Alternative splicing of fibroblast growth factor receptor 2 - Nature

Oncogene (1997) 15, 3059 ± 3065  1997 Stockton Press All rights reserved 0950 ± 9232/97 $12.00

Alternative splicing of ®broblast growth factor receptor 2 (FGF-R2) in human prostate cancer Russ P Carstens1,2,3, James V Eaton1,4, Hannah R Krigman5, Philip J Walther4,5,6 and Mariano A Garcia-Blanco1,3,6 1

Department of Molecular Cancer Biology, 2Division of Nephrology, 3Department of Medicine, 4Division of Urology, Department of Surgery, 5Department of Pathology and the 6Duke Comprehensive Cancer Center, Duke University Medical Center, Durham, North Carolina, USA

Progression of prostate cancer from an androgen sensitive to androgen insensitive tumor has previously been shown to be accompanied by a change in alternative splicing of ®broblast growth factor receptor 2 (FGF-R2) in a rat model of prostate cancer. This change results in loss of the FGF-R2(IIIb) isoform and predominant expression of the FGF-R2(IIIc) isoform. We sought to determine whether this change in FGF-R2 splicing is also associated with androgen insensitivity in human prostate tumors. We analysed three well characterized human prostate cancer cell lines and three metastatic prostate tumors which have been maintained as xenografts in nude mice. One of the cell lines, LNCaP, and two of the xenografts, DUKAP-1 and DUKAP-2, have been characterized as androgen sensitive, whereas two of the cell lines, DU-145 and PC-3, and one of the xenografts, DU9479, display androgen independent growth. Using an RT ± PCR based assay, we demonstrated that progressive loss of the FGF-R2(111b) isoform correlated with androgen insensitivity in these human prostate cancer models. These ®ndings lend support to the hypothesis that that loss of FGF-R2(IIIb) may be one step in a series of events which lead to progression of human prostate cancer. Keywords: prostate cancer; alternative splicing; androgen sensitivity; ®broblast growth factor receptors; xenograft cell lines

Introduction Prostate cancer, the second most common cause of male cancer deaths, remains a therapeutic dilemma. While there is a high prevalence of the disease, based on autopsy studies, a substantial percentage of such cancers will never threaten a patient's well-being, prompting some to recommend expectant management (rather than aggressive de®nitive therapy) as the best treatment option for many elderly males. In others, prostate cancer progresses with early metastatic spread, confounding curative intervention of localized disease. Elucidation of the biological processes which cause prostate cancer to both metastasize and develop androgen independent growth is needed. Recognition of an aggressive phenotype using biological markers might allow the clinician to limit aggressive Correspondence: MA Garcia-Blanco Received 27 May 1997; revised 12 August 1997; accepted 13 August 1997

therapy for those at risk, while sparing those with indolent disease. In addition, better understanding of the mechanisms which lead to prostate cancer progression can guide the development and testing of new prostate cancer therapies. An important area of research which has had a signi®cant impact upon our understanding of carcinogenesis, both in the prostate as well as other tissues, has been identi®cation of growth factors involved in growth of normal and cancerous cells (Aaronson, 1991). In the prostate such polypeptide growth factors play a critical role in mediating the interactions betweeen stromal and epithelial cells which have been shown to be important in maintaining normal prostate growth and dierentiation (Cunha et al., 1985, 1987; Gleave et al., 1992; Yan et al., 1992). It is proposed that growth factors are key elements which mediate the eects of androgens on prostate cell growth and dierentiation via a directional communication system from stromal to epithelial cells (Yan et al., 1992). Thus, disruption of this system of cellular communication through interactions of growth factors with their receptors may be a step which is involved in tumor development and/or progression. One of the families of growth factors which have been implicated in normal and cancerous cell growth in the prostate is the ®broblast growth factor (FGF) family. These mitogens consist of nine factors, FGF-1 through FGF-9, which are structurally related and have a mass of 20 ± 30 kD (Mason, 1994). Several of these factors have recently been shown to play an important role in prostate cell growth (Mansson et al., 1989; McKeehan, 1991). In particular, ®broblast growth factor 7 (FGF-7, or keratinocyte growth factor (KGF)) has been shown to be a potential mediator of the eects of androgen on prostate growth (Yan et al., 1992). FGF-7 expression is limited to stromal cells in a variety of tissues and it is mitogenic for epithelial cells (Rubin et al., 1989; Finch et al., 1989). In the prostate, production of FGF-7 is similarly restricted to stromal cells and is induced by androgens (Yan et al., 1992). Epithelial cells, but not stromal cells, express a speci®c receptor for FGF-7. This receptor is a speci®c isoform of ®broblast growth factor receptor 2 (FGF-R2), a member of the tyrosine kinase family of cell surface receptors (Hattori et al., 1990; Miki et al., 1991, 1992; Johnson et al., 1991). In normal prostate, and in prostate malignancies as well, it appears that the interaction between FGF-7 and this receptor plays a part in maintaining androgen responsive growth and dierentiation of epithelial cells (Yan et al., 1992, 1993).

