Alterations of the K-ras and p53 Genes and Microsatellite Instability in ...

ANTICANCER RESEARCH 24: 2047-2052 (2004)

Alterations of the K-ras and p53 Genes and Microsatellite Instability in Sporadic Colorectal Carcinomas ARIFUMI HASEGAWA, TOSHIHIKO FUKUSHIMA, MIYUKI MASHIKO, KEIICHI NAKANO, SATOSHI SUZUKI, YOSHIYUKI ENDO, SHINJI OHKI, YUICHI HATAKEYAMA, YOSHIHISA KOYAMA, NORIO INOUE, YUJI TAKEBAYASHI, KOUJI SEKIKAWA and SEI-ICHI TAKENOSHITA

Department of Surgery II, Fukushima Medical University, Fukushima 960-1295, Japan

Abstract. Background: The international guidelines for the evaluation of microsatellite instability (MSI) in colorectal cancer were defined in 1997 by the National Cancer Institute (NCI). Here, the relationship between MSI, cancer-associated genes and their clinicopathological variables were revaluated using these guidelines. Patients and Methods: Mutations of K-ras at exon 1 and p53 at exons 5, 6, 7 and 8 were analyzed in 43 cases of sporadic colorectal carcinoma. MSI was analyzed using the 5 markers recommended by the NCI reference panel. Results: The proportion of p53 mutations in the MSI-H cases (0 out of 5; 0%) was lower than that of non-MSI-H cases (23 out of 38; 60.5%) (p=0.0117). The proportion of p53 mutations in microsatellite stable (MSS) cases (21 out of 34; 61.8%) was higher than that of non-MSS cases (2 out of 9; 22,2%) (p=0.0366). The proportion of K-ras mutations in MSI-H tumors (1 out of 5; 20.0%) was less frequent than in non-MSIH tumors (19 out of 38; 50.0%) (p=0.2115). Conclusion: p53 mutations in MSI-H tumors were much less common than in non-MSI-H tumors. This result suggested that alterations of the p53 gene are not closely associated with carcinogenesis in MSIH carcinomas. In 1988, Vogelstein et al. (1) proposed the adenomacarcinoma sequence of colorectal carcinogenesis. Alterations in APC, K-ras and p53 are known to be involved in this multistep carcinogenesis pathway (2-4). Seventy-five percent of colorectal carcinomas can be classified as this type (2). Loss of heterozygosity (LOH) of these genes, accompanied by point mutation, plays a very important role in carcinogenesis (5). In 1993, a different carcinogenesis pathway involving

Correspondence to: Arifumi Hasegawa, M.D., PhD., Department of Surgery II, Fukushima Medical University, 1 Hikarigaoka, Fukushima 960-1295, Japan. Tel: +81-24-547-1259, Fax: +81-24-548-3249, e-mail: [email protected] Key Words: Microsatellite instability, K-ras, p53, colorectal carcinoma.

0250-7005/2004 $2.00+.40

abnormalities of the DNA mismatch repair genes was reported (6, 7). The lack of a DNA mismatch repair system is known to cause microsatellite instability (MSI) (8). MSIpositive carcinomas have distinct clinicopathological variables and right-side existence, a poor degree of differentiation, tumor-infiltrating lymphocytes, a tendency for juvenile onset and, compared with MSI-negative carcinomas, a relatively good prognosis (9-17). The international guidelines for the evaluation of MSI in colorectal cancer were defined in 1997 by the National Cancer Institute Workshop on Microsatellite Instability for Cancer Detection and Familial Predisposition (18). The aim of this study was to revaluate the relationship between K-ras alterations, p53 alterations, MSI and their clinicopathological variables using the NCI reference panel.

Patients and Methods Patient profiles and clinical data. This study was conducted on 43 colorectal carcinoma tumors surgically resected from 43 patients (28 males and 15 females, aged 45-86 years; median age, 65 years) without hereditary nonpolyposis colorectal cancer (19). These 43 cases included 16 well-differentiated, 22 moderately-differentiated, 2 poorly-differentiated and 3 mucinous adenocarcinomas. Specimens of both the tumors and adjacent non-neoplastic lesions were obtained from each patient during surgery and immediately frozen and stored at -80ÆC until use. Genomic DNA was extracted with SDS-Proteinase K and phenol-chloroform, as previously described (20). Informed consent was obtained from each patient. PCR-SSCP analysis. Alterations of the K-ras of exon 1 at codon 12 and 13 and the p53 of exons 5, 6, 7 and 8 were determined using single-strand conformational polymorphism (SSCP) analysis. The PCR primers used in this study were as follows: K-ras exon1U: 5’ GGCCTCCTGAAAATGACTGA 3’ K-ras exon1D: 5’ GTCCTGCACCAGTAATATGC 3’ p53 exon5U: 5’ TGATGAGAATTCTTCCTCTTCCTGCAGTAC 3’ p53 exon5D: 5’ TGATGAGAATTCAGCTGCTCACCATCGCTAT 3’ p53 exon6U: 5’ CACTGATTGCTCTTAGGTCT 3’ p53 exon6D: 5’ ACTTGCAAACCAGACCTCAG 3’ p53 exon7U: 5’ TGATGAGAATTCGTTGGCTCTGACTGTACCA 3’ p53 exon7D: 5’ TGATGAGAATTCAAGTGGCTCCTGAC3’

