Lawrence Berkeley Laboratory, Berkeley, CA 94720. Communicated by Ray ...... Soloski, M. J., Vernachio, J., Einhorn, G. & Lattimore, A. (1986). Proc. Natl. Acad.
Proc. Nati. Acad. Sci. USA Vol. 91, pp. 1883-1887, March 1994 Immunology
Alternative splicing of class Ib major histocompatibility complex transcripts in vivo leads to the expression of soluble- Qa-2 molecules in murine blood PIOTR TABACZEWSKI*, HAVAL SHIRWANt, KEITH LEWIS*, AND IWONA STROYNOWSKI*§ tDepartment of Microbiology and Gifford Laboratories for Diabetes Research, University of Texas Southwestern Medical Center at Dallas, Dallas, TX 75235-8854; tTransplantation Biology Laboratory, Cedars-Sinai Medical Center, Beverly Hills, Los Angeles, CA 90211; and tU.S. Department of Energy, Lawrence Berkeley Laboratory, Berkeley, CA 94720 Communicated by Ray D. Owen, November 22, 1993 (received for review June 9, 1993)
40-kDa, membrane-bound isoform corresponds to serologically defined Qa-2 antigen and is attached to cell surfaces of transfectants by a glycophosphatidylinositol (GPI) anchor (12, 13). The 39-kDa, soluble isoform is detectable in the supernatants of cultured splenocytes (14) and transfectants (12). The two isoforms are translated in tissue culture from alternatively spliced transcripts of Q7/Q9 genes (15). In cultured splenocytes, differential splicing is inducible by treatment of cells with Con A. This led to the suggestion that soluble Qa-2 molecules released from activated splenocytes were synthesized from truncated transcripts. Here we report that alternative splicing of exon 5 occurs in vivo and gives rise to secreted Qa-2 released into serum. In addition, GPI-anchored Qa-2 or its precursor can be posttranslationally cleaved or shed to contribute to the total pool of soluble Qa-2 in vitro and in vivo. The two types of soluble Qa-2 (secreted, or SQa-2, and membrane-derived, or MDQa-2) are inducible in blood upon immune stimulation with poly(I'C). We speculate that a regulated shift of expression from membrane to soluble Qa-2 forms may help to protect cells from adverse autoimmune recognition. MATERIALS AND METHODS Animals. C57BL/6, BALB/c, and BALB/c dm2 mice were purchased from The Jackson Laboratory. New Zealand White rabbits were purchased from Irish Farms, Norco, CA. The animals were housed in the animal facility of the California Institute of Technology, Pasadena, CA. Antibodies. Hybridomas producing monoclonal antibody (mAb) 46 (16) and mAbs 20-8-4 (17), 30-5-7 (18), and 28-14-8 (18) were grown as ascites in nude and in (BALB/c x C3H)F1 mice and were purified on protein A-Sepharose columns (19). To prepare antibodies, to the C terminus of SQa-2, two peptides, NUPI and NUPII, were synthesized by the solidphase method on an Applied Biosystems peptide synthesizer (20). Peptides were purified by reversed-phase HPLC and conjugated to carrier protein, keyhole limpet hemocyanin (KLH), via the free SH group on the cysteine residue. To prepare antiserum to a synthetic peptide, two rabbits were immunized intramuscularly and subcutaneously with 750 ,ug of the peptide-KLH conjugate emulsified in complete Freund's adjuvant (19). Three booster injections in incomplete Freund's adjuvant were administered subcutaneously at 1-month intervals. Animals were bled on days 7, 9, and 11 after the last booster injection and the antisera were tested against peptides and metabolically labeled splenocyte lysates by ELISA and/or immunoprecipitation. Radiolabeling, Immunoprecipitation, and SDS/PAGE. Metabolic labeling of proteins with [35S]methionine and vec-
ABSTRACT Class lb Qa-2 molecules are expressed in tissue culture cells as 140-kDa membrane-bound, glycophosphatidylinositol-linked antiens and as --39-kDa soluble polypeptides. Recently, alternative splicing events which delete exon 5 from a portion of Qa-2 transcripts were demonstrated to give rise to truncated secreted Qa-2 molecules In transected cell lines. To determine whether this m anis operates in vivo and to find out whether Qa-2 can be detected in soluble form in circulation, murine blood samples were analyzed. Critical to these experiments was preparation of an anti-peptide antiserum against an epitope encoded by ajunction ofexon 4 and exon 6. We find that supernatants of splenocytes cultured in vitro as well as serum or plasma contain two forms of soluble Qa-2 molecules. One form corresponds to a secreted molecule tnlated from sipts from which exon 5 has been deleted; the other is derived from membrane-bound antigens or their precursors. The levels of both soluble forms of Qa-2 are inducible upon stimulation of the immune system, suggestng an immunoregulatory role for these molecules or for the m nism leading to the reduction of cell-associated Qa-2 antigens in vivo.