Splicing of FGF-R2 in prostate cancer RP Carstens et al

3060

There are currently four known ®broblast growth factor receptor genes, FGF-R1 ± 4, which share signi®cant structural and amino acid homology (Miki et al., 1992; Johnson et al., 1991; Dionne et al., 1990; Jaye et al., 1992; Johnson and Williams, 1993). The general structure of these receptors consists of two or three Ig-like domains which appear to be involved in ligand binding, a single transmembrane domain, and intracellular tyrosine kinase domains. Although a number of dierent isoforms of each of these receptors have been demonstrated, the best characterized example of post-transcriptional modi®cation of these receptors is that involving the second half of the third Ig-like domain of FGF-R2. Here there is a mutually exclusive splicing event in which the second half of this domain is comprised of either the 148 nucleotide IIIb exon or the 145 nucleotide IIIc exon. The resulting isoforms dier in their ligand speci®city in a functionally important manner. The IIIb containing form of the receptor (also known as keratinocyte growth factor receptor, or KGF-R) is responsive to FGF-7 whereas FGF-R2 (IIIc) is not. Conversely FGF-R2 (IIIc) displays a much greater anity for FGF-2 (basic FGF) than FGF-R2 (IIIb) does (Miki et al., 1992; Bottaro et al., 1990; Yayon et al., 1992). Not surprisingly, these dierences in ligand speci®city are consistent with the cell type distribution seen for these receptor isoforms. The IIIb isoform is the predominant isoform seen in epithelial cell types, including prostatic epithelia, and the IIIc isoform is expressed in some, but not all, cells of mesenchymal origin (Miki et al., 1992; Yan et al., 1993; Orr-Urtreger et al., 1993). Thus, this alternative splicing process is consistent with a directional pathway of androgen stimulation in the prostate, whereby androgen mediated stimulated secretion of FGF-7 results in proliferation and dierentiation of prostatic epithelial cells, eects which are eected through the IIIb isoform of the FGF-R2 receptor. McKeehan and colleagues have used the transplantable Dunning R3327 rat prostate tumor model to gain further insight into the mechanisms involved in the development of androgen insensitivity (Yan et al., 1992, 1993; Isaacs et al., 1978). The androgen sensitive, well dierentiated R3327PAP, or DT, tumor can progress to an androgen insensitive, highly aggressive R3327AT3 tumor after castration and serial passage through castrated and female hosts. A very interesting feature of these tumors is that the switch from an androgen sensitive, slow growing tumor to a more aggressive, androgen insensitive tumor is accompanied by a change in the alternative splicing pattern of the epithelial cell FGF-R2 receptor (Yan et al., 1993). Normal prostate epithelia, as well as DT tumor cells, express exclusively the FGF-R2 (IIIb) isoform as described above. In contrast, AT3 tumors express the FGF-R2 (IIIc) variant, which as discussed previously, is not responsive to stromal derived FGF7. Thus, loss of responsiveness to FGF-7 may render these cells independent of stromal derived factors and set up autocrine loops between FGF ligands and their receptors allowing autonomous growth and progression to a more malignant phenotype (Yan et al., 1993). We sought to investigate whether these ®ndings in the rat model could be extended to implicate the FGF-

7/RGF-R2 axis in progresion of human tumors using human prostate cancer cell lines and xenografts. We analysed the pattern of splicing of FGF-R2 in the previously well characterized DU-145, LNCaP and PC3 prostate cancer cell lines as well as in three prostate cancer xenografts established at our institution. The results of these studies lead us to propose that loss of the IIIb isoform of FGF-R2 correlates with development of androgen insensitivity and progression of human prostate cancer.

