Alternative splicing removes an Ets interaction domain ... - Springer Link

Download PDF
3 downloads 3337 Views 466KB Size Report
Comment
May 3, 2005 - runt-homology domain responsible for DNA binding and also the C-terminus are both .... www.fruitfly.org/), NCBI BLASTN+X, ORF finder (http://.
Dev Genes Evol (2005) 215: 423–435 DOI 10.1007/s00427-005-0490-0

ORIGINA L A RTICLE

Kristina Jackson Behan . Jason Fair . Shalini Singh . Michael Bogwitz . Trent Perry . Vladimir Grubor . Fiona Cunningham . Charles D. Nichols . Tara L. Cheung . Philip Batterham . John Archie Pollock

Alternative splicing removes an Ets interaction domain from Lozenge during Drosophila eye development Received: 29 November 2004 / Accepted: 8 April 2005 / Published online: 3 May 2005 # Springer-Verlag 2005

Abstract Physical and functional characteristics of the RUNX family of transcription factors are conserved between vertebrates and the Drosophila protein Lozenge. The runt-homology domain responsible for DNA binding and also the C-terminus are both nearly identical between the two proteins. The mammalian and fly proteins heterodimerize with a non-DNA binding partner protein to form a core binding factor essential for gene regulation during cell Communicated by C. Desplan K. J. Behan and J. Fair contributed equally to the data presented Electronic Supplementary Material Supplementary material is available for this article at http://dx.doi.org/10.1007/s00427-0050490-0. Present address: K. Jackson Behan University of West Florida, Pensacola, FL, 32514, USA J. Fair . M. Bogwitz . T. Perry . V. Grubor . F. Cunningham . P. Batterham Department of Genetics, University of Melbourne, Parkville, Victoria, Australia S. Singh . T. L. Cheung . J. A. Pollock (*) Department of Biological Sciences, Duquesne University, Pittsburgh, PA, 15282, USA e-mail: [email protected] Tel.: +1-412-8554043 Fax: +1-412-3965907 Present address: F. Cunningham Royal Children’s Hospital Parkville, Murdoch Children’s Research Institute, Victoria, 3052, Australia Present address: C. D. Nichols Louisiana State University, New Orleans, LA, 70112, USA

differentiation. The mammalian protein RUNX1 (AML1/ PEBP2αB) interacts with the transcription factor Ets-1 to increase DNA binding and transactivation potential. Alternative splicing of the mammalian RUNX1 removes a domain required for this cooperative transactivation. In this work we determine the structure of the lozenge transcription unit and map 21 mutations. We show that the lozenge transcript is alternatively spliced during eye development to remove an Ets interaction domain. Emphasis is placed on Pointed the Drosophila homolog of the vertebrate Ets1 protein; both Lozenge and Pointed proteins are needed for the activation of prospero expression. We use site-directed mutagenesis and yeast two-hybrid analysis to show that conserved amino acids within the alternate Lozenge exon are important for interaction with Pointed. Furthermore, the ectopic expression of Lozenge is sufficient to rescue Prospero expression in the presence of the Pointed competitor, YanACT. We show that both lozenge isoforms are expressed during eye development and that the relative ratio of the transcripts for the two isoforms is sensitive to changes in Ras activity. We suggest that during eye development, Lozenge isoforms function in divergent roles, either interacting with Pointed on downstream targets or by functioning independently to establish distinct cell fates. Keywords RUNX1 . AML1 . Core binding factor α2 . Pointed . Yan . Prospero

Introduction Among metazoans, virtually all cell fates are determined by a small collection of signaling pathways (Pires-daSilva and Sommer 2003). One of these is the receptor tyrosine kinase pathway that modulates the Ras/MAP kinase phosphorylation signaling cascade. Within tissues, several different cells may use the same signaling pathways to distinguish different fates, with the cell’s own history establishing each cell’s unique competence. A given cell type may also rely on signal strength and cross-talk between signaling pathways to determine fate and terminal differentiation pro-

424

grams. In each case, the signaling pathway influences gene expression. Thus, a cell’s fate and morphology is determined by the action of signaling pathways on transcription factors and in turn, the transcription factor’s regulation of specific target genes. One target of the MAP Kinase pathway in Drosophila is the RUNX1 transcription factor Lozenge (Behan et al. 2002). Members of the RUNX family have been described in species of worms, flies, frogs, fish, and mammals, and the functional parallels in blood cell development across species are striking (Lee et al. 2004; Daga et al. 1996; Klein et al. 2002; Kalev-Zylinska et al. 2002; Bae et al. 1993; Zhu et al. 1994; Ghozi et al. 1996). RUNX1 is an oncogene also known as acute myeloid leukemia 1 (AML1) and core binding factor α2 (CBFα2). The core-binding factor is a heterodimeric transcription factor that binds to the core element of enhancers and promoters. RUNX1 is the alpha subunit of the core-binding factor and has been widely studied for its role in blood development and leukemogenesis (Tenen 2003). The partner protein, core binding factor β (CBFβ), does not contact DNA directly. CBFβ changes the conformation of the RUNX protein to increase its affinity for target DNA (Golling et al. 1996; Berardi et al. 1999). Another key partner protein is the Ets-1 proto-oncoprotein, a member of the Ets family of transcription factors (Dittmer 2003). A multimeric protein complex of RUNX1 and CBFβ can interact with Ets-1 at RUNX1/Ets-1 composite DNA binding sites in the enhancers of downstream genes. Such a protein complex relaxes autoinhibition of both RUNX1 and Ets-1, and results in cooperative binding of both proteins to DNA (Wotton et al. 1994; Erman et al. 1998; Kim et al. 1999; Goetz et al. 2000; Gu et al. 2000; Dittmer 2003). In vertebrates, regions of cooperative protein interaction have been implicated in both RUNX1 (PEBP2αB) and Ets-1 (Kim et al. 1999; Gu et al. 2000; Goetz et al. 2000). Several aspects of the RUNX1/Ets-1 system are recapitulated in the functions of the Lozenge protein in the fruit fly, Drosophila. The Drosophila RUNX1 factor, Lozenge, is involved in blood cell development (Rizki and Rizki 1981; Canon and Banerjee 2000; Lebestky et al. 2000). Lozenge is also expressed in neurons and nonneuronal cone and pigment cells during eye development (Crew et al. 1997; Flores et al. 1998; Behan et al. 2002). Mutations affecting the lozenge locus map at recombination position 1–27.7, cytological bands 8D8-9 on the X chromosome (Morgan et al. 1925; Bridges and Brehme 1944; Lefevre 1976; Green 1990). The locus is genetically complex, exhibiting interallelic recombination and contradictory complementation (Oliver 1940; Green and Green 1949; Green 1990; Batterham et al. 1996). Daga et al. (1996) cloned lozenge demonstrating that it encoded a transcription factor with homology to Runt and AML1. During the late third instar, transcriptional expression of lozenge is seen in the undifferentiated cells behind the morphogenetic furrow. This furrow is a developmental marker for retinal differentiation. A few hours later in eye development, lozenge expression increases in three photorecep-

