alters growth factor responsiveness in stably transfected PC12 ... - NCBI

Proc. Natl. Acad. Sci. USA Vol. 93, pp. 2180-2185, March 1996 Medical Sciences

Expression of the C terminus of the amyloid precursor protein alters growth factor responsiveness in stably transfected PC12 cells FAHEEM A. SANDHU*, YONG KIM*, KIRSTY A. LAPAN*, MOHAMMED SALIMt, VIQAR ALIUDDINt, AND SAYEEDA B. ZAIN*t *Department of Biochemistry and

tCancer Center, University of Rochester School of Medicine, 601 Elmwood Avenue, Rochester, NY

14642

Communicated by Fred Sherman, University of Rochester Medical Center, Rochester, NY, October 18, 1995

of 13-amyloid or native 13-amyloid peptide from AD plaques can be neurotoxic to neurons in culture and in vivo (for summary, see ref. 17). The C-terminal 100 amino acids of APP (APPctoo), which contains the entire 13-amyloid, transmembrane, and intracellular domains of APP, is a potentially amyloidogenic protein fragment; it too may be involved in aspects of AD pathology. Expression of APPcloo in cultured cells may be neurotoxic (18, 19) and can cause fibril formation (20). In vitro translation of APPcloo indicates that this molecule has a propensity to form insoluble stable aggregates by metalcatalyzed oxidation (21). However, if APPcloo is properly inserted into a membrane by the addition of a signal sequence, aggregation is prevented (22). Aggregation of amyloidogenic APP fragments may be a critical step in the formation of protease-resistant ,B-amyloid deposits. Also, the recent demonstration that the C terminus of APP binds Go, a major GTP binding protein in the brain, has raised additional possibilities for APP function and dysfunction (23). PC12 cells, derived from a rat pheochromocytoma (24), are commonly used in the study of gene expression in a neuronal background. PC12 cells differentiate into neurons after treatment with nerve growth factor (NGF) or basic fibroblast growth factor (bFGF); differentiation is accompanied by changes in cell morphology (neurite outgrowth), neurotransmitter synthesis, and ion permeability (25). Herein we report that stable transfection of PC12 cells with a APPcloo gene construct results in diminished responsiveness to NGF stimulation and an increased responsiveness to bFGF stimulation. Treatment with either growth factor does not cause neurotoxicity in these transfected cells. Also, unlike control cells, transfected cells continue to proliferate in the presence of NGF. A significant increase in a tyrosine phosphatase activity was seen in APPctoo transfected cells.

The amyloid precursor protein (APP) is a ABSTRACT molecule centrally involved in Alzheimer diseas-e pathology, but whose normal function is still poorly understood. To investigate the consequences of increased intracellular production of various regions of APP on cellular physiology, we stably transfected PC12 cells with the C-terminal 100 amino acids of the human APP. In eight transfected clones that express the APPcloo protein, exposure to nerve growth factor (NGF) did not promote differentiation. Transfectants continued to divide and failed to elaborate extensive neurites, whereas control PC12 cells, mock-transfected PC12 cells, and a nonexpressing transfected cell line did develop neurites and stopped dividing after NGF stimulation. Unlike NGF treatment, treatment with basic fibroblast growth factor profoundly accelerated neurite outgrowth in transfected cells. Also, a dramatic increase in a tyrosine phosphatase activity was noted. Expression and accumulation of APPcloo protein in PC12 cells results in an abnormal response to growth factor stimulation.