Results Relative loss of the FGF-7 responsive FGF-R2(IIIb) isoform correlates with androgen independence in DU145, LNCaP and PC-3 DU-145 (Stone et al., 1978), LNCaP (Horoszewicz et al., 1983) and PC-3 (Kaighn et al., 1979) cell lines have previously been described. Cells were obtained from the American Type Culture Collection (ATCC) and after several passages total cellular RNA was harvested and subjected to RT ± PCR using primers speci®c for the exons upstream and downstream of the alternative exons IIIb and IIIc as shown in Figure 1a. Bands corresponding to the expected size for this region of FGF-R2 were consistently seen in two (DU-145 and LNCaP) of the three cell lines, but not in mock (no RNA) RT ± PCR or RT ± PCR reactions containing no reverse transcriptase (data not shown). DNA sequencing con®rmed that the products so identi®ed indeed corresponded to these isoforms of FGF-R2. Following PCR, these samples were then subjected to restriction endonuclease digestion with both AvaI and HincII. As seen in Figure 1a, there is a single AvaI site in exon IIIb but none in exon IIIc, whereas IIIc contains two HincII sites which are not present in IIIb. Thus, PCR products containing IIIb yield full length products of 367 bp which are not digested by HincII, and yield bands of 249 bp and 118 bp upon digestion with AvaI. IIIc containing PCR products result in a 364 bp full length product that is not cut by AvaI and yields 125, 120 and 119 bp products upon digestion with HincII. Following digestion the PCR products were electrophoresed on 8% acrylamide, dried, and exposed to ®lm for 4 ± 12 h. Using this analysis we noted that the LNCaP cells, which have previously been characterized as androgen responsive, expressed nearly exclusively the IIIb containing isoform of FGF-R2 (Figure 1b). DU-145, an androgen insensitive cell line, expressed predominantly the IIIc isoform of FGF-R2 (Figure 1b). Phosphorimager analysis showed the percentage of FGF-R2 (IIIb) to be 96% and 33% in LNCaP and DU-145 cells, respectively. We were unable to detect an RT ± PCR product representing this portion of the FGF-R2 gene in PC-3 cells (also androgen insensitive) even after preparing RNA from these cells twice in parallel with DU-145 and LNCaP. These same RNAs were also subjected to RT ± PCR using actin primers to control for RNA degradation and as shown in Figure 1c, all three cell lines yielded the expected RT ± PCR product. This suggested to us that in PC-3 cells the FGF-R2 gene (or at least this portion of it) is either not expressed or has somehow been lost in these tumors.