tor neurons (R1, R6, and R7), and later in the four cone cells, and the pigment cells (Crew et al. 1997; Behan et al. 2002). Lozenge protein expression was visualized with an antibody made to a peptide sequence in exon VI, and mirrors transcriptional expression (Flores et al. 1998). In the eye, Lozenge requires the CBFβ homolog Big Brother, which is expressed in all cells that express Lozenge (Li and Gergen 1999; Kaminker et al. 2001). Lozenge acts as a positive regulator of prospero in R7 and cone cells (Kauffmann et al. 1996; Xu et al. 2000) and shaven (D-Pax2, sparkling) in cone and pigment cells (Flores et al. 2000). Two Ets factors, Yan and Pointed contribute to the regulation of these genes, too. Yan is a transcriptional repressor (Lai and Rubin 1992) that temporally restricts the up-regulation of Lozenge in differentiating cells of the developing retina (Behan et al. 2002). Yan also directly represses prospero expression in developing R7 and cone cells (Xu et al. 2000) and Yan represses D-Pax2 expression in cone and pigment cells (Flores et al. 2000). Pointed is a transcriptional activator, and competes with Yan for the same binding sites on both the prospero and the D-Pax2 enhancers. Both Yan and Pointed are phosphorylated by the Ras cascade via MAP kinase during development, but with opposite effects. Phosphorylation of Pointed increases its ability to transactivate its targets (Brunner et al. 1994). Phosphorylation of Yan results in its ultimate degradation (Rebay and Rubin 1995). The YanACT allele produces a protein that lacks phosphorylation sites and is hyperstable (Rebay and Rubin 1995). Ectopic expression of YanACT represses prospero expression (Xu et al. 2000) and D-Pax2 expression (Flores et al. 2000). YanACT also represses lozenge up-regulation (Behan et al. 2002) and thus prevents differentiation of R7 (Rebay and Rubin 1995). Fine structure genetic analysis has localized lozenge mutations to four subloci—spectacle, krivshenko, lozenge, and glossy (Green and Green 1956; Green 1961; Batterham et al. 1996). To date, only three mutations mapping to the spectacle sublocus and large deletions removing much of the locus have been analyzed at the molecular level (Flores et al. 1998). Furthermore, our understanding of the molecular structure of the lozenge gene rests on the analysis of a single cDNA clone, c3.5. Therefore, we have used detailed sequence analysis to determine the physical locations of 21 lozenge mutations, defining the extent of the lozenge locus. We also find that lozenge mRNA is alternatively spliced during eye development similar to vertebrate RUNX1 factors. Through site-directed mutagenesis combined with yeast two-hybrid analysis, we demonstrate direct Lozenge– Pointed protein interaction facilitated by sequences found in the alternative exon. We also show that a severe truncation allele of lozenge that retains exon V is still able to transactivate prospero in R7 cells. We show that both lozenge isoforms are expressed with the full-length form being the predominant type. Similar to mammalian RUNX proteins, we show that expression of both lozenge isoforms is sensitive to changes in Ras expression, and significantly that the relative ratio of these isoforms is altered in a dominant negative Ras background, suggesting that a cell-

425

specific ratio of the isoforms exists. We propose a model where the Lozenge and Pointed proteins interact prior to binding DNA at a composite Lz–Pnt binding site.

Materials and methods Fly Stocks Canton S was used as wild type. Dr. U. Banerjee provided GMR-lz, lzr1, lzr7, lzr8, lzr9, and lzr11. Dr. G. Rubin provided UAS-yanACT and sev-yanACT. Canton S and P{w+mW.hs=sev-hs-Ras1N17}JA, w1118 were provided by the Bloomington Stock Center. Sequencing the genomic DNA region of lozenge Doublestranded, contiguous sequence was obtained from the overlapping cosmid clones 11 and 12 (Daga et al. 1996) using a custom-primer walking strategy. PCR and sequencing was performed in a Mastercycler gradient (Eppendorf) or Progene (Techne) thermocycler, directly on purified cosmid DNA (Wizard Plus Maxipreps DNA Purification System, Promega Corporation) or from PCR products amplified with Pfu DNA polymerase (Promega Corporation). The sequencing chemistry used was ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer). Completed sequence reactions were run and detected on gels by the Australian Genome Research Facility http:// www.agrf.org.au/) and results compiled and annotated with Sequencher 3.1 (Gene Codes Corporation). Computational analysis The 45,142 bp of genomic DNA spanning the lozenge gene was analyzed with the following gene prediction and sequence similarity utilities: BDGP/ EDGP - BLASTN+X, splice site prediction, Genie (http:// www.fruitfly.org/), NCBI BLASTN+X, ORF finder (http:// www.ncbi.nlm.nih.gov/), HGMP-NIX bioinformatics analysis tool (http://www.hgmp.mrc.ac.uk/), ANGIS-Tandem (maximum repeat size 500, minimum 2, threshold 20) and Pileup (Gap creation penalty 5.0,Gap extension penalty 0.3) (http://www.mel1.angis.org.au/WebANGIS/WAG/), Nnpredict (http://www.cmpharm.ucsf.edu/cgi-bin/nnpredict. pl) for secondary structure of exon V and site-directed mutant of exon V. Additional analysis was done using http:// www.embl-heidelberg.de/predictprotein/predictprotein.html and http://www.cmpharm.ucsf.edu/~nomi/nnpredict.html. Mutation mapping Genomic DNA was extracted from approximately 20 to 30 flies, as described (Sambrook et al. 1989). Standard PCR reactions were used to map deletions via PCR walking at either end of potential breakpoints to pinpoint the 5′ and 3′ limits, and then across the breakpoints, in expectation of a product significantly smaller than the known sequence in AF217651. Positive results were purified (Wizard PCR Preps DNA Purification System, Promega Corporation) and sequenced to determine the exact molecular breakpoints in the mutant strain. Insertion mutations were first localized with standard PCR, where a failure of amplification indicated a large insert between a primer pair. Second, breakpoints for transposable elements of known identity were PCR-amplified using element-specific terminal primers and genomic DNA-

specific primers flanking the insert. These products were purified and sequenced to determine exact breakpoints to the nucleotide level. Inserted elements of unknown identity were amplified with long PCR (Expand 20 KbPlus PCR System-Boehringer Mannheim) using genomic DNA-specific primers, purified and sequenced to determine the exact breakpoints and confirm the sequence identity of the insertion element. Site-directed mutagenesis QuikChange site-directed mutagenesis kit (Stratagene) was used to create an R440E and R441E mutation in the conserved portion of exon V. The mutation was made in both the full-length Lozenge sequence and a gene fragment encoding just exon V. The mutation changed the charge of the molecule but maintained the predicted secondary structure of alpha helix. Forward primer SDMF: ctggagtcgcttgaggagtccgccaaggtgg cagcg Reverse primer SDMR: cgctgccaccttggcggactcctca agcgactccag. After transformation each construct was fully sequenced on both strands. Mutant clones were named LzSDM for the full-length lozenge mutant and E5-SDM for the Exon V mutant peptide. Yeast two-hybrid assay The Matchmaker Two-hybrid system 3 (Clontech) was used to detect protein interaction following the manufacturer’s instructions. For the assay, Lz3.5, Lz SDM, E5 (exon 5), E5SDM, and Pointed (PntP2) were cloned into plasmids pGBKT7 and pGADT7 to express fusion proteins containing Gal4 DNA binding domain or the Gal4 activation domain in all possible combinations (Table 1). All clones were verified by sequencing. Saccharomyces cerevisiae strain AH109 and Y187 harboring the reporter gene β-galactosidase was used for cotransformation by using the lithium acetate method. Transformants were plated on synthetic medium without tryptophan and leucine and tested for interaction. Filter assays for β-galactosidase activity were performed with X-gal as a substrate. Colonies (2 mm diameter) on filters were frozen with liquid nitrogen for 1 min, and then incubated with X-gal (334 μg/ ml) at 30°C for color development. Positive and negative controls were purchased from Clontech and run with each assay. Protein extraction and Western blot analysis The fusion proteins contain c-myc and HA epitope tags used to confirm protein expression in the yeast cells. Soluble protein ex-

Table 1 Clones designed for yeast two-hybrid pGADT7-activation domain+LEU2

pGBKT7–DNA binding domain+TRP

Lozenge (Lz) Lozenge mutant (Lz SDM) Pointed P2 Lozenge Exon V (E5) Lozenge Exon V mutant (E5 SDM)

Lozenge (Lz) Lozenge mutant (Lz SDM) Pointed P2 Lozenge Exon V (E5) Lozenge Exon V mutant (E5 SDM)

