Vera Thole, Roberto Miglino and John F. Bol ... Author for correspondence: John F. Bol. ..... We wish to thank Dr R. Hull (John Innes Centre, Norwich, UK) for.
Journal of General Virology (1998), 79, 3139–3143. Printed in Great Britain ..........................................................................................................................................................................................................
SHORT COMMUNICATION
Amino acids of alfalfa mosaic virus coat protein that direct formation of unusually long virus particles Vera Thole, Roberto Miglino and John F. Bol Institute of Molecular Plant Sciences, Gorlaeus Laboratories, Leiden University, PO Box 9502, 2300 RA Leiden, The Netherlands
In contrast to most alfalfa mosaic virus (AMV) strains (YSMV, S, M and 425), AMV strains VRU and 15/64 can form abnormally long virus particles, an ability which has been linked to the coat protein (CP). In order to study this phenomenon, the CP-encoding RNAs 3 of AMV strains VRU and 15/64 were cloned and fully sequenced. Comparative sequence analyses of AMV RNA 3 sequences derived from different strains revealed two non-conservative amino acid substitutions, Ser66 and Leu175, which occur exclusively in the closely related VRU- and 15/64-CPs. When these amino acid alterations were introduced into the CP of AMV strain 425 unusually long virus particles were assembled. This confirms that amino acids Ser66 and Leu175 of the CPs of AMV strains VRU and 15/64 are involved in the formation of tubular virus particles.
Alfalfa mosaic virus (AMV) has a tripartite single-stranded positive-sense RNA genome. RNAs 1 and 2 encode the replicase subunits, P1 and P2, respectively. RNA 3 encodes the movement protein P3 and coat protein (CP), which is expressed from a subgenomic RNA, RNA 4 (for a review, see Jaspars, 1985). AMV assembles to bacilliform particles with a constant diameter (18 nm) and lengths characteristic of the RNA encapsidated (56, 43, 35 and 30 nm, respectively). The bacilliform particles consist of hemi-spherical ends with pentagonal symmetry and a cylindrical part with different hexamer expansions (Mellema & van den Berg, 1974). The four major ribonucleoprotein particles contain the three large RNAs as single molecules and RNA 4 in two copies, respectively. Besides the four major AMV particles, empty spherical protein shells and at least 13 minor bacilliform components encapsidating minor and}or major RNA species are reported (Bol & Author for correspondence : John F. Bol. Fax 31 71 5274469. e-mail j.bol!chem.leidenuniv.nl The nucleotide sequences of RNAs 3 of AMV-VRU and AMV-15/64 reported in this paper have been deposited in GenBank under accession numbers AF015716 and AF015717, respectively.
0001-5798 # 1998 SGM
Lak-Kaashoek, 1974). In addition, AMV strains VRU and 15}64 are able to form unusually long virus particles. These long particles do not contain any RNA molecule longer than RNA 1 and accommodate several molecules of the genome segment or different sets of AMV RNA species (Heijtink & Jaspars, 1974 ; Hull, 1970). Reconstitution experiments suggested that the tendency to form longer particles is CPdirected (Hull, 1970). Apart from its structural role, the AMV CP is required for cell-to-cell movement (van der Kuyl et al., 1991 a ; van der Vossen et al., 1994), regulation of plus- and minus-strand RNA synthesis (van der Kuyl et al., 1991 b ; van der Vossen et al., 1994) and initiation of replication of the three genomic RNAs, which can be complemented by RNA 4 (Bol et al., 1971). In this study, we report the cloning, sequencing and sequence analysis of RNAs 3 of AMV strains VRU and 15}64, respectively. Further, we investigate (by electron microscopy of virus particles assembled) the effect of introducing two nonconservative amino acid variations occurring only in the VRUand 15}64-CPs into the CP of AMV strain 425. The RNAs 3 of AMV strains VRU and 15}64 were cloned by RT–PCR using total nucleic acid extracts from AMV-VRUand 15}64-infected Nicotiana tabacum cv. Samsun NN plants, respectively, and a strain 425-derived primer pair [A, 5« GTATTAATACCATTTTCAAAATATTCC (corresponding to nt 1–27) ; B, 5« CGTACTTACGGGGATTCCCTACGggcccaga (complementary to nt 2120–2142) ; a SmaI site is underlined and