3061

a

b

1

2

3

4

5

c

6

1

M 1,018 —

2

3

4

5

6

7

622 —

— 696 b 506,517 —

527 — + 404 —

–

+

–

Mock DU-145 RT-PCR

— 367 — 364

+

–

LNCaP

+

RT

PC-3

309 — — 249

242/238 — 217 201 — 190 180 — 160 — 147 —

d

125 120 119 118

123 — 110 —

M

1

2

3

4

5

6

7

8

9

622 — 527 —

U

A

H

DU-145

U

A

H

LNCap

404 — 309 —

— — 367 bp 364 bp

— 201 242/238 217 — 190 160 — 180 147 — 123 — 110 — M U

— 249 bp

A

H

DUKAP-2

U

A

H

DUKAP-1

U

A

H

125 bp 120 bp 119 bp 118 bp

DU9479

Figure 1 (a) The maps of the RT ± PCR products obtained using primers FGF-FB and FGF-RB for both IIIb and IIIc containing isoforms of FGF-R2. The locations of AvaI and HincII restriction sites are indicated, as are the sizes of the resulting fragments in base pairs following digestion. (b) RT ± PCR products from DU-145 and LNCaP cell lines uncut and after digestion with AvaI or HincII. The sizes of the PCR products both uncut and following digestion are shown. M=pBR322/MspI DNA size markers. U=uncut. A=AvaI digest. H=HincII digest. Lanes 1,4: uncut products. Lanes 2,5: AvaI digested products. Lanes 3,6: HincII digested products. Full length, uncut PCR products yield bands of 367 and 364 bp for IIIb and IIIc containing isoforms, respectively. The presence of 249 bp and 118 bp bands following digestion with AvaI is indicative of FGF-R2 (IIIb). Presence of 125, 120 and 119 bp bands with HincII digestion demonstrates FGF-R2 (IIIc). (c) RT ± PCR products obtained from DU-145, LNCaP and PC-3 cells using actin control primers. The 696 bp product is that expected based on published sequences. M=1 kb ladder DNA size markers. Lane 1: Mock RT ± PCR in which all components were added to the RT and PCR reactions except that no RNA was added. Lanes 2,4,6: Minus reverse transcriptase (RT) reactions in which all components were added to RT and PCR reactions except reverse transcriptase. Lanes 3,5,7: RT ± PCR results with band of expected size. (d) RT ± PCR products from DUKAP-2, DUKAP-1 and DU9479 uncut and digested with AvaI or HincII as described in the legend to Figure 2. Lanes 1,4,7: uncut. Lanes 2,5,8: AvaI digested products. Lanes 3,6,9: HincII digested products

Characterization of DU9479, DUKAP-1 and DUKAP-2 prostate cancer xenografts and analysis of FGF-R2 isoforms in these tumors We sought to extend these ®ndings in prostate cancer cell lines to other prostate tumor samples. Because of the paucity of in vitro prostate cancer cell lines and diculties in using our approach on tumors in situ, we felt that xenograft tumors in nude mice represented a good model in which fairly uniform collections of

prostate cancer cells could be collected and analysed. Histologic analysis of these xenografts using hematoxylin and eosin or immunostained sections is summarized in Table 1. Light microscopic evaluation of hematoxylin and eosin stained sections (Figure 2a,b,d,e,g,h) showed the aggressive, disorganized nature of each xenograft with varying degrees of necrosis, intervening stroma, and nuclear heterogeneity in each tissue sample. None of these characteristics correlated with dierential isoform expression, how-


3062

Table 1 Xenograft Architecture

Histologic description of xenografts

DUKAP-2

DUKAP-1

DU9479

Small and large clusters

Large clusters with central and peripheral necrosis

Nests of 20 ± 30 cells, arranged with orientation to basement membrane Stroma surrounds each nest, 10 ± 15% None 5% Clear to pink, abundant cytoplasm with indistinct cytoplasmic borders Round, small nuclei

Stroma

Dense ®brous stroma Rare ®brous septa, 5% separates cell groups, 25% Individual cell death 2+ 2+ Necrosis 5% 60% Cytoplasm Amphophilic, moderate Amphophilic, scanty. quantities. Cells are polygonal, Cells are rounded with with distinct outlines distinct outlines Nuclei Majority are round, with Round to oval, coarsely granular cytoplasm and clumped chromatin with solitary, eosinophilic 1 ± 3 peripheral micronucleoli macronucleoli. Occasional cells are large, with smudged, enlarged nuclei. Mitoses Infrequent Infrequent PSA 2+, 1% of cells 3+, 10 ± 15% PAP 3+, 10% of cells 3+, 1% Cytokeratin 2+diuse 3+, diuse

a

b

c

d

e

f

g

h

i

none 0 0 2 ± 3+, diuse

Figure 2 Color micrographs of paran-®xed tumor xenografts. DUKAP-2 (a ± c), DUKAP-1 (d ± f) and DU9479 (g ± i) display heterogeneous staining characteristics. H&E staining at 406 (a,d,g) and 1336 (b,e,h) and PSA immunohistochemistry (c,f,i) are shown

ever. Similar staining for prostate speci®c antigen (PSA) (Figure 2c,f,i) and prostatic acid phosphatase (PAP) (data not shown) was seen in DUKAP-1 and DUKAP-2 tissue sections. These both displayed positive, albeit sparse, staining for each of these relatively speci®c prostatic antigens. DU9479, however, revealed no staining for either PSA or PAP. This would seem to corroborate previous histologic evidence that histological specimens of prostate

cancer that display little or no evidence of staining for these antigens were often more aggressive tumors with poor prognostic implications (Epstein and Eggleston, 1983). Interestingly, in the original manuscript describing DU9479 (Graham et al., 1985), the authors were able to demonstrate positive staining for PAP. It should be noted that in the original manuscript the PAP immunohistochemistry was done on snap frozen xenograft tumor tissue as opposed to