426

tracts were prepared from yeast strain AH109 and Y187, cotransformed with pGBKT7 encoding c-Myc tagged Gal4 DNA binding domain fusion protein and pGADT7 encoding HA tagged Gal4 activation domain fusion protein. Yeast proteins (50 mg/lane) were electrophoresed on duplicate 4–20% Tris-Gly gels (Invitrogen) and transferred to an Invitrolon polyvinylidene difluoride membrane (Invitrogen) using the Xcell II Blot Module (Invitrogen). Membranes were stained with Ponceau S 0.5% in 1% acetic acid to check for efficiency of transfer. Membranes were blocked and probed with primary monoclonal antibody HA-11 (Covance) and monoclonal antibody c-myc (Clontech) at 1:5,000, and incubated at room temperature for 1 h. Secondary peroxidase-labeled antibody was used in combination with SuperSignal West (Pierce) for 5 min at room temperature before exposing to Kodak Biomax MR Film for visualization. RNA preparation and reverse transcription Thirty-two white prepupae were staged as 0–4 h postpuparium formation based on their ability to sink in 1 M NaCl. RNA was harvested from cephalic complexes using RNeasy (Qiagen). Homogenization was done with a QIA shredder (Qiagen) per manufacturer’s instructions and 1.2 μg RNA was reverse-transcribed using oligo-dT primers and the Gibco Life Technologies Superscript II kit. Forward primers were as follows: F3, agcaatagcaacaa taacaac (50 pmol); X4Fnt35 (47 nucleotides upstream of Saba2), ccacgactccgccacaggtg (28 pmol); Saba2, ccgtcgatg gaccccgcgag (58 pmol). Reverse primers were: R6, cgagt tgattgtactattcg (50 pmol); R7, aactcgaggatccatttgtc (56 pmol); and Saba3, ttgggtcaatagggtcgccacac (39 pmol). Primers to rp49 were used as a control. All reactions used 200 nM dNTPs, Genechoice Taq polymerase, and buffer, 10 μl Q solution (Qiagen) and 2 μl of the first strand cDNA in a total volume of 50 μl. PCR amplification was determined to be exponential at 25 cycles for the primers used. For quantitative PCR, the first step was 12 cycles with X4Fnt35 and Saba3. Nested PCR confirmed the amplification of both Lzc3.5 and LzΔ5 by using 1 μl of this product as template for the second step of 23 cycles with Saba2 and Saba3. When RNA from equal numbers of animals were transcribed, both lz transcripts are decreased in sev-Ras1N17 relative to wild-type, PCR parameters were an initial denaturation at 94°C for 4 min, followed by the cycle of 94°C for 1 min, 63°C for 1 min, and 72°C for 2 min. For quantitative analysis, PCR products were serially diluted and electrophoresed on 1% agarose gels in TAE buffer stained with Gelstar (Biowhittaker), and imaged with a digital camera. Quantitative data analysis was performed using Kodak 1D software. For sequencing analysis, PCR products were ligated to the pCR vector for TA cloning (Invitrogen) and transformed into TOPOF’ cells as per manufacturer’s instructions. DNA was sequenced at the University of Pittsburgh Automated DNA sequencing center, by using the promoter primer sequences resident in the pCR vector.

Fig. 1 a Recombination map of the lozenge locus showing the " mutations analyzed here that define the four subloci (spectacle, krivshenko, lozenge, and glossy). b Schematic representation of a molecular map of the lozenge region. The 45,142-bp sequence was derived from cosmids 11 and 12 (Daga et al. 1996), and has the GenBank accession number AF217651. The six exons of lozenge c3.5 (Daga et al. 1996) are numbered I–VI and highlighted in red, whilst surrounding genes are shown in dark blue. Insertion mutations (lzgal4, lzmr2, lzL, lz34, lz37, lzK, lz1, and lzsprite) are depicted as black triangles above the map and deletion mutations (lzs, lz50e, mr1, lz38.71, lzr1, lzr7, lzr8, lzr9, lzr11, lz3, lzY4, and lzg) as black triangles below. Other mutations shown include lzts1 (exon III) and lzts114 (exon III and VI). lzL contains a large insertion and a deletion, and lzr9 and lz3 contain small insertions and a deletion also. RT-PCR reveals two lozenge isoforms. c RT-PCR on mRNA purified from white prepupal eye tissue. The smaller isoform lacks exon V. d Coding regions of both Lozenge isoforms. The Runt domain is depicted RD, dark gray. The alternatively spliced exon V is depicted E5, black. The conserved VWRPY is marked with a bold line at the C′ terminus of the coding region. Primers named Saba2 and Saba3 are indicated by arrows above the map and amplify between the Runt domain and the conserved C′ terminus. The F3 and R7 primers were used to delimit the length of the alternative transcript, and are also indicated. e Alignment of Lozenge and murine RUNX1 protein isoform PEBP2αB1 spanning their alternatively spliced exons. The predicted secondary structure for Lozenge is represented above the sequences. Alpha helices are shown in pink, beta strands are depicted as yellow arrows, green curved arrows indicate beta turns, and blue lines indicate random coils. The double arrows (pointing down) show the exon boundaries for Lozenge. The open arrow (pointing up) indicates the exon boundaries for the PEBP2αB1. Identical amino acids are indicated by stars. The strong homology at the beginning of the sequence shown is the terminus of the runt-homology domain. Included in that region is the EI Ets interaction domain (pink box) defined by Kim et al. (1999). The second Ets interaction domain (EII pink box) that Kim and coworkers defined is not as highly conserved with Lz. The alpha helix in Lozenge Exon V has a blue box with a high degree of sequence conservation. The yellow box highlights the conserved arginines that are disrupted by site-directed mutagenesis. The splicing of LzΔ5 eliminates all three putative Ets-interaction domains (EI, EII, and the alpha helix)

Histology and microscopy Immunohistochemistry was performed as previously described (Behan et al. 2002). AntiProspero (Spana and Doe 1995) was diluted at 1:5 and detected with antimouse FITC (Vector Laboratories) diluted at 1:100. Anti-Runt (Kosman et al. 1998) was diluted 1:200 and detected with anti-guinea pig TRITC (Sigma) diluted at 1:200. Z stacks of confocal images were taken at 1-μm increments on a Biorad MRC600 and projected for final image. Scanning electron microscopy was done on unfixed 0- to 3-day-old adult flies using a Hitachi S-2460N.

Results Extent of the lozenge locus Interallelic recombination analysis indicates that the locus spans 0.14 cM map units and that there are four subloci (Green and Green 1956; Green 1961; Batterham et al. 1996). We sequenced two overlapping cosmid clones previously identified as hybridizing to the lozenge cDNA clone c3.5 (Daga et al. 1996). The entire lozenge locus is contained within this 45,142-bp sequence (Fig. 1; GenBank accession number AF217651).