Alzheimer disease (AD) is a complex disorder that impairs cognitive and memory functions in primarily the elderly population. An array of neuropathological changes have been observed in AD brain tissue including neuronal degeneration, intracellular neurofibrillary tangle formation, and extracellular and cerebrovascular 3-amyloid peptide deposits. The gene encoding the amyloid precursor protein (APP), from which the 3-amyloid peptide is cleaved, was cloned and localized to chromosome 21 (1-4). It is now believed that 03-amyloid peptide secretion occurs constitutively in numerous cell types (5-7). Also, processing of APP can follow several pathways that may influence the production of an amyloidogenic 13-amyloid peptide (8, 9). Whether f3-amyloid deposition is a primnary or secondary event in AD pathology is presently unclear. Genetic studies of different familial AD pedigrees strongly suggest that mutations of APP may, at least in a small number of cases, be responsible for initiating AD pathology (10, 11). Additionally, recent in vitro studies with a double mutation found in the APP gene of a Swedish familial AD pedigree demonstrate that the mutations can significantly enhance soluble f-amyloid peptide production (12, 13). The APP is a complex cell surface molecule that may have multiple functions. Some isoforms of APP contain a Kunitzlike protease inhibitor domain in the extracellular portion of the molecule that confers protease inhibition properties (14, 15). Growth promotion activity has been associated with another region in the extracellular domain of APP (16). The ,B-amyloid peptide, a major component of plaques, may also have some unique biological activities. Although the normal function of f-amyloid peptide is not known, synthetic peptides

MATERIALS AND METHODS Cell Culture. PC12 cells and transfected cells were grown in Dulbecco's modified Eagle's medium (DMEM) (GIBCO) with 5% (vol/vol) fetal bovine serum and 5% (vol/vol) horse serum and were routinely passaged without trypsinization. For cells grown in the presence of 2.5S mouse NGF (Boehringer Mannheim; 50 ng/ml), complete medium containing NGF was added to cells 24 h after plating and then was replaced every 2-3 days. Routinely, NGF-treated cells were grown in uncoated culture dishes. However, for some experiments, cells were grown on laminin- or collagen-coated dishes. Culture Abbreviations: AD, Alzheimer disease; APP, amyloid precursor protein; NGF, nerve growth factor; bFGF, basic fibroblast growth factor; SV40, simian virus 40; CM, conditioned medium; PVDF, poly(vinylidene difluoride); NGF-R, NGF receptor; EGF, epidermal growth factor. fTo whom reprint requests should be addressed at: University of Rochester, School of Medicine, 601 Elmwood Avenue, Box 704, Rochester, NY 14642.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

2180

Medical Sciences: Sandhu et al. dishes (35 mm) were covered with 10 jig of mouse laminin (BRL) as described (26) or with 100 ,gg of rat tail collagen (Sigma) exactly as described (27). Bovine recombinant bFGF (146 aa) was obtained from Boehringer Mannheim and used at 10 ng/ml in complete medium. Conditioned medium (CM) was collected from 106 cells after 3 days of growth. CM was centrifuged (500 x g for 10 min) to remove any cellular debris. The CM was diluted 1:1 with complete medium and the pH was adjusted to 7.4 while maintaining the temperature at 37°C. Finally, the CM was filter-sterilized. Vector Construction. The pSVAex construct was as described (28) and used again to transfect PC12 cells. This vector, which utilizes the simian virus 40 (SV40) large tumor antigen start codon, produces a fusion protein containing 7 aa of the SV40 large tumor antigen and 96 aa of the C-terminal region of APP. The antigenicity and migration of the fusion protein are indistinguishable from APPcloo by Western blot analysis. pJCEAex, the other vector, is exactly as described (29). With this vector, only the human APPcioo protein is expressed. Transfection of PC12 Cells. Calcium phosphate precipitates of pSVAex DNA (10 ,ug) or pJCEAex (10 ,ug) and pKoNeo (2 ,ug) were prepared by the supplier's specifications (Profection, Promega) and added to 105 PC12 cells. After 2 days in culture, the cells were washed once with PBS and split 1:10 in complete medium supplemented with G418 (GIBCO; 0.2 mg/ml). Resistant clones were isolated 3-5 weeks after G418 treatment and propagated. Positive transfectants, which integrated the human APPCIoo gene and the neomycin-resistance gene, were identified by PCR amplification of cellular DNA with transgene-specific primers, hA3 [GATGGGGGATGCTTCATGTG; 2622-2641 bp of APP695 (2)] and SV3 (GTCACACCACAGAAGTAAGG; 4677-4696 bp of the SV40 genome) as described (29). DNA products were separated on a 1% agarose gel with ethidium bromide (0.5 ,ug/ml) and photographed under UV light. Growth and Viability Assays. The growth rate of cells was determined by counting cells with a hemocytometer at 1 and 3 days after plating as described (19). Cells were removed by trypsinization to fully represent total cell counts for every case. Samples for each time point were analyzed in triplicate and the resulting numbers were averaged. Cell viability was assayed by trypan blue dye exclusion for growth rate determinations of cells treated with or without NGF. Cells were placed in 0.04% trypan blue in PBS for 5-10 min and then counted with a hemocytometer. Dark blue cells were scored as nonviable and clear cells were considered viable. Toxicity of CM was tested by administering 50% (vol/vol) CM (pH 7.4) [diluted 1:1 with fresh complete medium] to NGF-treated PC12 cells. The CM mixture was changed every 2 days and replaced with freshly diluted CM mixture. Cells used in the CM toxicity experiments were either subjected to concurrent NGF treatment or were first grown in the presence of NGF for 5 days and then grown in the CM mixture. Cell viability was determined after 7-9 days in CM mixture by trypan blue dye exclusion assay. All samples were analyzed in triplicate. Cell Lysate Preparations for Western Blot Analysis. Routinely, lysates of tissues were prepared with a mixture of 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 1 mM benzamidine, leupeptin (2 jig/ml), and 2 ,uM pepstatin in a Dounce homogenizer. Lysates were centrifuged for 30 min at 12,000 x g; the supernatant was saved and the pellet was boiled in 1% SDS solution for 5 min. Protein concentrations were determined by modified Lowry (30). Western Blot Analysis. Proteins were separated by SDS/ PAGE on 7-12% gels as described by Laemmli (31) or by Tris/Tricine SDS/PAGE on 10-15% gels (32). After electrophoresis, proteins were transferred to Immobilon P (0.45 ,um, pore size, Millipore) poly(vinylidene difluoride) (PVDF)