paran ®xed tissue which we used in the current study, however at present we do not have a de®nitive explanation for this discrepancy. Each xenograft reacted with antibodies to mixed keratins, con®rming epithelial dierentiation (data not shown). Xenograft tissues from DU9479, DUKAP-1 and DUKAP-2 were subjected to the same RT ± PCR assay described previously. Using this analysis, it can be seen that DU9479 consists almost entirely of FGF-R2 transcripts containing exon IIIc, whereas DUKAP-1 and DUKAP-2 contain both IIIb and IIIc containing transcripts (Figure 1d). This gel was also subjected to phosphorimager analysis to quantify the relative contributions of each isoform and showed that DUKAP-2 consisted of 68% FGF-R2 (IIIb) and DUKAP-1 30%. DU9479, however, consisted of 97% FGF-R2 (IIIc) and thus only 3% FGF-R2 (IIIb). It is noteworthy that although the xenografts contain mostly epithelial cells, there is a small but signi®cant stromal component identi®ed in these tumors which may contribute to the amount of FGF-R2 (IIIc) observed. It may be, therefore, that some, but not all, of the FGF-R2 (IIIc) seen in DUKAP-1 and DUKAP-2 is derived from this stromal compartment. In sum, these results in xenografts, like those in cultured prostatic cell lines, show a correlation between loss of the IIIb isoform of FGF-R2 and androgen insensitivity in human prostate tumors. Discussion Progression of prostate cancer from localized, slow growing tumors to more aggressive tumors capable of regional spread and metastasis as well as development of androgen independence most likely involves a series of stepwise biological events. Such a multistep process of tumorigenesis (Fearon and Vogelstein, 1990) has been proposed to involve a series of mutational events which ultimately lead to development and progression of neoplasia. Mutations which could lead to disruption of cellular pathways involving the ®broblast growth factor family could play a role in a multistep pathway which could ultimately lead to treatment refractory tumors. The ®broblast growth factors have been shown to be important mediators of prostate development and normal prostate growth (Cunha et al., 1985; Yan et al., 1992). In particular, FGF-7 has been shown to be produced by prostatic stromal cells in response to androgens and mediates epithelial cell proliferation and dierentiation via interactions with its receptor, the exon IIIb containing isoform of FGF-R2. This isoform, FGF-R2 (IIIb), is the exclusive isoform expressed by prostatic epithelial cells, whereas FGFR2 (IIIc) is predominantly expressed in mesenchymal derived cells (Yan et al., 1992, 1993). The observations made using the Dunning rat prostate cancer model point to loss of the FGF-7 responsive FGF-R2 (IIIb) isoform as being an important event in the development of androgen insensitivity in these cancers. Thus, it has been proposed that this change in splicing isoforms results in the loss of a normal pathway of differentiation which could lead to tumor progression. While similar ®ndings in human prostate cancer have not previously been described, it is of interest that Diaz de