non-viral nucleotides are shown in lower-case letters] resulting in pVRU-3 and p15}64-3, respectively. The sequences of pVRU-3 and p15}64-3 were determined by the dideoxynucleotide chain termination method (Sanger et al., 1977) using synthetic oligonucleotide primers. The full-length cDNA 3 copies of strains VRU (GenBank AF015716) and 15}64 (GenBank AF015717) were each 2038 nt in length. Sequence comparisons pointed out that the RNAs 3 of strains VRU and 15}64 differ the most, displaying overall nucleotide sequence similarities of 94–95 % in the pairwise alignments with the known complete AMV RNA 3 sequences of strains YSMV (Neeleman et al., 1991), S (Ravelonandro et al., 1984), the Madison isolate of 425, 425M (Barker et al., 1983) and the Leiden isolate of 425, 425L (Langereis et al., 1986), respectively, whereas the latter four strains show a closer relationship (97–98 %). Accordingly, the P3 and CP amino acid sequences
DBDJ
V. Thole, R. Miglino and J. F. Bol
Table 1. Differences in the CP amino acid sequences of six AMV strains based on the CP sequence of strain 425L Non-conservative amino acid substitutions are shown in bold and identical amino acids are indicated by dots. Amino acid position* Strain
28
40
53
66
71
82
83
93
425L 425M S YSMV VRU 15}64
Q \ \ R \ \
V \ A A A A
V \ \ \ \}L \
F \ \ \ S S
A V V V \ \
V A T A A \
G \ \ \ A A
Y \ \ \ F F
103 106 175 180 184 209 211 213 219 220 H Y \ \ \ \
T \ \ \ S S
Q \ \ \ L L
K \ \ \ R \
F Y Y Y Y Y
G \ \ \ \ K
F L L L \ \
E \ \ \ D D
R \ † \ \ \
H \ \ Q Q
* The amino acid numbering excludes the N-terminal Met. † Stop codon.
Table 2. Percentage of unusually long virus particles Analysis of electron micrographs of virus preparations (16 days p.i.) from N. benthamiana plants infected with the wild-type isolates 425L and VRU as well as with the T7 transcripts from 425L cDNAs 1 and 2 combined with the 425-L-S*, 425L-L* and 425L-SL* transcripts, respectively.
425L VRU 425-L-S* 425L-L* 425L-SL*
Particles counted
Percentage of particles "65 nm
763 539 534 513 521
0% 3±4 % 1% 2±9 % 2±7 %
of strains YSMV, S, 425M and 425L are more similar to one another (97–98 %) than to those of strains VRU and 15}64, respectively (93–95 %). The closely related strains VRU and 15}64 (98 % nucleotide sequence identity) showed variations mainly in the P3 proteins (97 % amino acid sequence identity) with almost complete identity in the CPs (99 %). To analyse the infectivity of the sequenced full-length cDNA copies of VRU- and 15}64-RNAs 3, respectively, the T7 RNA polymerase promoter sequence was fused directly to their 5« termini. The 5« ends of pVRU-3 and p15}64-3 were replaced by ClaI (nt 458)-digested PCR products amplified with primers C [5« TAATACGACTCACTATAGTATTAATACCATTTTCA (T7 RNA polymerase promoter indicated in bold is joined to nt 1–18)] and D [5« GGTCGGTGTCAACATCCAC (complementary to nt 605–623)] to yield pT7VRU-3 and pT7-15}64-3, respectively, and the sequence of the PCR fragments was verified. In vitro RNA transcripts were synthesized with T7 RNA polymerase on SmaI-linearized pT7VRU-3 and pT7-15}64-3, respectively ; transcripts are named
DBEA
according to the relevant plasmid without the prefix ‘ p ’. Transcripts T7-VRU-3 and T7-15}64-3 were mechanically inoculated onto transgenic N. tabacum cv. Samsun NN plants (P12 plants ; Taschner et al., 1991) which express the AMV replicase proteins P1 and P2 and support the replication of RNA 3 in the absence of RNAs 1, 2 and CP (or RNA 4) in the inoculum. Northern blot analysis of total nucleic acid extracts from T7-VRU-3- and T7-15}64-3-infected P12 plants, 5 days post-infection (p.i.), showed that the transcripts were replicating efficiently as demonstrated previously for the T7 transcripts synthesized from the 425L cDNA 3 clone, pAL3 (Neeleman et al., 1991) (data not shown). The high infectivity of the T7-VRU-3 and T7-15}64-3 transcripts confirms that viable RNA 3 molecules have been cloned and further studies can be based on the established nucleotide sequences. Comparison of the CP amino acid sequences deduced from the nucleotide sequences of six AMV strains revealed that among several amino acid variations two non-conservative alterations, Ser'' and Leu"(&, are found exclusively in the VRUand 15}64-CPs (Table 1). Strain 15}64 contains an additional non-conservative amino acid change, Lys#!