Proc. Natl. Acad. Sci. USA 93 (1996)

2181

membranes in 25 mM Tris/192 mM glycine/20% (vol/vol) methanol. Filters were blocked with 5% (wt/vol) nonfat dry milk in TBST (20 mM Tris HCl, pH 7.4/150 mM NaCl/0.05% Tween 20) for 1 h and then incubated with primary antibody for 3 h at room temperature. Filters were washed three times in TBST before placing in secondary antibody [1:300 diluted donkey anti-rabbit IgG horseradish peroxidase conjugate (Amersham) or 125I-labeled protein A (NEN) or 1:1000 diluted anti-mouse IgG alkaline phosphatase conjugate (Oncogene Science)]. The filters were subjected to three washes in TBST. Binding was visualized by using ECL reagents (Amersham) with exposure to X-AR film (Kodak) for rabbit antisera. Immunoblots with mouse antibodies were incubated in antimouse IgG conjugated to streptavidin (DAKO) for an additional 2 h at room temperature and then washed three times in TBST. Staining was visualized with BCIP and NBT (Promega). Immunoprecipitation of NGF Receptor (NGF-R). NGF-R was immunoprecipitated with a rabbit polyclonal anti-trkA antibody (a gift from Moses Chao, Cornell University Medical College) after a 5-min treatment or no treatment with NGF. Cell lysates from 107 cells were prepared in 1 ml of 1% Nonidet P-40 buffer containing 20 mM Tris HCl (pH 8), 137 mM NaCl, 10% glycerol, 2 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, aprotinin (0.15 unit/ml), 20 ,uM leupeptin, 1 mM sodium orthovanadate, and 4 mM p-nitrophenyl phosphate (33). Lysates were normalized for protein content; NGF-R was immunoprecipitated with 5 Al of anti-trkA/3 mg of cell lysate for 3-4 h at 4°C. Immunoprecipitates were collected on protein A-Sepharose beads, washed three times with ice-cold 1% Nonidet P-40 buffer or RIPA buffer, separated by SDS/PAGE on a 7.5% gel, and transferred to PVDF membranes (Millipore). NGF-R was visualized by Western blot analysis of immunoprecipitated material with an antiphosphotyrosine monoclonal antibody (1:1000 dilution, 4G10, Upstate Biotechnology) or trkA antisera (1:2500 dilution).

