Alveolar Proliferation, Retinoid Synthesizing Enzymes ... - ATS Journals

Alveolar Proliferation, Retinoid Synthesizing Enzymes, and Endogenous Retinoids in the Postnatal Mouse Lung Different Roles for Aldh-1 and Raldh-2 Matthew Hind, Jonathan Corcoran, and Malcolm Maden Medical Research Council Centre for Developmental Neurobiology, King’s College London, London, United Kingdom

Alveoli are formed postnatally in the rat, mouse, and human. The molecular signals controlling the patterning of this developmental process are not well understood. Here we describe immunohistochemical studies that label proliferating alveolar wall cells which suggest two distinct patterns of alveologenesis: (1) a low grade, peripheral subpleural parenchymal process which occurs from P1 through to P15; and (2) a dramatic increase in central cell proliferation from P4 which is complete by P15, corresponding to the well described period of alveolar septation. We describe the temporal and spatial expression of the retinoid-synthesizing enzymes Aldh-1 and Raldh-2 in the postnatal mouse lung. Both enzymes are upregulated during the period of maximal alveolar wall cell proliferation. Aldh-1 is located in the bronchial epithelium and alveolar parenchyma, and Raldh-2 is restricted to the bronchial epithelium and pleural mesothelial cells. High-pressure liquid chromatography (HPLC) reveals that rapidly septating lungs have relatively simple chromatographic profiles; in contrast, the adult lungs have a complex profile that includes many novel retinoids. These data suggest two patterns of alveolar proliferation with temporal and spatial association of the enzymes Aldh-1 and Raldh-2 and a dynamic role for different retinoids in both the septating and adult mouse lung.

Alveoli are formed as a developmentally regulated, largely postnatal event in rats, mice, and humans (1–3). Retinoids are a family of molecules derived from vitamin A (retinol) and include the biologically active metabolite, retinoic acid (RA). Alveolar subdivision or septation in the developing postnatal rat lung is associated with dramatic changes in the metabolism of endogenous retinoids from storage forms (retinyl esters) to more biologically active molecules, such as retinol and RA (4, 5). Septation is also associated with transcriptional upregulation of the retinoid-binding proteins and retinoic acid receptor (RAR) genes (5–7). Recently it has been reported that mice with specific RAR gene deletions have altered patterns of alveologenesis; with RAR a negative (8), and RAR (9) a positive factor in the regulation of alveologenesis. The dramatic potential

(Received in original form March 27, 2001 and in revised form July 12, 2001) Address correspondence to: Dr. Matthew Hind, MRC Centre for Developmental Neurobiology, 4th Floor, New Hunts House, King’s College London, Guy’s Campus, London SE11UL, UK. E-mail: matthew.hind@kcl. ac.uk Abbreviations: Aldehyde dehydrogenase-1, Aldh-1; complimentary DNA, cDNA; glucose acid phosphate dehydrogenase, GAPDH; high-pressure liquid chromatography, HPLC; 14-hydroxy-4, 14-retro-retinol, 14HRR; messenger RNA, mRNA; phosphate buffered saline, PBS; retinoic acid, RA; Retinaldehyde dehydrogenase-2, Raldh-2; retinoic acid receptor, RAR; reverse transcriptase polymerase chain reaction, RT-PCR; saline sodium phosphate, SSC. Am. J. Respir. Cell Mol. Biol. Vol. 26, pp. 67–73, 2002 Internet address: www.atsjournals.org

for alveolar repair or regeneration in the adult lung in response to exogenous retinoids has been demonstrated by Massaro and Massaro (10, 11), who showed that all-transRA (atRA) can reverse, and partially reverse, the pathologic features of emphysema in the adult elastase-treated rat and adult tight-skin mouse, respectively. This evidence suggests a central role for retinoid signaling in alveolar formation and highlights the potential for novel therapeutic approaches to the treatment of respiratory diseases characterized by a reduced gas exchanging surface area, such as emphysema and bronchopulmonary dysplasia. To gain further insights into the role of retinoids and alveologenesis, we characterized the pattern of alveolar proliferation, examined the temporal and spatial distribution of the key developmental RA-synthesizing enzyme genes, aldehyde dehydrogenase-1 (Aldh-1) and retinaldehyde dehydrogenase-2 (Raldh-2), and determined the endogenous retinoid profile in the postnatal mouse lung from birth, through the period of alveologenesis to adulthood. Using an antibody that identifies proliferating cells on fixed tissue sections of postnatal lungs (P1, P4, P9, P15, and adult), we identify two different periods and patterns of alveolar proliferation during postnatal alveologenesis. Reverse transcriptase polymerase chain reaction (RTPCR), in situ hybridization, and immunohistochemical studies demonstrate different temporal and spatial expression patterns of the retinoid-synthesizing enzymes Aldh-1 and Raldh-2, which may be responsible for the different patterns of alveolar proliferation. Finally, high-pressure liquid chromatography (HPLC) reveals the endogenous retinoid profile of the lungs at each stage examined.