Cell-specific patterns of expression of major histocompatibility complex (MHC)-encoded antigens are thought to be intimately involved with regulation of their physiological functions in vivo. For example, early developmental onset of the polymorphic classical class I (class Ia) MHC proteins is essential for thymic education of MHC-restricted T cells and for induction of tolerance to self proteins. Class Ia antigens on virally infected or neoplastically transformed cells triggers recognition and cytotoxic destruction of the diseased cells. Enhanced expression of these MHC proteins on peripheral cells correlates with autoimmune reactions (1, 2). In contrast to the well-defined roles of class Ia MHC antigens, the functions of the numerous nonclassical (class Ib) proteins are poorly understood. Some of the membranebound class Ib molecules are implicated in responses to intracellular bacteria (3) and stress proteins (4) and in allogeneic reactions (5, 6). However, the interplay between the expression patterns and the physiology of class lb proteins has not been well studied. One of the best characterized class lb molecules in the murine system is the Qa-2 antigen. This protein is complexed with (32-microglobulin and naturally processed peptides (7, 8) and can guide allogeneic reactions (9). It is present predominantly on lymphoid-derived cells and does not reach significant levels of expression until the third week after birth (reviewed in refs. 5 and 6). In BALB/c mice it is encoded by a single gene, Q7d (10), and in C57BL/6 mice by two pseudoalleles, Q7b and Q9b (11). Each of the Qa-2 genes encodes two protein products in transfected mammalian cells (12). The
Abbreviations: MHC, major histocompatibility complex; GPI, glycosylphosphatidylinositol; SQa-2, secreted Qa-2; MDQa-2, membrane-derived Qa-2; mAb, monoclonal antibody. §To whom reprint requests should be addressed.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 1883
1884
Immunology: Tabaczewski et al.
Proc. Natl. Acad. Sci. USA 91
torial labeling with 1251 by a lactoperoxidase method were as described (15). Labeled proteins were immunoprecipitated and immunocomplexes were analyzed (15). ELISAs. Sandwich ELISA was performed essentially as described (8, 19), using NUPIT, mAb 20-8-4, and mAb 46 to detect Qa-2 proteins, and mAbs 30-5-7 and 28-14-8 to detect H-2Ld proteins. Where appropriate, adjustments in dilutions were made to compare MHC proteins synthesized by equal cell equivalents. The reactions were amplified with ,3-galactosidase-conjugated streptavidin (Boehringer Mannheim) and developed with red ,B-D-galactopyranoside (Boehringer Mannheim). The concentration of Qa-2 was estimated from absorbance of the red product at 570 nm with a Biotek microtiter plate reader and titration against SQa-2 purified from the supernatants of sQa-2 DNA-transfected myeloma cells. Multiple titrations were carried out to demonstrate specificity, reproducibility, and linear ranges of ELISAs. Preparation of Serum and Plasma Samples. Blood for plasma preparations was collected from tail veins directly into chilled heparinized saline. The sediment was removed by multiple rounds of centrifugation at 4°C. To prepare serum, tail blood samples were incubated overnight at 4°C and the supernatants were processed as for plasma samples.