2047

ANTICANCER RESEARCH 24: 2047-2052 (2004) p53 exon8U: 5’ TGATGAGAATTCTGGTAATCTACTGGGACGG 3’ p53 exon8D: 5’ TGATGAGAATCCTCGCTTAGTGCTTCCCTG 3’ These primers were pre-labeled with [Á-32P]ATP using T4 polynucleotide kinase (Boehringer Mannheim, Germany). The PCR reaction mixture was denatured at 94ÆC for 120 sec and incubated for 40 cycles (annealing at 58ÆC for 60 sec and extending at 72ÆC for 90 sec). Other PCR and SSCP analysis procedures were performed as described previously (21, 22). DNA sequencing. DNA fragments with different mobility compared to DNA fragments with normal sequences under SSCP analysis were directly sequenced using an ABI Big Dye Terminator Kit (Perkin-Elmer Applied Biosystems) and ABI PRISM 310 Genomic Analyzer (23). Microsatellite instability analysis. The primers of the microsatellite markers for the MSI analysis were as follows: BAT25, BAT26, D2S123, D5S346 and D17S250 (24), and were pre-labeled with [Á-32P]ATP. PCR was performed under the same conditions as described above. Other MSI analysis procedures were performed as described previously (25). Each specimen was considered MSI-H if two or more of the markers demonstrated instability or MSI-L when only one marker was unstable. Specimens without any extra band or band shift were considered as MSS (18). Statistical analysis. Each MSI type and alterations in the K-ras and p53 genes were compared using the following clinicopathological parameters: the patient’s age at the time of operation; gender; location of the tumor; degree of differentiation; node involvement; depth of invasion; and Dukes’ classification. Categorized variables were compared using the Mann-Whitney test. Continuation factors were analyzed with the Student’s t-test. All presented p-values were two-sided and a p-value of less than 0.05 was considered insignificant.

Results and Discussion Of the 43 tumors, 5 (11.6%) were of MSI-H, 4 (9.3%) of MSI-L and 34 (79.1%) of MSS (Figure 1a). MSI-H tumors possessed the characteristics described below. The proportion of poorly-differentiated adenocarcinomas in MSI-H tumors was significantly higher than in non-MSI-H tumors (p=0.0075). The proportion of MSI-H tumors on the right side of the colon was significantly higher than the proportion of non-MSI-H tumors on the right side of the colon (p=0.0374). The proportion of well-differentiated adenocarcinomas was higher in MSS tumors than non-MSS tumors (p=0.0034) (Table I). In previous reports, MSI was identified in 12~15% of sporadic colorectal carcinomas (9, 13, 26). Compared with non-MSI-H tumors, diploid types, which are commonly found on the right side of the colon, a tendency toward juvenile onset and poorly-differentiated adenocarcinomas or mucinous carcinomas were more common in MSI-H tumors. MSI-H tumors also have a relatively better prognosis than non-MSI-H tumors (9-17). In this study, the frequency and clinicopathogenic features of MSI-H were similar to those seen in previous studies.