Materials and Methods Animal Care All experiments were conducted in accordance with local ethics committee guidelines. Animals were an established outbred strain of mice (TO) obtained from Harlan (Bicester, UK). Postnatal day 1 (P1), P4, P9, P15, both male and female, and adult females (over 8 wk) were used in these experiments. All animals were given access to water and laboratory chow ad libitum.

Tissue Preparation Animals were killed by neck dislocation and their lungs dissected free. Lung tissue for HPLC and RT-PCR analysis was removed, washed in phosphate-buffered saline (PBS), and immediately stored at –70C. Lungs for in situ hybridization studies and immunocytochemistry were dissected out and removed, the trachea cannulated, tied firmly in place, and infused with either 4% paraformaldehyde or perfix at pressure of 20 cm H 2O for 24 h. The lungs were then dehydrated through a graded series of alcohol solutions and xylene, and embedded in paraffin wax. The

68

AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL. 26 2002

TABLE 1

Primers used in RT-PCR analysis Gene

Aldh1 Raldh2 GAPDH

Forward primer

Reverse primer

Size

591 aactcctctcacggctctcac 612 1190 gcttcttcattgacccac 1208 37 cgtagacaaaatggtgaagg 56

980 gctcgctcaacactccttttc 960 333 gactccacgacatactcagc 314 333 gactccacgacatactcagc 314

380 350 298

lungs were sectioned at 5 m, and the sections mounted on polylysine-coated glass slides (BDH, Dorset, UK).

RT-PCR Analysis To identify which synthesizing enzymes were involved in postnatal RA synthesis, we used semiquantitative RT-PCR according to methods described elsewhere (12). Briefly, RNA was extracted using an RNAeasy kit (Qiagen, W. Sussex, UK) and cDNA prepared by the use of an Amersham Pharmacia (Bucks, UK) 1ststrand cDNA synthesis kit as described in the manufacturer’s instructions. The primers used were specific to mouse Aldh-1 and Raldh-2. Primers to the housekeeping gene glucose acid phosphate dehydrogenase (GAPDH) were used in each PCR as an internal control (Table 1). An amplification curve was established for each enzyme (15– 40 cycles); subsequent amplification was then performed in the linear range for both pairs of primers. Amplification conditions were as follows: denaturation for 30 s at 95 C, annealing for 30 s at 55C, and extension for 30 s at 72C, (Aldh-1 22 cycles, Raldh-2 25 cycles). One-fifth of the resultant product was then visualized on an agarose gel. Each RNA extraction was repeated at least three times and PCR amplification curves established in each case. Representative gels were normalized to the housekeeping gene, GAPDH, using Scion image analysis, gel-plot 2 software, available free of charge at www.http/scioncorp.com and the relative amount of mRNA measured. Data from at least three separate experiments were combined in the figures.

workers (15), and its use as a marker of cells preparing to enter mitosis has been established because there is a mitosis-specific phosphorylation of histone H3 that occurs in late G2 phase of the cell cycle (16). Labeled cells in the conducting airways were discounted from the analysis. Both the total number of labeled cells total number of unlabeled nuclei were counted to identify a temporal and spatial pattern of alveolar proliferation. Counting was performed at 400 magnification using an eyepiece graticule aligned to the edge of the section to compare peripheral areas with central areas. Regions of tissue that contained large amount of bronchovascular tissue were discounted from the analysis. The antibody staining was repeated on at least three randomly selected regions of lung with at least five tissue sections from each region. This was repeated for each developmental stage examined.