*, at the C terminus of the CP, in the region known to be involved in CP dimer formation (Kumar et al., 1997). The sequence of the CPencoding region of strains VRU and 15}64 was analysed by using three independent clones for each strain and very few nucleotide variations were observed ; all were silent except one conservative amino acid variation (position 53) for strain VRU (Table 1). The CP amino acid sequences reported in this study for strains VRU and 15}64 are very similar to the (partial) primary CP sequences determined by Castel et al. (1979) ; the latter work differs mainly in several non-conservative amino acid alterations in the N-terminal region of the 15}64-CP (data not shown). The two non-conservative amino acid substitutions occurring exclusively in the CPs of strains VRU and 15}64, Ser'' and Leu"(&, were selected for further analysis. These alterations
AMV long particles
Fig. 1. Electron micrographs of virion preparations from wild-type and mutant AMV infections negatively stained with 2 % uranyl acetate. Particles assembled following infection of N. benthamiana plants with AMV-425L RNAs 1 and 2 transcripts in combination with the 425L-S* (A), 425L-L* (B) and 425L-SL* (C) mutant transcripts, respectively. For comparison, the wildtype isolates AMV-VRU (D) and AMV-425L (E) are shown. For each infection (A–E) two electron images have been selected (1 and 2). All electron micrographs are at the same magnification ; the bar indicates 170 nm.
were introduced either separately or as a double mutation into pAL3 by PCR-mediated mutagenesis. Primers containing the intended mutation [for Ser'' (in bold) E, 5« CGCGCCGAGCCCATTTGAAGAGCTCAGA (complementary to nt 1486–1513) (a SacI site is indicated in italics) and for Leu"(& (in bold) F, 5« TCGATGCGCTGCCTGAGGGA (nt 1815–1834)] were used with a relevant primer [G, 5« AAACGTTCTCAGATGTATGCTGCTTTACG (nt 1346–1374) or B] to synthesize small PCR products. These PCR products served as ‘ megaprimers ’ and amplified together with an appropriate primer (B or G) and with one another PCR products which were cloned as SacI–ApaI fragments (nt 1493–1903) into pAL3. The resulting clones were designated according to the mutated amino acid(s) in strain 425L as p425L-S* (Phe'' ! Ser), p425L-L* (Gln"(& ! Leu) and p425L-SL* (Phe'' ! Ser and Gln"(& ! Leu), respectively. The PCR fragments were sequenced to verify that only the intended mutation(s) were inserted. The infectivity of the in vitro transcripts from the PstIlinearized p425L-S*, p425L-L* and p425L-SL* was analysed by
inoculating P12 plants. Northern blot hybridization showed that the alteration of Phe'' ! Ser or}and Gln"(& ! Leu in the mutants p425L-S*, p425L-L* and p425L-SL*, respectively, did not have any effect on the infectivity of the transcripts (data not shown). For electron microscopic studies, N. benthamiana plants were infected with the wild-type and mutant RNA 3 transcripts in combination with transcripts from cDNAs 1 and 2 of strain 425L (L. Neeleman & J. F. Bol, unpublished) and a few CP molecules. Initially, samples were assayed as crude extracts (plant material ground in PBS) ; however, the amounts of virus particles were insufficient for accurate calculations and concentrating the virus particles was necessary. Virus particles were isolated at different stages of infection (5–16 days p.i.) from inoculated and systemic leaves according to van VlotenDoting & Jaspars (1972) and examined on carbon-coated grids negatively stained with 2 % uranyl acetate in a JEOL JEM-1000 electron microscope. In our assays we calculated the numbers of particles larger than 65 nm (Table 2), based on the
DBEB
V. Thole, R. Miglino and J. F. Bol