2048

K-ras mutations were identified in 20 of the 43 (46.5%) tumors. All of these were mis-sense mutations and involved codons 12 (11/20; 55%) and 13 (9/20; 45%). The proportion of K-ras mutations in MSI-H tumors was less than in nonMSI-H tumors, although these differences were not significant (p=0.2115) (Table II). In previous studies, K-ras mutations in MSI-positive sporadic colorectal carcinomas were regarded as the mis-sense mutation of codons 12 and 13 at a frequency of 7~47% (15, 17, 27-33) (Table III). Several studies have reported that the proportion of K-ras mutations is equivalent in MSI-H and non-MSI-H tumors (17, 27, 29, 31, 32). Other studies have reported that K-ras mutations are significantly less common in MSI tumors than MSS tumors (15, 28, 33). In this study, the proportion of K-ras mutations in MSI-H tumors was found to be equivalent to that in nonMSI-H tumors. These results suggest that K-ras mutations are involved in both MSI-H and non-MSI-H tumors. p53 mutations were identified in 23 of the 43 (53.3%) tumors (Figure 1b and c). The proportion of p53 mutations in MSI-H cases was lower than in non-MSI-H tumors (p=0.0117). The proportion of p53 mutations in MSS tumors was higher than in non-MSS tumors (p=0.0366) (Table II). In previous reports, alterations of the p53 gene were significantly less common in MSI-H tumors than nonMSI-H tumors (15, 17, 27-31, 34) (Table III). However, some studies have reported that the proportion of alterations in p53 genes in MSI-H tumors is identical to that in MSI-L and MSS tumors (32, 33). The reasons for these differences remain unclear. In this study, there were significant differences in the clinicopathological and genetic features between tumors with p53 mutations and MSI-H tumors. Therefore, the tumors that were examined can be classified into two types of colorectal carcinoma. One is represented by p53 mutations, which might be associated with LOH and accounts for a significant proportion of tumor suppressor gene inactivation, namely the LOH pathway (1-5, 26). The other is represented by MSI-H, which is caused by a failure in the DNA mismatch repair system, namely the MSI pathway (6, 7, 26). No differences in the clinicopathological variables between MSI-L and non-MSI-H tumors were observed (Table I). The proportion of p53 mutations in MSI-L cases did not differ from non-MSI-L cases (Table II). In the previous studies documenting MSI-L tumors, no differences were found in any clinicopathological or molecular variable between MSI-L and MSS tumors (29, 35, 36). Others have reported that there is no evidence to show differences in clinicopathological features between MSI-L and MSS tumors (37). However, some studies reported that MSI-L carcinomas differ from MSS carcinomas with regards to their higher frequency of K-ras mutation and lower frequency of 5q LOH (15). In this study, no characteristic

Hasegawa et al: Alterations of the K-ras and p53 Genes and MSI in Sporadic Colorectal Carcinomas

Figure 1. (A) Microsatellite instability analysis, (B and C) PCR-SSCP and sequence analysis of the p53 gene. (A) Microsatellite instability-positive cases were determined using the BAT25, BAT26, D2S123, D5S346 and D17S250 microsatellite markers. MSI was determined as a clear shift or preset of extra bands in the tumors when compared with normal alleles. N: normal tissue, T: tumor. (B) PCR-SSCP patterns in exon 7 of the p53 gene. Mutant bands are present in carcinomas from patients with sporadic colorectal carcinomas. (C) DNA sequence histogram. Single nucleotide substitutions cause a change from Arg (CGG) to Trp (TGG) at codon 248.

2049

ANTICANCER RESEARCH 24: 2047-2052 (2004) Table I. Relationship between the clinical parameters of the MSI phenotypes. Clinical parameter Age Male/Female Locationa right

MSI-H(5)MSI-L(4) MSS(34) 64.2 4/1

64.3 3/1

64.3 21 / 13

P-value

MSI type

N.S. c N.S.

MSI-H vs non-MSI-H: p=0.0374 Others N.S.

4

1

11

left Degree of differentiation good

1

3

23

0

0

17

moderate

2

3

16

poor mucinous Node involvement positive negative Depth of invasion mp ss, a1 se, a2 si, a3 Dukes’ classification A B C

2 1

0 1

0 1

1 4

2 2

19 15

N.S.

0 2 1 2

0 1 3 0

6 10 16 2

N.S.

0 4 1

0 2 2

4 9 21

N.S.

MSI-H vs non-MSI-H: p=0.0075b MSS vs non-MSS: p=0.0031b Others N.S.

aCarcinomas in the cecum, ascending and transverse colon are classified as right side, and carcinomas in the descending, sigmoid and rectum are classified as left side. bP-values were determined in the degree of differentiation with well-differentiated, moderatelydifferentiated and poorly-differentiated adenocarcinomas. cN.S., not significant.

features of MSI-L were detected. To conclude, p53 mutations in MSI-H tumors were confirmed as being much less common than those in nonMSI-H tumors. This result suggests that alterations in the p53 gene are not closely associated with carcinogenesis in MSI-H carcinomas.

References 1 Vogelstein B, Fearon ER, Hamilton SR, Kern SE, Preisinger AC, Leppert M, Nakamura Y, White R, Smith AM and Bos JL: Genetic alterations during colorectal-tumor development. New Engl J Med 319: 525-532, 1988. 2 Fearon ER and Vogelstein B: A Genetic model for colorectal tumorgenesis. Cell 61: 759-767, 1990. 3 Hartwell L: Defects in a cell cycle checkpoint may be responsible for the genomic instability of cancer cells. Cell 71: 543-546, 1992.