In Situ Hybridization Digoxigenein-labeled RNA sense and antisense probes were synthesized from the mouse Aldh-1 plasmid as described by Duester (17). In situ hybridization was performed according to a modified

HPLC Analysis Retinoids were extracted from the tissue according to the method of Thaller and Eichele (1987) (13) by collecting 200–500 mg of lungs and homogenizing in 1 ml of stabilizing solution (5 mg/ml ascorbic acid, Na3EDTA in PBS, pH 7.3). The homogenate was extracted twice with 2 vols of 1:8 methyl acetate/ethyl acetate, with butylated hydroxytoluene as an antioxidant, and then dried down over nitrogen. The extract was resuspended in 100 l methanol, centrifuged at high speed to remove any particulate matter, and placed into an auto sampler vial for analysis. Reverse-phase HPLC was performed using Beckman System Gold Hardware with a photodiode array detector and a 5 C18 LiChrocart column (Merck, Dorset, UK) with an equivalent precolumn. The mobile phases used were those of Achkar and colleagues (1996) (14) that allows a good separation of the retinoic acids and the retinols. The flow rate was 1.5 ml/min using a gradient of acetonitrile/ammonium acetate (15 mM, pH 6.5) from 40% to 67% acetonitrile in 35 min followed by 100% acetonitrile for an additional 25 min. Individual retinoids could be identified according to their UV absorption spectra using the photodiode array detector.

Proliferation Studies Tissue sections from P1, P4, P9, P15, and adult lungs were processed and mounted on glass slides as described above. An antibody to the phosphorylated serine 10 residue of histone H3 (anti–phospho-H3) was used to label proliferating cells. The characterization of this antibody is described by Clayton and co-

Figure 1. The temporal pattern of alveolar wall cell proliferation in the postnatal mouse lung during alveologenesis. Using an antibody that identifies cells undergoing late G2 phase of mitosis (anti–phospho-H3 antibody), the total number of proliferating alveolar cells are identified. The total number of labeled cells and unlabeled nuclei were counted and expressed as proliferating cells per 1,000 nuclei (both labeled and unlabeled). Labeled cells occupying a peripheral location (solid bars) are compared with labeled cells occupying a central location (shaded bars). Data are means S.E.M. *P 0.05 peripheral compared with central; **P 0.05 both central and peripheral compared with P15 and adult.

Hind, Corcoran, and Maden: Alveolar Proliferation, Retinoid Synthesizing, and Endogenous Retinoids

69

Figure 2. Patterns of alveolar wall cell proliferation within the postnatal mouse lung during alveologenesis. The photomicrographs are sections of postnatal mouse lungs labeled with anti–phospho-H3 antibody. A–C, D–F, G–I, and J–L are images of P1, P4, P9, and P15 lungs, respectively. There was little alveolar wall cell proliferation in the adult lung (data not shown). A, D, G, and J are low power (100) images of whole lung; B, E, H, and K are high power images of peripheral lung (400); C, F, I, and L are high power images (400) of central (nonperipheral) lung. Scale bar 100 m.

Wilkinson (18) method. Briefly, sections were prepared as described, dewaxed with xylene, and rehydrated through graded alcohol solutions, washed once with PBS, and fixed in 4% PFA for 30 min. They were then washed twice for 5 min in PBS-0.05% Tween (PBT). Sections were treated with Proteinase K (1:1,000) for 5 min. The sections were then washed twice in PBT for 10 min and fixed again for 30 min in 4% PFA. Sections were dehydrated through graded alcohol solutions and air-dried. Hybridization was performed at 55C overnight using a 1 in 100 dilution of probe in hybridisation buffer. Hybridization buffer consisted of 50% formamide, 25% 20 SSC, 0.05% heparin, 0.5% Tween 20 and 1% yeast tRNA. The slides were then washed sequentially for 15 min at 55C in 2 SSC, then 0.2% SSC. RT washes for 5 min each in 75% 0.2 SSC, 25% PBT, 50% 0.2 SSC, 50% PBT, 25% 0.2 SSC, 75% PBT, and 100% PBT. Slides were blocked in 2% sheep serum in PBT for 1 h and incubated with anti DIG antibody (1:2,500) overnight at 4 C. Slides were then washed eight times in PBT for 2 h at RT. Color reaction was developed by using NBT/BCIP according to the manufacturer’s instructions (Boehringer Mannheim, Lewes, UK). Controls using sense probes and no probe developed a uniform background signal only.

Immunohistochemistry Slides were dewaxed to PBS through graded alcohol solutions and blocked with goat serum for 1 h. They were then incubated in primary antibody at 4C overnight and washed three times in PBS. Subsequent steps using secondary antibody, ABC reagent, and diaminobenzidine were performed according to a Vector ABC Elite kit (Vector labs, Peterborough, UK).

Statistical Analysis The data are expressed as means standard error of the mean (SEM). Data were compared using Student’s t test. Differences were considered significant at P 0.05.