Medina et al. (1997) analysed FGF-R2 expression in transitional cell cancers of the bladder and noted that compared to normal human urothelium, the expression of FGF-R2 (IIIb) was often signi®cantly depressed and that this decrease was not associated with a corresponding increase in FGF-R2 (IIIc). In addition these authors noted that there were more cancer deaths among those patients with tumors exhibiting decreased levels of FGF-R2 (IIIb). It is also of note that other authors (LaRochelle et al., 1995) showed absent FGFR2 (IIIb) expression in an oral squamous cell carcinoma, but signi®cant FGF-R2 (IIIb) in surrounding epithelium. These observations together with those described in the rat prostate cancer model suggested to us that human prostate cancer progression and or development of androgen insensitivity may also be characterized by loss of FGF-R2 (IIIb). The initial experiments in human prostate cancer cell lines in fact demonstrate nearly exclusive expression of FGF-R2 (IIIb) by the androgen dependent LnCaP cell line, whereas the androgen independent DU-145 and PC-3 lines demonstrated either predominant expression of FGF-R2 (IIIc) or undetectable expression of either isoform, respectively. The lack of observable FGF-R2 expression in PC-3 is particularly interesting in that the FGF-R2 gene is located on chromosome 10q26 and this chromosome appears to be disrupted based on by karyotype analysis of these cells (Kaighn et al., 1979) but not in DU-145 and LNCaP (Stone et al., 1978; Horoszewicz et al., 1983). Therefore, this gene could be aected by translocation or deletion in PC-3 cells. This suggests that in epithelial cells the FGF-R2 gene may in essence play the role of a tumor suppressor gene in prostate cancer and that the IIIb isoform of the gene is the most functionally important isoform in that its loss is most detrimental in the process of tumor progression. Thus, it may be that whereas in PC-3 loss of this gene product may be achieved by loss of expression or direct inactivation of the gene (e.g. through deletion or mutation), cellular events which lead to a change in the pathway of RNA processing of a gene may be another way in which functional inactivation of a tumor suppressor gene can be achieved. The xenograft tumors likewise demonstrated decreased relative levels of FGF-R2 (IIIb) expression in those tumors which exhibited androgen independent growth. It should be noted that while the androgen independent DU-145 cell line and the DUKAP-1 androgen dependent xenograft display a similar percentage of FGF-R2 (IIIb), these separate model systems cannot be directly compared as the degree of cell homogeneity is less in these xenografts. In the xenografts, it is likely that at least some of the FGF-R2 (IIIc) observed is derived from stromal or endothelial elements. Thus it is likely that the percentage of prostatic epithelial cells in DUKAP-1 expressing FGF-R2 (IIIb) is higher than the result seen. In any case, the observation that the complete loss of a normal pathway of dierentiated growth in human prostate cancers mediated by FGFR2 (IIIb) correlates with development of androgen independence further supports this event as being an important biological marker for progression of prostate cancer. Further investigation into the mechanisms controlling splicing of this receptor may also target the development of future therapies for this highly prevalent disease.

3063


3064

Materials and methods Development of DU9479, DUKAP-1 and DUKAP-2 human prostate cancer cell xenografts The establishment of the DU9479 (Graham et al., 1985) and the establishment of DUKAP-1 and DUKAP-2 (Walther PJ, in preparation) have been described. Brie¯y, DU9479 was initiated following a biopsy of iliac crest from a patient with hormone refractory metastatic adenocarcinoma of the prostate. Biopsy tissue was veri®ed as metastatic adenocarcinoma of the prostate by the Clinical Pathology service at Duke University Medical Center prior to further experimental use. Tumor tissue removed from the patient was injected subcutaneously into the ¯ank of female or male BALB/cURD nu/nu host mice. DU9479 xenografts grew equally well in male and female mice and thus were deemed hormone/androgen independent. DUKAP-1 and DUKAP-2 were derived initially from supraclavicular lymph node biopsies in patients with metastatic prostate cancer who, at that time, were clinically responding to androgen ablation. These xenografts were established in a manner similar to DU9479 except that attempts to grow the tumors in female mice were unsuccessful. Thus they were deemed hormone/androgen dependent. In addition, animals bearing DUKAP-1 tumors who underwent castration demonstrated marked tumor regression. This correlates well with the clinical behavior of the tumors at the time of their harvest. Immunohistochemical staining and analysis of xenograft tissue specimens Original pathologic diagnosis of each biopsy specimen was con®rmed as above and is reported elsewhere (Graham et al., 1985; Walther, in preparation). After several passages in individual nude mice, tumor tissue was ®xed in buered formalin, processed and embedded in paran. Four micron thick sections were placed on Probe-On Plus (Fisher Scienti®c, Pittsburgh, PA) glass slides and immunostained by capillary action using a Code-On automated stainer (Fisher Scienti®c) (Brigati et al., 1988). Following paran removal and quenching of endogenous peroxidase activity, tissue sections were post®xed in 10% neutral buered formalin to prevent overdigestion from pepsin proteolytic enzyme (Sigma Chemical Co., St. Louis, MO, #P7012), preserving tissue and cellular architecture. Human prostate speci®c antigen (PSA), protein acid phosphatase (PAP) and cytokeratin were detected with rabbit anti-human polyclonal antibodies (Dako Corp., Carpinteria, CA) at a 1 : 50 dilution. The unlabeled, bound primary antibody was detected with biotinylated goat anti-rabbit IgG (Vector Laboratories, Burlingame, CA, #BA-1000) followed by horseradish peroxidase labeled streptavidin (Jackson Immuno Research, Inc., West Grove, PA, #016-030-084). The sections were then developed with 3,3' diaminobenzidine (DAB) tetrahydrochloride (0.5 mg/ml) (Sigma Chemical Co., St. Louis, MO, #D5637) in 0.05 M Tris buer, pH 7.6. Enhancement of the DAB reaction with 1% cupric sulfate solution and subsequent counterstaining of tissue sections with modi®ed Harris Hematoxylin (Fisher Scienti®c) completed this standard staining protocol. The sections were dehydrated, cleared and mounted with Acrytol (Surgipath Medical Industries, #01720). Analysis of the immunostained xenograft tissue specimens was done by the Surgical Pathology Divison of Anatomic Pathology at Duke University Medical Center.