427

We have sequenced 21 distinct mutations collected from both historic and modern collections to define the extent of the lozenge locus (Fig. 1; Table 2). The majority of the mutations represent deletions or the insertion of transposable elements. The molecular distance between mutations in the lozenge locus at the DNA level appears to be poorly correlated with the recombination distances between these mutations at the genetic level (see Discussion). Lesions associated with the spectacle sublocus mutations are located in the 4-kb interval between the first exon and the third intron. Mutations from the krivshenko and lozenge subloci also map to the third intron and are less than 500 bp

apart, whereas the glossy mutations are located 11 kb further 3′ in exon VI. The molecular analysis of the lozenge mutations did not provide evidence of any additional structural elements at the locus beyond the exons identified through the sequencing of lozenge cDNA c3.5 and the annotation of the genome. Lozenge is alternatively spliced Using nested primers, reverse transcriptase PCR (RT-PCR) of tissue from eyeimaginal disks revealed two products (Fig. 1c, d). By agarose gel electrophoresis, the difference in size was ∼360

428 Table 2 Mutations in the lozenge locus

Mutation

Mutation type

lzgal4

P-element insertion GATTCGAC target site duplication P-element insertion AGTCAGTT target site duplication Inserted, roo LTR transposable element Deletion of 16,497 bp Inserted nomad LTR transposable element TGTA target site duplication Inserted tourist transposable element AT possible target site duplication Inserted copia LTR transposable element GCAG target site duplication Inserted gypsy LTR transposable element TACA target site duplication P-element insertion CCACCCAC target site duplication Substitution of Asn351 to Ile Substitution of Asn351 to Ile and Nonsense, Tyr681 to stop codon Deletion of 3,957 bp Deletion of 1,398 bp Deletion of 9-bp

lzmr2 lzL lz34 lz37 lzK lz1 Summary of the physical location of 21 lozenge mutations with respect to GenBank entry AF217651. For transposable element insertions, the location within AF217651 corresponds to the first base of the proposed target site duplication. The mutation lzL contains a partial, 5- to 7-kb fragment of the roo element. The mutations lz50e and lzmr1 (also known as lz77a7) are the same deletion of 1,398 bp (Flores et al. 1998). Information on specific mutations and their discoverers can be found at Flybase (http://www.flybase.bio. indiana.edu/.bin/fbidq.html? FBgn0002576&content=alleletable). Five prime RACE experiments indicate that Exon 1 in AF217651 is larger than is suggested by the published lzc3.5 cDNA (Daga et al. 1996, GenBank accession number U47849). Also, there is a polymorphism of five asparagine residues (Asn248–252) at position 9,409–9,423 of AF217651, compared to eight in the published lzc3.5 cDNA

lzsprite lzts1 lzts114 lzs lz50e and lzmr1 lz38.71

Location within AF217651

Single base substitution

lzr1 lzr7 lzr8 lzr9 lzr11 lz3

lzY4 lzg

Deletion of 22,716 bp Deletion of 13,781 bp Deletion of 11,033 bp Deletion of 6,088 bp Insertion of 11 bp TTGCCTTGCAA Deletion of 4,639 bp Deletion of 358 bp causing frame shift Insertion of 19 bp TATAATATAATAATTTACT Deletion of one base causing frame shift Substitution of His771 to Leu, and single base deletion causing frame shift

nucleotides, the expected size of exon V. We sequenced both products and found that exon V was precisely removed in the alternative isoform, with a one amino acid change from S to T at the splice interface. The full-length lozenge transcript is 3,471 nucleotides, and is referred to as lz-3.5 (Daga et al. 1996). We investigated the length of the alternative transcript using RT-PCR. With primers that spanned the 3′ end of exon II to the 5′ end of exon VI, we again found both the full-length and spliced variants. In order to determine whether exon II or exon VI themselves might be internally spliced, we analyzed those sequences with MacTargSearch modified with a search matrix for fly splice sites to look for potential splice donors and acceptors (Goodrich et al. 1990; Mount et al. 1992). No candidate sequences had a greater than 65% identity to consensus splice sequences. We have inferred from this that

7,235 7,298 9,794 9,798–26,295 11,739 11,746 13,594 14,042 28,736 11,268 (A→T base substitution) 11,268 (A→T base substitution) and 25,180 (T→A base substitution) 4,042–7,998 9,586–10,982 10,357 (deletion of single T base) 10,588 (deletion of single A base) 10,898–10,904 (deletion of TGCATCC) 10,561 (C→T base substitution) 8,291–31,006 15,354–29,134 19,540–30,571 24,850–30,937 25,169–29,807 25,487–25,844 25,487 25,391 (deletion of single A base) 25,449 (A→T base substitution) and 25,451 (single C base deletion)

the entire exons II and VI are included in the alternative transcript. Since both these exons include noncoding regions, we have delimited the protein sequence of the alternative transcript (depicted in Fig. 1d). We refer to the alternative isoform as LzΔ5. Exon V encodes a conserved Ets interaction domain Sequence homology between Lozenge and other RUNX proteins is strong in the Runt domain resident in exons II, III, and IV, but other exons show a weak homology overall. Nonetheless, ClustalW alignment revealed a high degree of identity between the amino acids 430–443 in Lozenge exon V and amino acids 195–208 in RUNX1/AML1/PEBP2αB exon VI (Fig. 1e). In the mammalian sequence, amino acids spanning this region were shown to be involved in cooperative interactions between RUNX1 and Ets-1 by EMSA

429

protein/DNA interactions (Gu et al. 2000). Kim et al. (1999) also used EMSA to identify Ets-1 interaction domains in this region (Fig. 1e). The sequences from L433–A443 in Lozenge (Fig. 1e) are also highly conserved in the frog and zebrafish homologs (Tracey et al. 1998; Kalev-Zylinska et al. 2002). Between mammals and flies, there is an absolute identity of the Lozenge amino acids L433, E435, L436, E437, L439, R440, R441, A443, and a conserved substitution of S442T. Alternative splice isoforms that remove this region have been reported in mouse and humans (Bae et al. 1994; Miyoshi et al. 1995); as yet, none have been reported in frogs or fish. Lozenge interacts with the Ets protein Pointed Pointed is the Drosophila homolog of Ets-1, bearing 95% identity to the Ets DNA binding domain (Klambt 1993) and it exhibits functional conservation as well (Albagli et al. 1996). In vertebrates, the ability of Ets-1 to bind to DNA is autoinhibited by regions flanking the ETS DNA binding domain, specifically helices HI-1, HI-2, and H4, which interact with helix H1 in the ETS DNA binding domain to maintain the protein in a folded (inhibited) state (Goetz et al. 2000; Wang et al. 2002). Autoinhibition is relieved by concurrent binding of CBF to a nearby site (Goetz et al. 2000). We examined homologous regions in the PntP2 protein and found 91% identity between Ets-1 and PntP2 in helix H1, as well as a striking degree of identity C-terminal to the ETS DNA binding domain, including, but not limited to, helix H4 (not shown). Pointed, like Lozenge, is expressed in all undifferentiated cells of the eye behind the morphogenetic furrow, but expression ceases about 6 h later (Brunner et al. 1994). We used a yeast two-hybrid assay to demonstrate that fulllength Lozenge and Pointed (PntP2) interact (Supplemental Data). We also found that peptide exon V (E5) alone was sufficient to interact with PntP2. We used site-directed mutagenesis to alter two of the conserved sequences in exon V, R440E, and R441E, thus reversing the charge of the amino acids but maintaining the alpha-helical secondary structure. Full-length mutant Lozenge (LZ SDM) continued to interact with PntP2, but the mutated exon V peptide (E5 Table 3 Yeast two-hybrid assays

The percentage of colonies that showed reporter gene activity after co-transformation is presented. Results shown for co-transformation experiments only. All experiments done using sequential transformation gave no reporter gene activity. Positive and negative controls in the sequential transformation gave same results as shown here for co-transformation a Plates where 1 cm2 area was counted