Results Immunohistochemical Proliferation Studies The first series of experiments were conducted using an antibody (anti–phospho-H3) raised against the phosphorylated serine 10 residue of histone H3. Phosphorylation of this residue initiates in late G2 and is complete before

70


Figure 3. Temporal expression of Aldh-1 and Raldh-2 genes during alveologenesis in the postnatal mouse lung. Densitometry analysis of RT-PCR bands demonstrates the temporal expression pattern of the Aldh-1 mRNA normalized to the expression of the internal control GAPDH mRNA, demonstrating upregulation in the early neonatal lung (P4) ( A), **P 0.05 compared with P9, P15, and Adult. Densitometry analysis of RT-PCR bands demonstrates the temporal expression pattern of the Raldh-2 mRNA normalized to the expression of the internal control GAPDH mRNA, revealing upregulation in the neonatal lung (P1). * P 0.05 compared with P15 and adult lung ( B).

prophase in the cell cycle of mitosis. Visualization of labeled alveolar wall cells allows both temporal and spatial patterns of alveolar wall cell proliferation to be identified. Figure 1 clearly shows that the major period of proliferation has commenced between P1 and P4 and is largely complete by P15. This temporal pattern is in general agreement with morphometric studies of septation in the rat and mouse (1, 2). There is constant cell turnover in the bronchial epithelium and the labeled bronchial cells were excluded from the analyses. The location of signal shows two distinct spatial patterns of alveolar proliferation. At P1 the few labeled cells are scattered in a peripheral distribution (Figures 2A and 2B), with little proliferation in the central regions (Figure 2C). The peripheral proliferation is maintained at P4 (Figures 2D and 2E); however, unlike P1 (Figure 2C), proliferation has now increased 10-fold in the central regions (Figure 2F). At P9 (Figures 2G, 2H, and 2I) there are many labeled cells scattered throughout the alveolar tissue with no obvious pattern. When septation is complete at P15 and the rate of proliferation falls to near adult levels, the labeled cells occupy a peripheral, subpleural parenchymal location (Figures 2J, 2K, and 2L). Significantly, we identify scattered alveolar proliferation, at a low level, in the adult mouse lung. Thus we describe a pattern of alveolar proliferation that is largely peripheral in the P1 mouse lung, becomes scattered in the P4 and P9 lung, and is peripheral, after septation is complete, at P15. Aldh-1 and Raldh-2 Expression Using RT-PCR and specific primers, we identify and describe the temporal expression of two key retinoid-synthesizing enzymes in postnatal mouse lungs. Aldh-1 and Raldh2 are dehydrogenase enzymes that catalyze the irreversible conversion of retinal to RA. This family of enzymes has a pivotal role in the local production of RA and are thought to be the rate-limiting step in RA synthesis (19). Raldh-2 mRNA expression has been previously described in the em-

bryonic lung during the earlier stage of branching morphogenesis (20) and Aldh-1 mRNA has been identified in adult mouse lung (21) by Northern blotting, but their expression has not been examined during alveologenesis. There are dynamic changes in the temporal expression patterns of Aldh-1 and Raldh-2 mRNA in the postnatal lung. Both enzymes are identified in all stages examined and are significantly upregulated in the early postnatal lung (Figures 3A and 3B). Aldh-1 mRNA was visualized using in situ hybridization (Figure 4A). The signal can clearly be seen in both the bronchial epithelium and lung parenchymal tissue. There are positive cells within the alveolar septal tissue (Figure 4B) but there was no signal detected in the pleura (Figure 4A). Raldh-2 protein was detected using an antibody and can be localized to the bronchial epithelium and pleural mesothelial cells (Figures 5A and 5B). The spatial distribution of both enzymes did not change over time. Thus the expression of Aldh-1 and Raldh-2 overlap in the bronchial epithelium, but only Aldh-1 is detected in the alveolar septal tissue and only Raldh-2 in the pleura. Endogenous Lung Retinoids Retinoid extractions were performed on five to six replicate samples of postnatal lungs taken at Days 1 (P1), 4 (P4), 9 (P9), and 15 (P15) after birth and on 17 replicate samples of adult lungs, making a total of 38 samples in all. All-trans-retinol was present in every sample and at levels which varied according to stage. P1 lungs had an average of 119 pg/mg tissue and this level dropped in P4 and P9 lungs to 58 and 60 pg/mg tissue, respectively, only to rise again by P15 to 124 pg/mg tissue (Figure 6). In adult lungs the level of all-trans-retinol was 50-fold higher (average of 5,156 pg/mg tissue), in accordance with the lung being a storage organ for retinoids (22). In accordance with this trend for retinol, all-trans-RA could only be detected in P1 (122 pg/mg tissue), P15 (33 pg/mg), and adult lungs (579 pg/mg), and not in P4 or P9 lungs.