RNA preparation and reverse transcription Total cellular RNA was isolated from frozen xenograft tumors using a standard procedure (Chomczynski and Sacchi, 1987). 2 mg of total RNA were heated to 1008C for 3-5 min, then chilled on ice and used in a reverse transcription reaction in a volume of 20 ml containing 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 1 mM dNTPs, 2.5 mM oligo dT12 ± 18, 2 U Rnasin (Promega), and 200 U MMLV-RT (Gibco) at 378C for 1 h. Samples were then heated to 908C for 5 min, then chilled on ice. PCR and restriction digestion 2 ml of each reverse transcription reaction was ampli®ed in a 100 ml PCR reaction containing 50 mM KCl, 10 mM TrisHCl (pH 8.8), 1.5 mM MgCl2, 0.1% gelatin, 200 mM dNTPs, 100 nM each primer, 10 mCi [a-32P]dATP and 2.5 U Taq DNA polymease (Stratagene or Boehringer Mannheim). Primers used were FGF-FB: CCCGGGTCTAGATTTATAGTGATGCCCAGCCC and FGF-RB: CCC GGG GAA TTC ACC ACC ATG CAG GCG ATT AA. The last 20 bases of these primers contain homology to rat sequences in the exons upstream and downstream of exons IIIb and IIIc, respectively. The human sequence in the regions represented by the oligonucleotides diered from rat by only one nucleotide in each primer and these primers were able to eciently amplify this region of FGF-R2 equally well using rat, human, or mouse templates (data not shown). Additional primer sequence at the 5' end of these oligonucleotides represent restriction sequences used for subsequent cloning and sequencing. Primers used for the actin controls were Actin-F(DMG-095): CACCAACTGGGACGACATGG and Actin-R(DMG-082): CCAGGGTACATGGTGG-TGCC. Ampli®cation conditions were performed using a Perkin-Elmer 2400 Thermal Cycler and consisted of an initial denaturation at 948C for 4 min, followed by 40 cycles of denaturation at 948C for 30 s, annealing at 658C for 30 s and extension at 728C for 1 min. After 40 cycles the reactions were completed with a ®nal extension at 728C for an additional 7 min. In all ampli®cation reactions a mock reverse transcription control was included which resulted in no PCR product. Following phenol/chloroform extraction and ethanol precipitation, the PCR products were resuspended and subject to restriction endonuclease digestion with either AvaI or HincII (New England Biolabs) according to the manufacturer's recommendations. Analysis of undigested and digested PCR products was done by electrophoresis on 8% acrylamide non-denaturing gels, followed by drying and exposure to Amersham Hyper®lm MP. Phosphorimager analysis was performed using a Molecular Dynamics Phosphorimager. Sequencing of PCR products was performed by cloning into either PCR2.1 (Invitrogen) or pBluescript SK+ (Stratagene) and dideoxynucleotide sequencing with Sequenase (United States Biochemical) according to the supplier's speci®cations.

Acknowledgements We thank members of the Garcia-Blanco laboratory for helpful advice and suggestions and the Keck foundation for support of the Leon Levine Science Research Center where much of this research was performed. This work was supported by an NIH grant and the Research Discovery Grant of the Duke Comprehensive Cancer Center to MAGB. RPC was supported by an NIDDK training grant.