(1994)
tively, are detailed in Fig. 1B. Their sequences were chosen to include the residues encoded by the exon 4/exon 6junction because of their diagnostic structures. The peptides were purified by reversed-phase HPLC, conjugated to carrier protein, and injected into rabbits. After several booster immunizations the animals were bled and their sera were tested for reactivity with NUPI and NUPII peptides and with Qa-2 proteins by ELISA and immunoprecipitation. Antisera from rabbits immunized with NUPIT reacted with NUPII peptide as well as with SQa-2 molecules secreted from SQa-2 transfectants. Control preimmune rabbit serum was negative in both tests (see below). Antiserum against NUPI failed to recognize secreted SQa-2 (data not shown). Therefore only NUPII antiserum was used for subsequent studies. The first five N-terminal residues of NUPII peptide are common to SQa-2 molecules as well as to the predicted precursor of the GPI-linked protein. To examine the specificity of the NUPII antiserum we tested it on a panel of L-cell and Hepa-1 cell transfectants (expressing SQa-2 or GPIQa-2) characterized in previous studies (12, 15). In both these cell lines the sQa-2 cDNA construct encodes soluble SQa-2. Consistent with this prediction we observed that NUPII, as well as the control mAb 20-8-4, specific for al/a2 domains of both Qa-2 isoforms, precipitated indistinguishable =39-kDa proteins associated with P2-microglobulin from the supernatants of 35S-labeled cells (Fig. 2 and Fig. 3A; in Fig. 2, P2-microglobulin ran off the bottom of the gel). In Hepa-1 cells mQa-2 cDNA encodes -40-kDa GPI-linked membraneattached protein. In addition, the supernatants of these transfectants contain low levels of soluble 39-kDa molecules (MDQa-2) reactive with mAb 20-8-4 (12, 15). It was hypothesized previously that these proteins may have been generated from GPIQa-2 precursors by cleavage with intracellular endogenous phosphatidylinositol-specific phospholipase C or that they represented processing intermediates or cleavage products of GPI-linked molecules. In L cells mQa-2 cDNA directs synthesis of the MDQa-2 -39-kDa soluble product only (12, 15). The absence of membrane-bound =40-kDa GPIQa-2 was proposed to result from L cells' inability to process membrane-destined GPIQa-2 precursors.
RESULTS Generation of Anti-Peptide Antiserum Specific for Predicted C Terminus of SQa-2 Molecules. The alternatively spliced mRNAs encoding precursors of GPI-Qa-2 and SQa-2 glycoproteins differ in their usage of exon 5 and in the location of their translation stop codons (Fig. 1A). The mQa-2 transcript, which contains exon 5, signals termination of GPIQa-2 precursor by using a stop codon located within this exon. The alternatively spliced sQa-2 mRNA, which lacks exon 5, uses a stop codon located downstream from the exon 4/exon 6 junction to terminate translation of SQa-2. Consequently, the two proteins are expected to have distinct C termini. This predicted structural difference was exploited to produce antibodies against a synthetic homologue of the C terminus of SQa-2. The amino acid compositions of the synthesized peptides, NUPI and NUPII, 12 and 17 residues long, respec-
COOH
L
a,
a2
a3
TMI
mQa-2 I|l
2
3
4
l5lOH
A
,,OOH s
Ia-2
2
2
3
16
4
B Exo~n 5
AGCCTCCTOCATACACTGTCTOCAACATGGCGACCATTGCTGTTGTGGTTGACCTTGGAGCTGTGG3CCATCATTGGA¢CTGTGGTGGCTTTTGTGATGAATAGGA¢GTG4AGAACAG MDQa-2 1uProProProTyrThrValSerAsnMetAlaThr I eAIaVaIVaIValAspLeuGIyAIaVaIAIaI le I eGlyAlaValVaIAlaPheVaIMetAsnArgArgTrm
-~~~~~~~~~~~~~~~~~~~~~~~--------------Exon 4 CTGAGATGt3GGGAGATGGG
MDQa-2 LeuArgTrpGlyArgTrpG SQa-2 LeuArgTrpGlyArgTrpG NUPI NUPI I
..Exon 6
I
Exon 8 _
yGI yGI nGI yGI yAspCysAl aProAl aProAl aTrm
FIG. 1. (A) Exon organization of alternatively spliced Qa-2 transcripts (mQa-2 and sQa-2) encoding GPI-linked membrane-expressed Qa-2 (GPIQa-2) and secreted Qa-2 (SQa-2). (B) Amino acid sequences of synthetic peptides diagnostic for SQa-2 protein. Exons are numbered according to the nomenclature used for classical MHC antigens with exon 1 corresponding to leader peptide, exons 2-4 encoding three external domains, al, a2, a3, exon 5 denoting transmembrane domain (TM), and exons 6-8 encoding cytoplasmic regions. Exon 7 is missing in both transcripts due to the mutation of the splice site in the genomic Qa-2 DNA (11). The positions of the termination codons defining translational stops are indicated by arrows. The amino acid sequences of C termini of GPI-linked precursor protein (encoded by fusion of exon 4 with 5) and SQa-2 protein (encoded by fusion of exon 4 with exons 6-8) are detailed. Sequence of NUPI peptide is underlined with a straight line; sequence of NUPII synthetic peptide is underlined with a wavy line.