RESULTS We have stably transfected PC12 cells independently with two vectors designed to express the C-terminal region of human APPcloo. The SV40 early region promoter or the JC virus early region promoter, which are both active in PC12 cells (28, 34), were used to direct expression of the human APPcloo gene in these cells. Transfectants derived from the SV40-based plasmid are referred to as APPc1oo clones, whereas those obtained from the JC virus vector are termed APPJcioo clones. For simplicity, we refer to both proteins as C100 or JC100 throughout this paper. Western blots were performed to assess synthesis of APPcloo transgene protein. We observed increased amounts of an 14-kDa protein, presumably APPc1oo monomer, when we probed blots with a well characterized antibody directed against an extreme C-terminal APP peptide termed C8 (35). Synthesis of the APPcloo protein was seen in eight unique transfected cell lines using both SV40 and JC expression vectors but is greater (-2-fold) with the SV40 promoter construct (Fig. 1 and Table 1). One APP10coo clone (Fig. 1, lane 7), did not produce the 14-kDa protein. This clone, which harbors expression vector DNA but does not produce any protein, has been used as an additional control; it will be referred to as APPJC100-IM, for integration mutant, in subsequent experiments. Additionally, the expression of the transgene RNA was not detected in the APPJC100-IM cell line by reverse transcription-coupled PCR analysis. PC12 cells, derived from a rat pheochromocytoma, have been extensively studied and shown to extend neurites after stimulation with NGF (25). We treated transfected clones and parent PC12 cells with NGF for 1 week and observed morphological changes in the cells. PC12 cells developed long and extensive neurites upon treatment with NGF (Fig. 2). The -

w;.w.i-.Fi ._i-.*t,.s,. g.i,M-

Medical Sciences: Sandhu et al.

2182

I

~

69-

2

4

0- NPIM 4~I VW

5

,,

6

.

Proc. Natl. Acad. Sci. USA 93

(1996)

Table 1. Properties of transfected cell lines

7

Neurite outgrowth

-.

Cell line

+ NGF

+ bFGF

Expression of human

APPcioo

FIG. 1. Western blot of the transfected cells. Cell lysates (25 jug) from transfected clones and control cells were separated by SDS/ PAGE on 12% gels, transferred to PVDF membranes, and probed with C8 antisera (1:500 diluted). PC12 cells (lane 1) are the wild-type control cell line. C100-1 (lane 2), C100-2 (lane 3), and C100-3 (lane 4) clones were transfected with pSVAex DNA, whereas JC100-1 (lane 5) and JC100-4 (lane 6) clones were transfected with pJCEAex DNA. JC100-IM (lane 7) is a transfected clone that harbors JCEAex DNA but does not express APPcioo protein. The arrow marks increased levels of APPCioo monomer at 14 kDa in transfected clones (lanes 2-6) compared to the integration mutant (lane 7) or PC12 cells (lane 1).

PC12 C100-1 ++ C100-2 ++ C100-3 C100-4 ++ C100-5 ++ JC100-1 JC100-4 +/JC100-7 + JC100-IM PCNeO-1 PCNeo-2 PCNeo-5 Various unique clones generated by transfection of PC12 cells are listed. C100 clones contain pSVAex DNA, JC100 clones contain pJCEAex DNA, and PCNeO cells harbor only the pKoNeo DNA; C100 and JC100 clones also contain the pK0Neo DNA. C100 and JC100 clones were independently generated at separate times. The response to growth factor stimulation (NGF or bFGF), gauged by neurite extension, is given on a scale of - (as no response) to ++++ (as largest observed response relative to the other cell lines examined). Also, the level of human APPcloo protein expression is indicated relative to the highest amount observed in a cell line.

processes became visible 3-5 days after NGF treatment and grew in length (to 5-15 times a somal body) after a 7-day exposure to NGF. Untreated PC12 cells did not develop any neurites. Also, APPJC100-IM control cells and several mocktransfected cell lines developed neurites, just as PC12 cells did, after NGF treatment (Fig. 2 and Table 1). In contrast, five unique APPcloo clones and three independent APPJcloo clones

did not form extensive neurites after 7 or even up to 11 days of NGF exposure. Neurite extension in transfected cells was not influenced by coating plates with either laminin or collagen, which has been shown to enhance neurite outgrowth in PC12 cells (27); routinely, we grew cells on uncoated dishes. Some very short neurites were apparent after 3-5 days of NGF exposure, but in