71

Figure 4. Spatial expression of Aldh-1 mRNA in the postnatal mouse lung. Representative photomicrographs of in situ hybridization studies using digoxigeninlabeled antisense Aldh-1 RNA probes on sections of P4 mouse lung. Aldh-1 mRNA is restricted to the bronchial epithelium (arrowhead) and alveolar epithelium (arrow) (A). Note there is no signal in the pleura (pl) (B). Control experiments using sense RNA probes and no probe revealed no signal (data not shown). Scale bar 100 m.

In general, the chromatographic profiles of P1–P15 lungs were simple, with no identifiable retinoid peaks other than all-trans-retinol and all-trans-RA (Figure 7A; peak 2 all-trans-RA, peak 5 all-trans-retinol). However, adult lungs showed a more complex chromatographic

profile with many other peaks present (Figure 7B), and they were particularly rich in retroretinoids. Identifiable retinoids in these adult profiles included 4-oxo-retinoic acid (peak 1), all-trans-retinoic acid (peak 2), 14-hydroxy-4, 14retro-retinol (14-HRR) (peak 3), 13-cis-retinol (peak 4), all-trans-retinol (peak 5), and anhydroretinol (peak 6). The other peaks present which are of uncertain identity are: peak A (a retroretinoid with a uv absorption spectrum showing 3 maximal at 299, 310, and 324), peak B (which could be 3,4-didehydroretinol), peak C (an unknown), peak D (which has an identical uv spectrum to 14-HRR but which elutes at a different position and could be a fatty acid ester of 14-HRR), peak E with an identical uv spectrum to all-trans-retinol, which could be an ester, and peak F, another peak with an identical uv spectrum to 14-HRR, which could be another 14-HRR ester. We could not unambiguously identify 9-cis-retinoic acid in any of the tissue analyzed.

Discussion

Figure 5. Spatial distribution of Raldh-2 protein in the postnatal mouse lung. The photomicrographs demonstrate immunohistochemical localization of Raldh-2 protein restricted to the bronchial epithelium (arrow) (B) and pleura (arrowhead) (C) of a P1 mouse lung. The location of signal did not change over time. Note there is no signal in the alveolar septal regions. Scale bar 100 m.

Our results are in general agreement with previous morphometric and DNA incorporation studies in the rat (2, 23) and scanning electron microscopy studies in the mouse (1) showing alveolar formation from the first to the third postnatal week. Previous labeling studies have suggested that alveoli are formed most rapidly at the periphery in the rat (24); we provide temporal and spatial data on alveolar wall cell proliferation that may support this idea. We describe two distinct patterns of alveolar proliferation: (1) a peripheral, subpleural parenchymal pattern of alveologenesis which occurs from birth through to P15; and (2) a pattern of rapid central proliferation at P4 and P9 which is complete at P15. Thus, as in earlier studies which have examined septation in the mouse, we found the period of maximal alveolar proliferation commenced between P1 and P4 and was largely complete by P15. It is interesting to note that there is a small but significant amount of alveolar wall cell proliferation in the adult mouse lung, suggesting cell turnover. Evidence from the RT-PCR studies confirmed with in situ hybridization or immunohistochemistry suggests a role