observation of Hull (1970) that the majority of longer particles are in the length groups 70, 83, 96, 108 and 120–130 nm, and some particles of more than 1 µm are found. In general, electron microscopic analyses revealed that virus preparations from infections with the mutated RNA 3 transcripts (Fig. 1 A, B, C) contained, to a great extent, particles characteristic in size of encapsidating RNAs 1, 2, 3 and 4 ; several particles were 2–5 times as long as the particles encoating RNA 1 (56¬18 nm) and a few extremely long (& 300 nm) particles were found. AMV strains VRU (Fig. 1 D) and 15}64 (data not shown), as well as the transcripts T7-VRU-3 or T7-15}64-3 plus 425LRNAs 1 and 2 transcripts (data not shown), showed similar electron microscopic images to those of the mutant RNA 3 transcripts. In contrast, strain 425L (Fig. 1 E) did not contain particles larger than 65 nm (Table 2). Further, the detailed analyses of the electron microscopic images indicated that the mutation of Gln"(& ! Leu led to the assembly of virus particles 4–5 times longer than the RNA 1-containing particles as well as to particles of more than 300 nm in length. However, the mutation of Phe'' ! Ser caused on its own the formation of a small amount of virus particles about 1±5–2 times longer than the RNA 1-containing particles. The particles formed by the double mutant 425L-SL* were similar in size and amount to the ones found with 425L-L* (Table 2 ; Fig. 1 B, C). In the electron micrographs, we observed degradation of long particles which may be due to virus purification as AMV is relatively unstable and can be affected by various agents (for a review, see Hull, 1969). This might have affected the estimation of numbers of long particles and may explain the fact that extremely long particles (300 nm to 1 µm) were rare. However, the particle length distribution observed in this study was consistent with an earlier report (Hull, 1970). There were no significant differences between the particle populations of young and older infections except that in old infections there seemed to be more excessively long particles. Our results indicate that the mutation(s) Phe'' ! Ser or}and Gln"(& ! Leu in the AMV425L CP are sufficient for the formation of unusually long virus particles, whereas Leu"(& may be the main triggering amino acid. In this report we have demonstrated that amino acids Ser'' and Leu"(& of the VRU- and 15}64-CPs are involved in the formation of abnormally long virus particles. The polymorphism of the AMV CP – its incorporation with either a hexagonal or pentagonal symmetry into the protein shell as well as the formation of helical hexamer expansions in the long VRU particles (Cremers et al., 1981) – will be understood with the unravelling of its structure. The role of Ser'' and Lys"(& in the assembly of long particles may be related to the formation of a different secondary structure causing a change in intraand}or intermolecular protein–protein interactions. Castel et al. (1979) predicted that amino acid substitutions in the region containing residues 65–100 influence the secondary structure and may result in the tendency of the VRU CP to polymerize into helical structures.
DBEC
Similar to AMV, ilarviruses have a tripartite RNA genome that is dependent on CP in the inoculum to initiate infection. Although CPs of AMV and ilarviruses are interchangeable in this early step of the replication cycle, these viruses are classified as different genera within the family Bromoviridae. A difference in morphology is one of the major reasons for this separate classification : AMV preparations contain four classes of bacilliform particles whereas ilarvirus preparations consist of four classes of spheroidal particles. However, spheroidal particles are present in AMV preparations, particularly those encapsidating RNA 4, and bacilliform particles are found in preparations of several ilarviruses, notably Tulare apple mosaic virus, Prunus necrotic ringspot virus and prune dwarf virus (Bol & Jaspars, 1994). A spontaneous AMV mutant has been described that produces mainly spheroidal particles with a strong resemblance to ilarvirus particles but also accumulates a low percentage of very long bacilliform particles (Roosien & van Vloten-Doting, 1983). Our results further support the notion that just a few amino acid differences in the respective CPs may be responsible for the difference in morphology between AMV and ilarviruses. We wish to thank Dr R. Hull (John Innes Centre, Norwich, UK) for providing the VRU isolate and Dr E. M. J. Jaspars (Gorlaeus Laboratories, Leiden University, Leiden, NL) for the 15}64 isolate. The authors are also grateful to Dr. W. de Priester and G. Lamers (Institute of Plant Molecular Sciences, Clusius Laboratories, Leiden, NL) for kind assistance in the electron microscopic studies.