SDM) did not interact with PntP2 (Supplemental Data; Table 3). Western blot analysis of the yeast two-hybrid assay cells shows that, in all cases, the expected Lozenge and PntP2 proteins and peptides were expressed (Supplemental Data b-e). Lozenge alters the Yan/Pointed dynamic in Prospero regulation We used Prospero expression as an assay to determine if Lozenge and Pointed behave cooperatively in Drosophila. The prospero enhancer contains multiple binding sites for Lozenge and Ets factors (Xu et al. 2000). The Lz1 DNA sequence and the Ets-A DNA sequence are 7 bp apart, representing a potential CBF–Ets composite motif. Both Pointed and its negative competitor Yan (Lai and Rubin 1992) are able to bind to the Ets-A consensus sequence (Xu et al. 2000). Prospero is expressed in the R7 and cone cell precursors. Eleven rows behind the morphogenetic furrow, its expression is upregulated in the R7 cell but not in the cone cells (Kauffmann et al. 1996). We challenged Pointed by expressing one copy of the hyperstable competitor YanACT via the sevenless enhancer. In the sev-YanACT background, YanACT is targeted directly to a subset of cells, including the R7 and cone cells (Rebay and Rubin 1995). In these flies, we found that Prospero expression was aberrant in the R7 photoreceptor cells: the expression level decreased or disappeared as cells matured (Fig. 2b). Lozenge expression is also decreased by YanACT expression (Behan et al. 2002). Significantly, Prospero expression was restored in this YanACT background by ectopically expressing full-length Lozenge under the control of the GMR promoter (Fig. 2c). This data is consistent with the expectation that Lozenge and Pointed act cooperatively to compete with Yan for binding sites on the prospero enhancer (see Discussion). Molecular analysis of 21 mutants showed that none of the mutants have specific defects in exon V (Fig. 1b, Table 2). However, lzr9 exhibits a large deletion that eliminates much of exon VI including the highly conserved C-terminal VWRPY, while leaving exons I through V intact (Fig. 3a). As a reporter system, this allele has the advantage of being under native regulatory control, and subject to normal de-

Yeast plasmids

Whole plates >200 colonies

pGADT7 activation domain

pGBKT7 DNA binding domain

1

2a

3a

PntP2

Lz Lz SDM Exon V Exon V SDM PntP2

42% (88/210) 54% (122/225) 53% (111/208) 0% (0/209) 45% (98/223) 63% (151/241) 65% (149/232) 0% (0/214) 100% 0% 100%

56% (6/11) 35% (3/8) 72% (9/13) 0% (0/13) 50% (5/10) 61% (8/13) 63% (7/11) 0% (0/12) 100% 0% 100%

49% (5/12) 41% (4/9) 68% (10/15) 0% (0/12) 67% (6/9) 50% (6/12) 76% (6/8) 0% (0/14) 100% 0% 100%

Lz Lz SDM Exon V Exon V SDM Positive control pGADT7-T+pGBKT7-53 Negative control pGADT7-T+pGBKT7-Lam β-Galactosidase control pCL1

430

Fig. 2 Lozenge rescues Prospero expression in the presence of YanACT. a Anti-Prospero (green) is detected in R7 and cone cells in the wild type. b–c Anti-Runt (red) stains the R8 neuron in each cluster. Anti-Prospero (green) stains the cone cells and R7 cells. Posterior is to the right. Morphogenetic furrow is indicated with an

arrow. 7 R7 photoreceptor, C cone cell, blue indicates unstained cells. b sev-YanACT/+. Cone cells show Prospero expression, but R7 cell expression is decreased or absent. csev-YanACT/GMR-lz. Up-regulated Prospero expression is seen in R7 cells beginning behind the furrow and retained to the edge of the disk

velopmental cues. The adult eye of this mutant is severely perturbed, resembling a lozenge null (Fig. 3c). Surprisingly, the developmental cellular expression of Prospero in lzr9 is normal in the developing R7 cell (Fig. 3d). Furthermore, R7 cells in lzr9 flies also express the R7 cell marker Runt (not shown). For lzr9, RT-PCR verified that the truncated lozenge transcript was expressed in this tissue, and that the entire exon V was included in the transcript (Fig. 3e). It is compelling that a mutant as severe as lzr9 is able to sustain positive regulation of a downstream target, and suggests that a key functional domain is retained in the mutant. Our interpretation is that this key domain is the Ets interaction region located in exon V.

Lozenge isoforms are expressed differentially We used quantitative RT-PCR to examine alternative splicing of lozenge. Lozenge is normally expressed in undifferentiated cells and R1, R6, R7, and cone cells in a normal prepupal ommatidium (Fig. 4a). Quantitative RT-PCR shows that the full-length transcript is the predominant form at this stage. We asked if alterations in Ras activity would affect lozenge expression by ectopically expressing the dominant negative Ras1N17. This mutant Ras has an altered affinity for GDP and competes with the native Ras (Feig and Cooper 1988), resulting in cell fate alterations including the loss of 25% of the R7 cells (Karim et al. 1996) and the loss of 25–75% of the cone cells (Matsuo et al. 1997). Ras1N17

Fig. 3 lzr9 retains the Ets interaction domain. a Schematic compares the full-length lozenge cDNA to lzr9. Primers used for RT-PCR are indicated by arrows. b–c Scanning electron micrographs of adult eyes. Posterior is to the right in all pictures; SEM of the same magnification. b Wild type. clzr9. The eye is smaller, and ommatidial structure is abolished. d lzr9. Prospero expression is normal in

developing R7 cells of this late third instar eye disk. Posterior is to the right. Morphogenetic furrow is indicated with an arrow. e RT-PCR of lzr9 eye tissue. Lane 1: product of Saba2 and R6 shows the presence of exon V in the transcript. Lane 2: product of Saba2 and R7 shows that the transcript extends past the exon boundary into exon VI. MW Molecular weight marker HindIII Lambda (Boehringer Mannheim)

431

Fig. 4 The ratio of lozenge isoforms is altered in a mutant Ras background. a–b One ommatidium is depicted to show the cell specific patterns of expression; these are shaded. U Undifferentiated, C cone cell, numbers indicate photoreceptors. a Lozenge is expressed in undifferentiated cells, R1, R6, R7, and the cone cells in white prepupal eye disks. Both isoforms are expressed in this tissue, and the predominant form is the full-length 3.5-kb transcript. b Expression of Ras1N17 is restricted to the R3, R4, R7, and cone cells by the sevenless promoter. In this background, the relative expression of lzΔ5 is increased more than threefold as assayed by Kodak 1D software. When RNA from equal numbers of dissections are reversetranscribed, both lz transcripts are decreased in sev-Ras1N17 relative to wild type. More PCR product was loaded in this lane to allow ratio calculations

was targeted to a R1, R6, R7, and cone cells. The pattern of expression is depicted in Fig. 4b; Ras1N17 and Lozenge expression overlap in the R7 and cone cells. Quantitative RT-PCR revealed that the relative ratio of lozenge isoforms was altered (Fig. 4b), suggesting that the isoform ratio is cell-specific.

Discussion In Drosophila, the expression of both Lozenge and Pointed is required for the specification of R7 and cone cells (Xu et al. 2000; Flores et al. 2000). We have shown here that Lozenge and Pointed interact at the protein level, and that their DNA binding properties do not mediate this interaction. Additionally, our experiments indicate that the alternative splicing of Lozenge exon V either includes or excludes an Ets interaction domain. The Lozenge locus The lozenge locus has long been studied for its relative large size, varied mutant phenotypes, and complex complementation (Green and Green 1949; Green 1961; Batterham et al. 1996). We now understand molecularly that an eye-specific enhancer accounts for much of the two-cistron phenomena (Batterham et al. 1996; Nichols 1997; Flores et al. 1998; Behan et al. 2002). The overall extent of the locus at 45,142 bp is close to the expected size, based on the interallelic recombination distance of 0.14 cM. In a neighboring region