Immunology: Tabaczewski et al. 20-8-4
C~ csE
,N
GPIQa-2
rb U
Cq
PI
NUPII N
9E(U aUw
ct
(
m
,
C (U
N
Proc. Natl. Acad. Sci. USA 91 (1994)
N
cm
rum. These results demonstrate specificity of the anti-peptide reagent for actively secreted soluble SQa-2. They also provide evidence for structural difference between secreted SQa-2 and soluble MDQa-2. Soluble Qa-2 Proteins Released from Con A-Activated Splenocytes. Soloski et al. (14) reported originally that in Con A-activated splenocytes the biosynthesis of Qa-2 molecules was enhanced severalfold but the levels of the membranebound Qa-2 antigens remained the same or were decreased. Simultaneously, soluble Qa-2 molecules of -39 kDa appear in the culture medium. Subsequent work showed that Con A stimulation of splenocytes was accompanied by a switch in alternative splicing of Qa-2 mRNA (15). In resting splenocytes almost all Qa-2 mRNA included exon 5, while in Con A-stimulated cells up to 30% of the total RNA lacked exon 5. It was proposed that soluble Qa-2 proteins released from Con A-activated splenocytes are translated from sQa-2 mRNAs. To test this hypothesis, supernatants collected from metabolically 35S-labeled Con A-activated splenocytes of C57BL/6 mice were immunoprecipitated with NUPII antiserum and, as control, with mAb 20-8-4. Both antibodies reacted with the =39-kDa band, indistinguishable biochemically from SQa-2 molecules precipitated from supernatants of sQa-2-transfected L cells (Fig. 3A, lanes 1-6). In addition to the 39-kDa SQa-2 protein, NUPII reacted to a different degree with several other proteins, of different molecular masses, found in the culture medium of the activated splenocytes. Longer autoradiographic exposure identified similar bands in NUPII immunoprecipitates of the untransfected and transfected L cells (Fig. 3A, lanes 7-9), suggesting that they represent nonspecific background. To address the possibility that soluble molecules derived from translation products of mQa-2 are also released upon splenocyte activation, we carried out sequential immunopre-
NUPII C cm
c
2 0 a lb a a 2 = E m E o
-42.7
w
SQa-2
or MDQa-2 1
2
3 4 5
L cells
6 7 8 9 10 11 12 13
Hepa-1
L cells
Hepa-1
FIG. 2. Anti-peptide NUPII antiserum reacts specifically with actively secreted proteins (SQa-2) but not with membrane-bound (GPIQa-2) or soluble Qa-2 molecules derived from processing of products of mQa-2 cDNA (MDQa-2). Supernatants from equal cell equivalents of metabolically 35S-labeled L-cell and Hepa-1 transfectants or lysates of equal cell equivalents of vectorially 1251-labeled Hepa-1 transfectants (lanes 4 and 11) were immunoprecipitated with indicated antibodies and analyzed by SDS/10%o PAGE. Positions of bands corresponding to -40-kDa GPI-linked Qa-2 and 39-kDa SQa-2 and MDQa-2 are indicated at left. Size standards (kDa) are listed at right. untrans, Untranslated; PI, preimmune.
Fig. 2 demonstrates that =39-kDa soluble and -40-kDa fully processed GPI-linked molecules encoded by mQa-2 cDNA can be precipitated from metabolically 35S-labeled and vectorially 125I-labeled Hepa-1 transfectants with the control mAb 20-8-4. Similarly, supernatants from L-cell transfectants also contain soluble Qa-2 reactive with mAb 20-8-4. However, as predicted for the molecules lacking SQa-2 C-terminal sequence, none of the Hepa-1- or L-cellsynthesized MDQa-2 proteins reacted with NUPII antise-
A
Antiserum PreNUPII immune F' ml
20-8-4
Antiserum
B
NUPII
|
ZIg 8 s
,
8 a>J
E
:L..
3
O~~~~-
q
t
C
-
up.
-42.7-
_ -
E