References Barker, R. F., Jarvis, N. P., Thompson, D. V., Loesch-Fries, L. S. & Hall, T. C. (1983). Complete nucleotide sequence of alfalfa mosaic virus RNA
3. Nucleic Acids Research 11, 2881–2891. Bol, J. F. & Jaspars, E. M. J. (1994). Alfalfa mosaic virus and ilarviruses.
In Encyclopedia of Virology, vol. 3, pp. 30–35. Edited by R. G. Webster & A. Granoff. London : Academic Press. Bol, J. F. & Lak-Kaashoek, M. (1974). Composition of alfalfa mosaic virus nucleoproteins. Virology 60, 476–484. Bol, J. F., van Vloten-Doting, L. & Jaspars, E. M. J. (1971). A functional equivalence of the top component a RNA and coat protein in the initiation of infection by alfalfa mosaic virus. Virology 46, 73–85. Castel, A., Kraal, B., de Graaf, J. M. & Bosch, L. (1979). The primary structure of the coat protein of alfalfa mosaic virus strain VRU. European Journal of Biochemistry 102, 125–138. Cremers, A. F. M., Oostergetel, G. T., Schilstra, M. J. & Mellema, J. E. (1981). An electron microscopic investigation of the structure of alfalfa
mosaic virus. Journal of Molecular Biology 145, 545–561. Heijtink, R. A. & Jaspars, E. M. (1974). RNA contents of abnormally long particles of certain strains of alfalfa mosaic virus. Virology 59, 371–382. Hull, R. (1969). Alfalfa mosaic virus. Advances in Virus Research 15, 365–433. Hull, R. (1970). Studies on alfalfa mosaic virus. IV. An unusual strain. Virology 42, 282–292. Jaspars, E. M. J. (1985). Interaction of alfalfa mosaic virus nucleic acid and protein. In Molecular Plant Virology, vol. 1, pp. 155–221. Edited by J. W. Davies. Boca Raton, FL : CRC Press.
AMV long particles Kumar, A., Reddy, V. S., Yusibov, V., Chipman, P. R., Hata, Y., Fita, I., Fukuyama, K., Rossmann, M., Loesch-Fries, L. S., Baker, T. S. & Johnson, J. E. (1997). The structure of alfalfa mosaic virus capsid protein
assembled as a T ¯ 1 icosahedral particle at 4±0-AI resolution. Journal of Virology. 71, 7911–7916.
Langereis, K., Mugnier, M., Cornelissen, B. J. C., Pinck, L. & Bol, J. F. (1986). Variable repeats and poly(A)-stretches in the leader sequence of
alfalfa mosaic virus RNA3. Virology 154, 409–414. Mellema, J.-R. & van den Berg, H. J. N. (1974). The quaternary
structure of alfalfa mosaic virus. Journal of Supramolecular Structure 2, 17–31. Neeleman, L., van der Kuyl, A. C. & Bol, J. F. (1991). Role of alfalfa mosaic virus coat protein gene in symptom formation. Virology 181, 687–693. Ravelonandro, M., Pinck, M. & Pinck, L. (1984). Complete nucleotide sequence of RNA3 from alfalfa mosaic virus, strain S. Biochimie 66, 395–402. Roosien, J. & van Vloten-Doting, L. (1983). A mutant of alfalfa mosaic virus with an unusual structure. Virology 126, 155–167.
Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proceedings of the National Academy of Sciences, USA 74, 5463–5467. Taschner, P. E. M., van der Kuyl, A. C. , Neeleman, L. & Bol, J. F. (1991). Replication of an incomplete alfalfa mosaic virus genome in
plants transformed with viral replicase genes. Virology 181, 445–450. van der Kuyl, A. C., Neeleman, L. & Bol, J. F. (1991 a). Complementation and recombination between alfalfa mosaic virus RNA 3 mutants in tobacco plants. Virology 183, 731–738. van der Kuyl, A. C., Neeleman, L. & Bol, J. F. (1991 b). Role of alfalfa mosaic virus coat protein in regulation of the balance between viral plus and minus strand RNA synthesis. Virology 185, 496–499. van der Vossen, E. A. G., Neeleman, L. & Bol, J. F. (1994). Early and late functions of alfalfa mosaic virus coat protein can be mutated separately. Virology 202, 891–903. van Vloten-Doting, L. & Jaspars, E. M. J. (1972). The uncoating of alfalfa mosaic virus by its own RNA. Virology 48, 699–708. Received 2 July 1998 ; Accepted 3 September 1998
DBED