72


for the RA-synthesizing enzymes, Aldh-1 and Raldh-2, in endogenous retinoid synthesis in the postnatal mouse lung. The temporal expression patterns indicate that transcription of both the Aldh-1 and Raldh-2 genes is significantly upregulated during alveologenesis. Aldh-1 mRNA is expressed in the bronchial epithelium and alveolar septal tissue. Raldh-2 protein is identified in the bronchial epithelium and pleura. This data supports the role of Aldh-1 as an RA-synthesizing enzyme located within the alveolar septae but not Raldh-2. The similarity between the peripheral pattern of proliferation identified in the P1–P15 lung and pleural Raldh-2 signal is striking (Figures 2, 3A, and 5A). It suggests that pleural Raldh-2 could be synthesizing a retinoid, which acts as a local developmental signal to induce the peripheral formation of alveoli. Aldh-1 expression is associated with the more widespread pattern of alveolar proliferation seen in the P4 and P9 lung; these data suggest that Aldh-1 is involved in this more central pattern of proliferation. Unusually, both Aldh-1 and Raldh-2 are present in the bronchial epithelium in overlapping distributions. The biologic significance of this observation regarding alveologenesis is unclear. It is known that bronchial epithelium is exquisitely sensitive to retinol depletion; one of the earliest features of vitamin A deficiency is the squamous metaplastic change of pseudostratified epithelium into keratinizing squamous epithelium (25, 26). The presence of two enzymes with similar functions in overlapping distributions may reflect this sensitivity. Another explanation would be that these enzymes are synthesizing different retinoids, each with specific functions. Our results confirm and extend the observations of earlier authors who identified the mobilization of retinoids from storage forms to more biologically active compounds (4, 5). The most abundant RA in the lungs is atRA. We identify a peak of atRA, which immediately precedes the onset of septation at P1. During the rapid period of alveolar proliferation, where transcription of Aldh-1 and Raldh-2

Figure 6. Retinol and RA levels at different stages in the postnatal mouse lung during alveologenesis. Retinoids were extracted and eluted from HPLC columns. Individual retinoids were identified by their UV absorption spectra. The levels of atRA (filled bars) and retinol (shaded bars) were measured and plotted on a logarithmic scale. No atRA could be detected in the samples of P4 and P9 mouse lung (n 5 for P1, P4, P9, and P15; n 17 for adult).

is maximal no RA could be identified. We suggest that this indicates rapid RA utilization. RA is broken down into polar metabolites, such as 4-oxo RA, by the cytochrome P450 family of enzymes (27). CYP-26 is a major degradation enzyme for RA and its expression is restricted both temporally and spatially in many RA-dependent developing systems including the lung (20). RT-PCR suggests that CYP-26 mRNA is also regulated in the neonatal lung (data not shown), suggesting that levels of RA during alveologenesis are controlled by both synthesizing and degrading enzymes. Unlike McGowan and associates (5), who performed HPLC on rat lung, we did not identify 9-cis RA in the postnatal mouse lung; this may reflect species differences between the rat and mouse. What is clear from these studies is that the immature developing lung has a retinoid profile very different from that of the adult lung. The presence of high levels of anhydroretinol and 14HRR in a tissue of the body is a novel finding. 14HRR is a survival factor for fibroblasts (28) and has been previously found to be generated by B-lymphocytes in vitro (29). Anhydroretinol has the opposite effect, being a competitive inhibitor of the growth-supportive effects of retinol or 14HRR (30). Therefore, the balance between these two endogenous compounds in the lung might play a role in regulating the retinoid status in the alveoli in the adult lung. Recently it has been reported that adult vitamin A–deficient rats develop emphysema (31) (Hind and Maden 2000, unpublished observations), suggesting that the complex pattern of retinoids which we have identified in the adult lung are important in the maintenance of the alveolar epithelium. One can speculate that endogenous retinoids have a role in alveolar repair that is

Figure 7. Representative chromatograms of P1 (A) and adult (B) lung. Neonatal lungs contained only atRA and retinol. Identifiable retinoids in adult profiles included 4-oxo-retinoic acid (peak 1), all-trans-retinoic acid (peak 2), 14-hydroxy-4, 14-retro-retinol (14HRR) (peak 3), 13-cis-retinol (peak 4), all-trans-retinol (peak 5), and anhydroretinol (peak 6). The other peaks present which are of uncertain identity are: peak A (a retroretinoid with a uv absorption spectrum showing 3 maximal at 299, 310 and 324), peak B (which could be 3,4-didehydroretinol), peak C (an unknown), peak D (which has an identical uv spectrum to 14-HRR but which elutes at a different position and could be a fatty acid ester of 14-HRR), peak E with an identical uv spectrum to alltrans-retinol, which could be a retinol ester, and peak F, another retroretinoid with an identical uv spectrum to 14-HRR. We could not unambiguously identify any 9-cis-retinoic acid.