of the X chromosome (300 kb of DNA from 9F12–10A7), Kozlova et al. (1994) found a local standard of 0.01 cM corresponding to 3.3 kb of DNA. Therefore, the 0.14 cM of lozenge should equal 46.2 kb of DNA, a remarkably close fit. The variation of interallelic recombination rates is likely due to the molecular nature of the mutations tested. In many cases, the historic mutants used were the result of transposable element insertion (Table 2). For example, lz1 (gypsy insertion) found in the lozenge sublocus is approximately 11,000 bp from the glossy sublocus (alleles lz3, lzy4, and lzg). Considering Kozlova’s standard of 3.3 kb per 0.01 cM, the lz1 to lzg separation should be 0.034 cM; a 0.057-cM recombination frequency is observed. It is possible that the additional separation is due to the gypsy insertion that is resident in the lz1 allele. Alternatively, the repetitive structure of the genomic sequence may have biased the local recombination frequencies. Phenotypes of these mutants have been described at the adult level and third larval level (Batterham et al. 1996; Crew et al. 1997; Behan et al. 2002; Siddall et al. 2003). This new molecular map will allow researchers to better select mutations for further study. Lozenge transcripts are alternatively spliced to remove an Ets interaction domain The lozenge transcript is alternatively spliced to include or remove the fifth exon. Comparison of the Lozenge Exon V amino acid sequence to the RUNX1 vertebrate homolog indicates that a comparable region of the vertebrate gene is similarly spliced. In fact, the 5′-splice junction is at the same amino acid (Fig. 1). This implies an evolutionary pressure for the alternate use of the amino acid sequences found in the region. Computational analysis of the secondary structure of exon V reveals a conserved alpha-helix with a high degree of sequence conservation. In vertebrates, this amino acid sequence has been implicated as an Ets interaction domain (Gu et al. 2000; Goetz et al. 2000). We have shown here that in the fly, this sequence is directly involved in protein–protein interaction with PntP2. Kim and coworkers have used electrophoretic mobility shift assay combined with the analysis of a deletion series of RUNX1 protein to implicate two domains designated as Ets binding site EI and EII (noted in Fig. 1d). The EI site of PEBPα2 spans the exon IV–exon V junction and is conserved between Lozenge and PEBPα2. The EI site is represented by highly conserved amino acids overlapping the runt-homology domain. The EII domain of PEBPα2 is only weakly conserved in Lozenge (Fig. 1). To assess the potential involvement of Exon V with Ets interaction, we focused our attention on the central element, the structurally conserved alpha-helix with a highly conserved island of ten amino acids. Within that domain, we selected two conserved arginines to mutate, R440E and R441E. This substitution reverses the charge, but retains the alpha-helix structure. Using the yeast two-hybrid system first described by Fields and Song (1989), we assessed protein–protein interactions between Lozenge and PntP2.

432

We have shown that full-length Lz and PntP2 interact physically and that Lz exon V alone is sufficient for that interaction. Mutated exon V was incapable of interacting with PntP2; however, the full-length Lz protein carrying the same mutation could interact. Our interpretation is that other domains of the full-length Lozenge protein are able to stabilize the protein–protein interaction even with the mutations in the Exon V alpha-helix. For example, the EI (Ets interaction) domain described by Kim et al. (1999) remains intact in the full-length protein, but is disrupted in the exon V peptide as it spans the 5′ exon IV/exon V boundary (Fig. 1). Lozenge–PntP2 interactions recapitulate vertebrate Ets interactions The Lozenge–Pointed interaction is reminiscent of RUNX1 interaction with Ets-1. For vertebrate RUNX1 (AML1/ PEBP2αB), exon VI is homologous to Lozenge Exon V by virtue of its sequence (Fig. 1), its relative position in the gene, and the presence of an Ets interaction domain; it is also removed by alternative splicing (Bae et al. 1994). Composite DNA sequence motifs for both RUNX1 and Ets-1 have been described in a number of mammalian enhancers: the two proteins interact and stabilize each other by forming a ternary complex resulting in increased DNA binding for both (Wotton et al. 1994; Kim et al. 1999; Goetz et al. 2000; Gu et al. 2000). We have investigated the analogous Lozenge–Pointed function by exploring their regulation of a downstream gene, prospero. The EtsA and Lz1 binding sites in the prospero enhancer are close enough to constitute a Pointed–Lozenge composite DNA motif, depicted in Fig. 5. Previous in vitro studies showed that in Drosophila, Yan outcompetes Pointed for binding sites on the prospero enhancer by 100-fold (Xu et al. 2000). Upon

Fig. 5 A model: lozenge alters the Yan/Pointed dynamic during Prospero expression in the R7 cell. Multiple binding sites for Ets factors and Lozenge are present in the prospero enhancer; for simplicity sake, only the EtsA:Lz1 DNA sequence is represented. Input from other regulatory factors has been omitted. The model is based in part on observations previously reported (Kim et al. 1999; Dittmer 2003). a After Ras/MAP Kinase phosphorylation has been

MAP kinase phosphorylation, phosphorylated Yan is replaced by phosphorylated Pointed. Together, Lozenge and Pointed activate prospero expression. However, if hyperstable YanAct is used, phosphorylated Pointed fails to activate prospero. In the YanAct genetic background, we have shown that ectopic expression of full-length Lozenge was sufficient to tip the competition in favor of phosphorylated Pointed, leading to the Lozenge–Pointed activation of prospero (Fig. 5). This shift in the Yan/Pointed dynamic is strikingly similar to the change in affinity that Ets-1 has for the Mo-MLV enhancer in the presence of RUNX1 (AML1/PEBP2αB) (Goetz et al. 2000), and is consistent with the model of Lozenge–Pointed cooperativity. We believe that Lozenge is involved in the Yan/Pointed competition in normal development by this very mechanism. Lozenge–Pointed cooperativity may be involved in the regulation of shaven (D-Pax 2). D-Pax2 is regulated by Lozenge, Yan, and Pointed in the developing cone cells of the eye; multiple binding sites exist for all three factors in its eye-specific enhancer (Flores et al. 2000). We have examined these binding sites and find that the first and last Lozenge binding sites are within close proximity of Yan/ Pointed binding sites. Interestingly, we find that the intervening sequence of base pairs that connects the EtsA and Lz1 binding sites in the prospero enhancer is the complement of the intervening sequence that connects the Lozenge and Ets binding sites at the RD-1 site in the D-Pax2 enhancer. The sequences of the prospero and D-Pax2 enhancers predict a second type of regulation by Lozenge. Neither the Lz-2 binding site in prospero nor the RD-2 binding site in D-Pax2 is in close proximity to a Pointed binding site. Furthermore, Flores et al. (2000) reported that while Lozenge is required for D-Pax2 expression in pigment cells, Pointed is not. Whether Lozenge acts alone at these sites or in combination with other factors remains to be seen.

activated, the Yan repressor is relieved and the phosphorylated PntP2 is able to interact with Lozenge to form a stable complex. b The PntP2–Lozenge complex is able to bind to the EtsA–Lz1 composite DNA binding site and contribute to the activation of Prospero expression. The integrity of the PntP2–Lozenge complex is sufficient to even displace YanAct from the EtsA site