3065

References Aaronson SA. (1991). Science, 254, 1146 ± 1153. Bottaro DP, Rubin JS, Ron D, Finch PW, Florio C and Aaronson SA. (1990). J. Biol. Chem., 265, 12767 ± 12770. Brigati DJ. (1988). J. Histotech., 11, 165 ± 183. Chomczynski P and Sacchi N. (1987). Anal. Biochem., 162, 156 ± 159. Cunha GR, Donjacour AA, Cooke PS, Mee S, Bigsby RM, Higgins SJ and Sugimura Y. (1987). Endocrine Rev., 8, 338 ± 363. Cunha GR, Bigsby RM, Cooke PS and Sugimura Y. (1985). Cell Di., 17, 137 ± 148. Diaz de Medina SGD, Chopin D, Marjou AE, Delouvee A, LaRochelle WJ, Hoznek A, Abbou C, Aaronson SA, Thiery JP and Radvanyi F. (1997). Oncogene, 14, 323 ± 330. Dionne CA, Crumley G, Bellot F, Kaplow JM, Searfoss G, Ruta M, Burgess WH, Jaye M and Schlessinger J. (1990). EMBO J., 9, 2685 ± 2692. Epstein JI and Eggleston JC. (1983). Hum. Path., 15, 853 ± 859. Fearon ER and Vogelstein B. (1990). Cell, 61, 759 ± 767. Finch PW, Rubin JS, Miki T, Ron D and Aaronson SA. (1989). Science, 245, 752 ± 755. Gleave ME, Hsieh JT, Von Eschenbach AC and Chung LWK. (1992). J. Urol., 147, 1151 ± 1159. Graham SD, Poulton SH, Linde J, Woodard BH, Lyles KW and Paulson DF. (1985). The Prostate, 7, 369 ± 376. Hattori Y, Odagir H, Hakatan H, Miyagawa K, Naito K, Sakamoto H, Katoh O, Yoshida T, Sugimura T and Terada M. (1990). Proc. Natl. Acad. Sci. USA, 87, 5983 ± 5987. Horoszewicz JS, Leong SS, Kawinsk E, Kar JP, Rosenthal H, Chu TM, Mirand EA and Murphy GP. (1983). Cancer Res., 43, 1809 ± 1818. Isaacs JT, Heston WDW, Weissman RM and Coey DS. (1978). Cancer Res., 38, 4353 ± 4359.

Jaye M, Schlessinger J and Dionne CA. (1992). Bioch. Biophys. Acta, 1135, 185 ± 199. Johnson DE and Williams LT. (1993). Adv. Cancer Res., 60, 1 ± 41. Johnson DE, Lu J, Chen H, Werner S and Williams LT. (1991). Molecular and Cellular Biology, 11, 4627 ± 4634. Kaighn ME, Narayan KS, Ohnuki Y, Lechner JF and Jones LW. (1979). Invest. Urol., 17, 16 ± 23. LaRochelle WJ, Dirsch OR, Finch PW, Cheong H, May M, Marchese C, Pierce JH and Aaronson SA. (1995). J. Cell. Biol., 129, 357 ± 366. Mansson P, Adams P, Kan M and McKeehan WL. (1989). Cancer Res., 49, 2485 ± 2494. Mason IJ. (1994). Cell, 78, 547 ± 552. McKeehan WL. (1991). Cancer Surv., 11, 165 ± 175. Miki T, Bottaro DP, Fleming TP, Smith CL, Burgess WH, Chan AM and Aaronson SA. (1992). Proc. Natl. Acad. Sci. USA, 89, 246 ± 250. Miki T, Fleming TP, Bottaro DP, Rubin JS, Ron D and Aaronson SA. (1991). Science, 251, 72 ± 75. Orr-Urtrege A, Bedford MT, Burakova T, Arman E, Zimmer Y, Yayon A, Givol D and Lonai P. (1993). Dev. Biol., 158, 475 ± 486. Rubin JS, Osada H, Finch PW, Taylor WG, Rudiko S and Aaronson SA. (1989). Proc. Natl. Acad. Sci. USA, 86, 802 ± 806. Stone KR, Mickey DD, Wunderli H, Mickey GH and Paulson DF. (1978). Int. J. Cancer, 21, 274 ± 281. Yan G, Fukabori Y, McBride G, Nikolaropolous S and McKeehan WL. (1993). Mol. Cell Biol., 13, 4513 ± 4522. Yan G, Fukabori Y, Nikolaropolous S, Wang F and McKeehan WL. (1992). Mol. Endo., 6, 2123 ± 2128. Yayon A, Zimmer Y, Guo-Hong S, Avivi A, Yarden Y and Givol D. (1992). EMBO J., 11, 1885 ± 1890.