disrupted in vitamin A deficiency. This idea is supported by clinical studies demonstrating an inverse association between serum retinol and chronic lung disease (32–34). In summary, we show evidence for two separate patterns of alveologenesis in the postnatal lung: (1) a peripheral pattern of alveolar proliferation which occurs outside the previously described period of septation (P1 through to P15); and (2) a widespread, central pattern of alveolar proliferation occurring at P4 and P9 which is complete at P15, corresponding to the period of septation. We describe the expression patterns of the RA synthesizing enzymes, Aldh-1 and Raldh-2, which are identified in discrete locations within the lung. Based on the temporal and spatial distribution of the enzymes, we suggest that Raldh-2 is the RA-synthesizing enzyme responsible for the peripheral pattern of alveolar proliferation and that Aldh-1 is the RA-synthesizing enzyme associated with the more widespread pattern of alveolar proliferation during alveolar septation. We identify dramatically different retinoid profiles in the developing postnatal and adult mouse lungs and suggest a dynamic role for both stimulatory and inhibitory retinoids in the balance of alveolar repair against alveolar destruction in the adult lung. Acknowledgments: M.H. is a Wellcome Trust Research Training Fellow, sponsored by M.M. The authors thank Dr. Alison Clayton and Professor Louis Mahadevan (Biochemistry Department, University of Oxford) for the anti–phospho H3 antibody, Dr. Peter McCaffrey (E. Kennedy Schriver Centre, Waltham, MA) for the Raldh-2 antibody, Dr. Greg Duester (Burnham Institute, La Jolla, CA) for the Aldh-1 plasmid, and Dr. Emily Gale, Aida Blentic and Leigh Wilson for expert technical assistance.

References 1. Amy, R. W., D. Bowes, P. H. Burri, J. Haines, and W. M. Thurlbeck. 1977. Postnatal growth of the mouse lung. J. Anat. 124:131–151. 2. Burri, P. H., J. Dbaly, and E. R. Weibel. 1974. The postnatal growth of the rat lung: I. Morphometry. Anat. Rec. 178:711–730. 3. Zeltner, T. B., J. H. Caduff, P. Gehr, J. Pfenninger, and P. H. Burri. 1987. The postnatal development and growth of the human lung: I. Morphometry. Respir. Physiol. 67:247–267. 4. Geevarghese, S. K., and F. Chytil. 1994. Depletion of retinyl esters in the lungs coincides with lung prenatal morphological maturation. Biochem. Biophys. Res. Commun. 200:529–535. 5. McGowan, S. E., C. S. Harvey, and S. K. Jackson. 1995. Retinoids, retinoic acid receptors, and cytoplasmic retinoid binding proteins in perinatal rat lung fibroblasts. Am. J. Physiol. 269:L463–L472. 6. Ong, D. E., and F. Chytil. 1976. Changes in levels of cellular retinol and retinoic acid binding proteins of the liver and lung during perinatal development. Proc. Natl. Acad. Sci. USA 73:3976–3978. 7. Whitney, D., G. D. Massaro, D. Massaro, and L. B. Clerch. 1999. Gene expression of cellular retinoid-binding proteins: modulation by retinoic acid and dexamethasone in postnatal rat lung. Pediatr. Res. 45:2–7. 8. Massaro, G. D., D. Massaro, W. Y. Chan, L. B. Clerch, N. Ghyselinck, P. Chambon, and R. A. Chandraratna. 2000. Retinoic acid receptor-beta: an endogenous inhibitor of the perinatal formation of pulmonary alveoli. Physiol. Genomics 4:51–57. 9. McGowan, S., S. K. Jackson, M. Jenkins-Moore, H. H. Dai, P. Chambon, and J. M. Snyder. 2000. Mice bearing deletions of retinoic acid receptors demonstrate reduced lung elastin and alveolar numbers. Am. J. Respir. Cell Mol. Biol. 23:162–167.