433

Two Lozenge isoforms regulate eye development The full-length lz isofom is the predominant isofom in quantity and is able to significantly rescue a lz null (Flores et al. 1998). It is intriguing that alterations in Ras activity cause a shift in the relative ratio of the lz isoforms, and suggests that the two forms are not redundant. This shift can be interpreted two ways. One explanation is that the lz isoform ratio is cell type-specific, and the proportion of those cells has changed. The cells that overlap Lz and Ras1N17 expression are the R7 and cone cells. This model is also consistent with findings that the ratios of RUNX/AML isoforms are tissue/cell line-specific (Miyoshi et al. 1995). An alternate explanation is that in a given set of cells, a change in the regulation of splicing has occurred that subsequently led to a change in cell fate. Our results cannot distinguish between these two mechanisms. However, these data are consistent with each isoform having a distinct biological function in the developing eye. It is important to note that in vertebrates, the homologous isoforms PEBP2αB1 and αB2 behave differently biochemically. The shorter form binds DNA with a higher affinity than does αB1 (Bae et al. 1994) even in the presence of Ets-1 (Kim et al. 1999). The two isoforms have different levels of transcriptional activity as well, depending on the reporter system used (Bae et al. 1994; Kanno et al. 1998; Kim et al. 1999). Although both forms bind DNA cooperatively with Ets-1, only the full-length αB1 exhibits cooperative transactivation with Ets-1 (Kim et al. 1999). In summary, expression of Lozenge in the R7 equivalence group falls under the receptor tyrosine kinase (EGFReceptor and Sevenless) regulation of the Ras signaling pathway and the MAP Kinase control of the Ets factor Yan (Behan et al. 2002). Once Lozenge is activated, it in turn effects the expression of genes essential for correct differentiation of cells in R7 equivalence group such as Bar, svp, prospero, D-Pax-2, Runt, and others (Daga et al. 1996; Crew et al. 1997; Flores et al. 2000; Xu et al. 2000; Behan et al. 2002). Lozenge is also expressed earlier in eye development beginning at the morphogenetic furrow in undifferentiated precursor cells where it contributes to the specific survival of the these cells (Siddall et al. 2003). Our interpretation is that full-length Lozenge protein is functioning in concert with the RTK/Ras/MAP Kinase signaling pathway and physically interacts with Pointed to control fate and differentiation. The Lozenge LzΔ5 isoform lacks the exon 5 Ets interaction domains and may have other transcriptional functions. lozenge genomic sequence has been deposited in Genbank accession number AF217651. Supplemental data Yeast two-hybrid system shows physical interaction between Lozenge and PntP2. Lz=Full length Lozenge, LzSDM=Full length Lozenge with site directed mutagenesis, Lz E5=exon V peptide only, Lz E5 SDM=exon V peptide with site directed mutagenesis. a. Wild type and mutagenized full length Lozenge interact with PntP2 to

reconstitute β-galactosidase activity. Exon V is sufficient to interact with PntP2, but mutagenized exon V does not interact. b-e. Western Blot analysis from each of the cotransformed yeast strains shows that both Lozenge and PntP2 were expressed in each case. Gels were run in duplicate and probed with different antibodies. Panel b and d: Samples probed with anti-HA and anti-c-Myc antibody respectively. Lane 1: AH019 (pGBKT7-PntP2 and pGADT7Lz), Lane 2: AH109 (pGBKT7-PntP2 and pGADT7-Lz SDM), Lane 3: Y187 (pGBKT7-PntP2 and pGADT7-Lz), Lane 4: Y187 (pGBKT7-PntP2 and pGADT7-Lz SDM). Panel c and e: Samples probed with anti-HA and anti-c-Myc antibody respectively. Lane 1: AH019 (pGBKT7-PntP2 and pGADT7-Lz E5), Lane 2: AH109 (pGBKT7-PntP2 and pGADT7-Lz E5 SDM). Acknowledgements We thank Jana Van Patton and Claudia Almaguer for help with the Yeast Two-Hybrid system. We thank Ranga Rao and Joe Lepo for the use of their lab at UWF. We thank A. Javier Lopez, Richard Carthew and Andreas Nocker for discussion and advice. We thank Raghuram Selvaraju for critical review of the manuscript. We thank Sam Saba and Paul Keller for their help in optimizing PCR conditions, and James M. Burnette for assisting with MacTargSearch analysis. We thank Utpal Banerjee for flies and for the lozenge 3.5 clone, Gerald Rubin for the gift of flies, Richard Carthew for the PntP2 clone, and Chris Doe for the gift of Prospero antibody. Parts of this work were performed at Carnegie Mellon University and the University of West Florida. This work was supported in part by Duquesne University of the Holy Ghost and the following grants to J.A.P.: SURG/HHMI Awards to undergraduate researchers at Carnegie Mellon University; NIH grant EY09093; NSF/STC grant BIR-8920118; March of Dimes Birth Defects Foundation FY93-1010; Duquesne University Faculty Development Awards; Samuel and Emma Winters Foundation; and international collaborative support from the NSF INT-9605205 and the University of Melbourne.

References Albagli O, Klaes A, Ferreira E, Leprince D, Klambt C (1996) Function of ets genes is conserved between vertebrates and Drosophila. Mech Dev 59:29–40 Bae SC, Yamaguchiiwai Y, Ogawa E, Maruyama M, Inuzuka M, Kagoshima H, Shigesada K, Satake M, Ito Y (1993) Isolation of Pebp2-alpha-B cDNA representing the mouse homolog of human acute myeloid-leukemia gene, Aml1. Oncogene 8:809– 814 Bae SC, Ogawa E, Maruyama M, Oka H, Satake M, Shigesada K, Jenkins NA, Gilbert DJ, Copeland NG, Ito Y (1994) Pebp2alpha-B/mouse Aml1 consists of multiple isoforms that possess differential transactivation potentials. Mol Cell Biol 14:3242– 3252 Batterham P, Crew JR, Sokac AM, Andrews JR, Pasquini GMF, Davies AG, Stocker R, Pollock JA (1996) Genetic analysis of the lozenge gene complex of Drosophila melanogaster: adult visual system phenotypes. J Neurogenet 10:193–220 Behan KJ, Nichols CD, Cheung TL, Farlow A, Hogan BM, Batterham P, Pollock JA (2002) Yan regulates Lozenge during Drosophila eye development. Dev Genes Evol 212:267–276 Berardi MJ, Sun CH, Zehr M, Abildgaard F, Peng J, Speck JN, Bushweller JH (1999) The Ig fold of the core binding factor alpha Runt domain is a member of a family of structurally and functionally related Ig-fold DNA-binding domains. Struct Fold Des 7:1247–1256 Bridges CB, Brehme KC (1944) The mutants of Drosophila melanogaster. Carnegie Inst Wash Publ 552:257

434 Brunner D, Ducker K, Oellers K, Hafen E, Scholz H, Klambt C (1994) The Ets domain protein pointed-P2 is a target of map kinase in the sevenless signal-transduction pathway. Nature 370:386–389 Canon J, Banerjee U (2000) Runt and Lozenge function in Drosophila development. Semin Cell Dev Biol 11:327–336 Crew JR, Batterham P, Pollock JA (1997) Developing compound eye in lozenge mutants of Drosophila: lozenge expression in the R7 equivalence group. Dev Genes Evol 206:481–493 Daga A, Karlovich CA, Dumstrei K, Banerjee U (1996) Patterning of cells in the Drosophila eye by lozenge, which shares homologous domains with AML1. Genes Dev 10:1194–1205 Dittmer J (2003) The biology of the Ets1 proto-oncogene. Mol Cancer 2(1):29 Erman B, Cortes M, Nikolajczyk BS, Speck NA, Sen R (1998) Ets-core binding factor: a common composite motif in antigen receptor gene enhancers. Mol Cell Biol 18:1322–1330 Feig LA, Cooper GM (1988) Inhibition of NIH-3T3 cell proliferation by a mutant Ras protein with preferential affinity for GDP. Mol Cell Biol 8:3235–3243 Fields S, Song O (1989) A novel genetic system to detect protein– protein interactions. Nature 340(6230):245–246 Flores GV, Daga A, Kalhor HR, Banerjee U (1998) Lozenge is expressed in pluripotent precursor cells and patterns multiple cell types in the Drosophila eye through the control of cell-specific transcription factors. Development 125:3681–3687 Flores GV, Duan H, Yan HJ, Nagaraj R, Fu WM, Zou Y, Noll M, Banerjee U (2000) Combinatorial signaling in the specification of unique cell fates. Cell 103:75–85 Ghozi MC, BernsteinY, Negreanu V, Levanon D, Groner Y (1996) Expression of the human acute myeloid leukemia gene AML1 is regulated by two promoter regions. Proc Natl Acad Sci U S A 93 (5):1935–1940 Goetz TL, Gu TL, Speck NA, Graves BJ (2000) Auto-inhibition of Ets-1 is counteracted by DNA binding cooperativity with corebinding factor alpha2. Mol Cell Biol 20:81–90 Golling G, Li LH, Pepling M, Stebbins M, Gergen JP (1996) Drosophila homologs of the proto-oncogene product PEBP2/ CBF beta regulate the DNA-binding properties of Runt. Mol Cell Biol 16:932–942 Goodrich JA, Schwartz ML, McClure WR (1990) Searching for and predicting the activity of sites for DNA-binding proteins— compilation and analysis of the binding-sites for Escherichia coli integration host factor (Ihf). Nucleic Acids Res 18:4993– 5000 Green MM (1961) Phenogenetics of the lozenge loci in Drosophila melanogaster. II. Genetics of lozenge-krivshenko (lozengek). Genetics 46:1169–1176 Green MM (1990) The foundations of genetic fine structure: a retrospective from memory. Genetics 124:793–796 Green MM, Green KC (1949) Crossing over between alleles at the lozenge locus in Drosophila melanogaster. Proc Natl Acad Sci U S A 35:586–591 Green MM, Green KC (1956) A cytogenetic analysis of the lozenge psuedoalleles in Drosophila. Zeit Abs Verer 87:708–724 Gu TL, Goetz TL, Graves BJ, Speck NA (2000) Auto-inhibition and partner proteins, core-binding factor beta (CBFbeta) and Ets-1, modulate DNA binding by CBFalpha2 (AML1). Mol Cell Biol 20:91–103 Kalev-Zylinska ML, Horsfield JA, Flores MV, Postlethwait JH, Vitas MR, Baas AM, Crosier PS, Crosier KE (2002) RUNX1 is required for zebrafish blood and vessel development and expression of a human RUNX1-CBF2T1 transgene advances a model for studies of leukemogenesis. Development 129:2015–2030 Kaminker JS, Singh R, Lebestky T, Yan HJ, Banerjee U (2001) Redundant function of Runt domain binding partners, big brother and brother, during Drosophila development. Development 128:2639–2648

