthorchiasis-associated human CCA, and correlated the expression kinetics with the histopathological changes caused by O. viverrini infection.
Parasitol Res (2009) 105:1273–1281
metacercaria, oval shape with big and black-brown excretory bladder, was identified under a dissecting light microscope. Sixty Syrian hamsters (6 weeks) were divided into four groups: (1) normal control group, (2) NDMA group: 15 hamsters were maintained with drinking water containing 12.5 ppm of N-nitrosodimethylamine (Wako, Japan); (3) infection group: 15 hamsters were infected with 50 metacercariae; and (4) infection plus NDMA group: 15 hamsters were infected with 50 metacercariae and maintained with drinking water containing 12.5 ppm of NDMA. Hamster livers (five hamsters at each time point for each group) were collected at 0, 30, 60, and 90 days postinfection (p.i.) for total RNA isolation and histological observation. Hamster CCA tissues To prepare the positive samples of hamster CCA, hamsters were infected with 50 metacercariae and maintained with drinking water containing 12.5 ppm of NDMA for 4 months. The CCA tissues in hilar region of livers were collected and total RNA was isolated as described below. Human CCA tissues
Materials and methods
Six frozen human CCA tissues were provided by the Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Thailand. These samples were from the CCA patients with opisthorchiasis history. Pair samples from each case, CCA tissue and normal liver tissue, were collected. Total RNA was isolated from these samples and complementary DNA (cDNA) was prepared as described below. The expression levels of RB pathway genes, including RB1, p16INK4, cyclin D1, and CDK4, were determined with quantitative real-time polymerase chain reaction (PCR). The altered folds of expression were calculated (expression level in CCA tissue/expression level in normal liver tissue), and more than 2-fold (up-regulation) or less than 0.5-fold (down-regulation) was considered to be significant. The utilization of the specimens in the present study was approved by the Human Ethics Committee of the Khon Kaen University (Ethical Clearance No. HEKKU501153).
Parasites and infection
Primers for real-time PCR
The metacercariae of O. viverrini were collected as the previously described (Boonmars et al. 2007, 2008). In brief, naturally infected cyprinoids fish captured from a freshwater reservoir in an endemic area of Khon Kaen, northeast Thailand, were minced and digested with pepsin-HCl, filtrated, and then washed with saline. O. viverrini
The primers for amplification of hamster samples were designed based on the published sequence in GenBank: RB1 (accession no. GQ246228, forward cagatggtgtgta atagtgaccga and reverse tttttcaggggcttgggag), p16INK4 (accession no. AF292567, forward gcaacacccaagtagccagac and reverse cgccagagtttccaagaagcc), cyclin D1 (accession
Parasitol Res (2009) 105:1273–1281
no. NM_007631, forward agcagaagtgcgaagaggagg and reverse ggcagtcaagggaatggtctc), CDK4 (accession no. GQ246229, forward caccctcgtgtttgagcata and reverse gttttctggtttcaggtctcgg), and G3PDH (accession no. U10983, forward gacatcaagaaggtggtgaagca and reverse catcaaaggtggaagagtggga). The primers for amplification of human samples were designed based on the published sequence in GenBank: RB1 (accession no. NM_000321, forward aggtctgccaacaccaacaa and reverse tccttcaxgcact tcttttgagc), p16INK4 (accession no. NM_058197, forward cgaatagttacggtcggaggc and reverse acgggtcgggtgagagtg), cyclin D1 (accession no. NM_053056, forward ctcacac gcttcctctccag and reverse acctcctcctcctcctcttcc), CDK4 (accession no. NM_000075, forward ttggtgtcggtgcctatgg and reverse cgaactgtgctgatgggaag), and glyceraldehyde-3phosphate dehydrogenase (GAPDH; accession no. NM_002046, forward gaacatcatccctgcctctact and reverse cctgcttcaccaccttcttg). Total RNA isolation and complementary DNA synthesis Total RNA was extracted from the tissues (200 mg) at the hilar region of liver from the four groups mentioned above (uninfected normal control, infection, NDMA, and infection plus NDMA), using TRIZOL (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The isolated RNA was treated with DNase (RQ1 RNase-Free DNase, Promega, Co., Madison, WI, USA) in the presence of ribonuclease inhibitor (Takara Shuzo, Co., Ltd, Kyoto, Japan). The treated RNA was extracted with phenol/ chloroform, precipitated with ethanol, and dissolved in RNase-free water. Reverse transcription was performed with a PrimeScriptTM Reverse Transcriptase (TAKARA BIO INC., Shiga, Japan) according to the manufacturer’s instructions. In brief, each 20μl of reaction consisted of 3μg of the sample RNA, 1μl of 0.5μg/μl Oligo (dT)12–18, 1μl of 10 mM deoxyribonucleotide triphosphate mix, 4μl firststrand buffer, 1μl of 0.1 M dithiothreitol, 1μl RNase inhibitor, and 1μl reverse transcriptase. The reaction was incubated at 42°C for 60 min and then inactivated by heating at 75°C for 15 min. Quantification by real-time PCR To determine the expression profiles of RB1, 16INK4, CDK4, and cyclin D1 in hamster and human tissues, real-time PCR was performed using the Thermal Cycler Dice Real-Time System (TAKARA, Japan). Hamster G3PDH and human GAPDH were used as internal control. Optimal conditions for all investigated genes were established using a SYBR Premix Ex Taq Kit (TAKARA
1275
BIO Inc., Ootsu, Shiga, Japan) according to manufacturer’s instructions. Twenty microliters of the reaction solution consisted of 2μl of the cDNA (appropriate dilution was determined by gene), 10μl of SYBR Premix Ex Taq, and 0.8μl of 5μM of each primer. PCR amplification was performed as follows: predenature for one cycle at 95°C for 10 s and 40 cycles at 95°C for 5 s and 60–62°C for 30 s. Melting curve analysis was performed at 60°C to 95°C with 0.1°C/s temperature transition. Specific external controls were constructed for all target genes. The PCR fragment of each gene was cloned into a pT7Blue T-Vector (Novagen, Inc., Madison, WI, USA). The recombinant plasmids were introduced into competent cells of Escherichia coli JM 109. The plasmid DNA was isolated from E. coli using a FlexiPrep Kit (Amersham Pharmacia Biotech Inc., Piscataway, NJ, USA). Tenfold serial dilutions (101 to 107 copies/2μl) of the plasmids were used to generate standard curves for each gene. Differences in the amounts of cDNA from different muscle samples were normalized by quantification of the housekeeping gene G3PDH, and expression levels were represented as the copy number of target gene/107 G3PDH copies. Three independent experiments were performed and two-well repeats were measured for each sample. Values are expressed as the mean ± standard deviation (SD). P values