73

10. Massaro, G. D., and D. Massaro. 1997. Retinoic acid treatment abrogates elastase-induced pulmonary emphysema in rats. Nat. Med. 3:675–677. 11. Massaro, G. D., and D. Massaro. 2000. Retinoic acid treatment partially rescues failed septation in rats and in mice. Am. J. Physiol. Lung Cell Mol. Physiol. 278:L955–L960. 12. Corcoran, J., B. Shroot, J. Pizzey, and M. Maden. 2000. The role of retinoic acid receptors in neurite outgrowth from different populations of embryonic mouse dorsal root ganglia. J. Cell Sci. 113:2567–2574. 13. Thaller, C., and G. Eichele. 1987. Identification and spatial distribution of retinoids in the developing chick limb bud. Nature 327:625–628. 14. Achkar, C. C., F. Derguini, B. Blumberg, A. Langston, A. A. Levin, J. Speck, R. M. Evans, J. Bolado, Jr., K. Nakanishi, and J. Buck. 1996. 4-Oxoretinol, a new natural ligand and transactivator of the retinoic acid receptors. Proc. Natl. Acad. Sci. U.S.A 93:4879–4884. 15. Clayton, A. L., S. Rose, J. Barratt, and L. C. Mahadevan. 2000. Phosphoacetylation of histone H3 on c-fos and c-jun-associated nucleosomes upon gene activation. EMBO J. 19:3714–3726. 16. Hendzel, M. J., Y. Wei, M. A. Mancini, A. Van Hooser, T. Ranalli, B. R. Brinkley, D. P. Bazett-Jones, and C. D. Allis. 1997. Mitosis specific phosphorylation of histone H3 initiates primarily within pericentromeric heterochromatin during G2 and spreads in an ordered fashion coincident with chromosome condensation. Chromosoma 106:348–360. 17. Duester, G. 2000. Families of retinoid dehydro genases regulating vitamin A function: production of visual pigment and retinoic acid. Eur. J. Biochem. 267:4315–4324. 18. Wilkinson, D. 1987 In Situ Hybridisation: A Practical Approach. Oxford University Press, Oxford. 19. Duester, G. 1999. Function of alcohol dehydrogenase and aldehyde dehydrogenase gene families in retinoid signaling. Adv. Exp. Med. Biol. 463: 311–319. 20. Malpel, S., C. Mendelsohn, and W. V. Cardoso. 2000. Regulation of retinoic acid signaling during lung morphogenesis. Development 127:3057–3067. 21. Hsu, L. C., W. C. Chang, I. Hoffmann, and G. Duester. 1999. Molecular analysis of two closely related mouse aldehyde dehydrogenase genes: identification of a role for Aldh1, but not Aldh-pb, in the biosynthesis of retinoic acid. Biochem. J. 339:387–395. 22. Okabe, T., H. Yorifuji, E. Yamada, and F. Takaku. 1984. Isolation and characterization of vitamin-A-storing lung cells. Exp. Cell Res. 154:125–135. 23. Massaro, G. D., and D. Massaro. 1996. Formation of pulmonary alveoli and gas-exchange surface area: quantitation and regulation. Annu. Rev. Physiol 58:73–92. 24. Massaro, G. D., and D. Massaro. 1993. Postnatal lung growth: evidence that the gas-exchange region grows fastest at the periphery. Am. J. Physiol 265:L319–L322. 25. Wolbach, S. B., and P. R. Howe. 1925. Tissue changes following deprivation of fat-soluble A vitamin. J. Exp. Med. 42:753–777. 26. Wolbach, S. B., and P. R. Howe. 1932. Epithelial repair and recovery from vitamin A deficiency. J.Exp.Med. 57:511–526. 27. Fujii, H., T. Sato, S. Kaneko, Y. Fujii-Kuriyama, K. Osawa, S. Kato, and H. Hamada. 1997. Metabolic inactivation of retinoic acid by a novel P450 differentially expressed in developing mouse embryo. EMBO J. 16:4163–4173. 28. Chen, Y., F. Derguini, and J. Buck. 1997. Vitamin A in serum is a survival factor for fibroblasts. Proc. Natl. Acad. Sci. U.S.A 94:10205–10208. 29. Buck, J., F. Derguini, E. Levi, K. Nakanishi, and U. Hammerling. 1991. Intracellular signaling by 14-hydroxy-4,14-retro-retinol. Science 254:1654– 1656. 30. O’Connell, M. J., R. Chua, B. Hoyos, J. Buck, Y. Chen, F. Derguini, and U. Hammerling. 1996. Retro-retinoids in regulated cell growth and death. J. Exp. Med. 184:549–555. 31. Baybutt, R. C., L. Hu, and A. Molteni. 2000. Vitamin A deficiency injures lung and liver parenchyma and impairs function of rat type II pneumocytes. J. Nutr. 130:1159–1165. 32. Morabia, A., A. Sorenson, S. K. Kumanyika, H. Abbey, B. H. Cohen, and E. Chee. 1989. Vitamin A, cigarette smoking, and airway obstruction. Am. Rev. Respir. Dis. 140:1312–1316. 33. Morabia, A., M. J. Menkes, G. W. Comstock, and M. S. Tockman. 1990. Serum retinol and airway obstruction. Am. J. Epidemiol. 132:77–82. 34. Paiva, S. A., I. Godoy, H. Vannucchi, R. M. Favaro, R. R. Geraldo, and A. O. Campana. 1996. Assessment of vitamin A status in chronic obstructive pulmonary disease patients and healthy smokers. Am. J. Clin. Nutr. 64:928–934.