Kanno T, Kanno Y, Chen F, Ogawa E, Kim WY, Ito Y (1998) Intrinsic transcriptional activation-inhibition domains of the polyomavirus enhancer binding protein 2 core binding factor alpha subunit revealed in the presence of the beta subunit. Mol Cell Biol 18:2444–2454 Karim FD, Chang HC, Therrien M, Wassarman DA, Laverty T, Rubin GM (1996) A screen for genes that function downstream of Ras1 during Drosophila eye development. Genetics 143:315–329 Kauffmann RC, Li SH, Gallagher PA, Zhang JJ, Carthew RW (1996) Ras1 signaling and transcriptional competence in the R7 cell of Drosophila. Genes Dev 10:2167–2178 Kim WY, Sieweke M, Ogawa E, Wee HJ, Englmeier U, Graf T, Ito Y (1999) Mutual activation of Ets-1 and AML1 DNA binding by direct interaction of their autoinhibitory domains. EMBO J 18:1609–1620 Klambt C (1993) The Drosophila gene pointed encodes 2 Ets-like proteins which are involved in the development of the midline glial-cells. Development 117:163–176 Klein SL, Strausberg RL, Wagner L, Pontius J, Clifton SW, Richardson P (2002) Genetic and genomic tools for Xenopus research: the NIH Xenopus initiative. Dev Dyn 225(4):384–391 Kosman D, Small S, Reinitz J (1998) Rapid preparation of a panel of polyclonal antibodies to Drosophila segmentation proteins. Dev Genes Evol 208(5):290–294 Kozlova TY, Semeshin VF, Tretyakova IV, Kokoza EB, Pirrotta V, Grafodatskaya VE, Belyaeva ES, Zhimulev IF (1994) Molecular and cytogenetical characterization of the 10A1-2 band and adjoining region in the Drosophila melanogaster polytene X chromosome. Genetics 136:1063–1073 Lai ZC, Rubin GM (1992) Negative control of photoreceptor development in Drosophila by the product of the yan gene, an Ets domain protein. Cell 70:609–620 Lebestky T, Chang T, Hartenstein V, Banerjee U (2000) Specification of Drosophila hematopoietic lineage by conserved transcription factors. Science 288:146–149 Lee J, Ahnn J, Bae SC (2004) Homologs of RUNX and CBF beta/ PEBP2 beta in C. elegans. Oncogene 23(24):4346–4352 Lefevre G (1976) A photographic representation and interpretation of the polytene chromosomes of Drosophila melanogaster salivary glands. In: Ashburner M, Novitsky E (eds) The genetics and biology of Drosophila, vol Ia. Academic, New York, pp 31–66 Li LH, Gergen JP (1999) Differential interactions between Brother proteins and Runt domain proteins in the Drosophila embryo and eye. Development 126:3313–3322 Matsuo T, Takahashi K, Kondo S, Kaibuchi K, Yamamoto D (1997) Regulation of cone cell formation by Canoe and Ras in the developing Drosophila eye. Development 124:2671–2680 Miyoshi H, Ohira M, Shimizu K, Mitani K, Hirai H, Imai T, Yokoyama K, Soeda E, Ohki M (1995) Alternative splicing and genomic structure of the Aml1 gene involved in acute myeloidleukemia. Nucleic Acids Res 23:2762–2769 Morgan TH, Bridges CB, Sturtevant AH (1925) The genetics of Drosophila melanogaster. Biblphia Genet 2:1–262 Mount SM, Burks C, Hertz G, Stormo GD, White O, Fields C (1992) Splicing signals in Drosophila—intron size, information-content, and consensus sequences. Nucleic Acids Res 20:4255– 4262 Nichols CD (1997) Molecular characterization of the lozenge locus of Drosophila melanogaster 1997. Department of Biological Sciences, Carnegie Mellon University, Pittsburgh PA Oliver CP (1940) A reversion to wild type associated with crossing over in Drosophila melanogaster. Proc Natl Acad Sci U S A, 26:452–454 Pires-daSilva A, Sommer RJ (2003) The evolution of signalling pathways in animal development. Nat Rev Genet 4(1):39–49 Rebay I, Rubin GM (1995) Yan functions as a general inhibitor of differentiation and is negatively regulated by activation of the Ras1/MAPK pathway. Cell 81:857–866

435 Rizki TM, Rizki RM (1981) Alleles of lozenge as suppressors of the Bc-phene in Drosophila melanogaster. Genetics (Suppl.) 97:s90 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York Siddall N, Behan KJ, Crew JR, Cheung TL, Fair JA, Batterham P, Pollock JA (2003) Mutations in lozenge and D-Pax2 invoke ectopic patterned cell death in the developing Drosophila eye using distinct mechanisms. Dev Genes Evol 213:107–119 Spana EP, Doe CQ (1995) The Prospero transcription factor is asymmetrically localized to the cell cortex during neuroblast mitosis in Drosophila. Development 121:3187–3195 Tenen DG (2003) Disruption of differentiation in human cancer: AML shows the way. Nature Rev 3:89–101 Tracey WD, Pepling ME, Horb ME, Thomsen GH, Gergen JP (1998) A Xenopus homologue of aml-1 reveals unexpected patterning mechanisms leading to the formation of embryonic blood. Development 125:1371–1380

Wang H, McIntosh LP, Graves BJ (2002) Inhibitory module of Ets-1 allosterically regulates DNA binding through a dipole-facilitated phosphate contact. J Biol Chem 277:2225–2233 Wotton D, Ghysdael J, Wang SW, Speck NA, Owen MJ (1994) Cooperative binding of Ets-1 and Core Binding Factor to DNA. Mol Cell Biol 14:840–850 Xu CY, Kauffmann RC, Zhang JJ, Kladny S, Carthew RW (2000) Overlapping activators and repressors delimit transcriptional response to receptor tyrosine kinase signals in the Drosophila eye. Cell 103:87–97 Zhu X, Yeadon JE, Burden SJ (1994) AML1 is expressed in skeletal muscle and is regulated by innervation. Mol Cell Biol 14 (12):8051–8057