2050

Table II. Relationship between the frequency of K-ras and p53 alterations, and MSI phenotype. Mutations / informative tumors (%) K-ras MSI-H (n=5) MSI-L (n=5) MSS (n=34) P-value, MSI-H vs non-MSI-H P-value, MSI-L vs non-MSI-L P-value, MSS vs non-MSS P-value, MSI-H vs MSI-L P-value, MSI-H vs MSS

1/5(20.0) 1/4(25.0) 18/34(52.9)

p53 0/5(0) 2/4(50.0) 21/34(61.8)

0.2115

0.0117

0.3707

0.8846

0.1044

0.0366

0.8056

0.0910

0.1704

0.0107

4 Cahill DP and Lengauer C, Yu J, Riggins GJ, Willson JK, Markowitz SD, Kinzler KW and Vogelstein B: Mutations of mitotic check point genes in human cancer. Nature 392: 300303, 1998. 5 Knudson AG: Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci USA 68: 820-823, 1971. 6 Leach FS, Nicolaides NC, Papadopoulos N, Liu B, Jen J, Parsons R, Peltomaki P, Sistonen P, Aaltonen LA, Lahti MN, Guan XY, Zhang J, Meltzer PS, Yu JW, Kao FT, Chen DJ, Cerosaletti KM, Fournier REK, Todd S, Lewis T, Leach RJ, Naylor SL, Weissenbach J, Mecklin JP, Jarvinen H, Petersen GM, Hamilton SR, Green J, Jass J, Watson P, Lynch HT, Trent JM, Chapelle A, Kinzler KW and Vogelstein B: Mutations of mutS homolog in hereditary nonpolyposis colorectal cancer. Cell 75: 1215-1225, 1993. 7 Kinzler KW and Vogelstein B: Lessons from hereditary colorectal cancer. Cell 87: 159-170, 1996. 8 Wheeler JMD: DNA missmatch repair genes and colorectal cancer. Gut 47: 148-153, 2000. 9 Thibodeau SN, Bren G and Schaid D: Microsatellite instability in cancer of the proximal colon. Science 260: 816-819, 1993. 10 Lothe RA, Peltomaki P, Meling GI, Aaltonen LA, Lahti MN, Pylkkanen L, Heimdal K, Anderson TI, Moller P, Rognum TO, Fossa SD, Haldorson T, Langmark F, Brogger A, Chapelle A and Borresen AL: Genetic instability in colorectal cancer: relationship to clinicopathological variables and family history. Cancer Res 53: 5849-5852, 1993. 11 Kim H, Jin J, Vogelstein B and Hamilton SR: Clinical and pathological characteristics of sporadic colorectal carcinomas with DNA replication errors in microsatellite sequences. Am J Pathol 145: 148-156, 1994. 12 Samowitz WS, Slattery ML and Kerber RA: Microsatellite instability in human colonic cancer is not a useful clinical indicator of familial colorectal cancer. Gastroenterology 109: 1765-1771, 1995.

Hasegawa et al: Alterations of the K-ras and p53 Genes and MSI in Sporadic Colorectal Carcinomas

Table III. MSI and p53 overexpression, mutation/K-ras mutation. Mutations/informative tumors (%) MSI type

p53

Kim et al. (11)

MSI-H MSI-L or MSS P-value, MSI-H vs non-MSI-H

3/17(18) 18/41(44) 0.06

Olschwang et al. (32)


4/13(30.8) 41/74(55.5) N.S.

2/9(22.2) 24/63(38.1) N.S.

Fujiwara et al. (27)


0/18(0) 13/39(33) 0.005

3/17(18) 13/37(35) N.S.

Jass et al. (15)

MSI-H MSI-L MSS P-value, MSI-H vs non-MSI-H

0/12(0) 16/28(57) 26/45(58) 0.01

2/26(7) 19/38(54) 13/48 (27) 0.0004

Shitoh et al. (33)

MSI-H MSI-L MSS P-value, MSI-H vs non-MSI-H

6/22(27) 2/7(28) 11/29(32) 0.4

2/24(8) 4/9(44) 11/29 (38) 0.008

Samowitz et al. (28)


7/35(26.3) 122/219(55.7) 0.001

6/51(11.8) 136/374(36.4) 0.001

Ward et al. (29)


6/33(18.1) 152/277(54.9) 0.001

5/33(15.6) 78/277(28.1) 0.20

Elsaleh et al. (30)


7/43(16) 226/562(40) 0.0001

Gervaz et al. (31)


2/21(10) 37/65(55)